920
A Novel Multiply Primed Polymerase Chain Reaction Assay for Identification of
Variant papG Genes Encoding the Gal(al-4)Gal-Binding PapG Adhesins of
Escherichia coli
James R. Johnson and Jennifer J. Brown
Department of Medicine, Division oflrifectious Diseases, University of
Minnesota, Minneapolis
A more convenient assay is needed for the three recognized allelic variants of papG, which encode
the Gal(a1-4)Gal-binding adhesin molecules of P fimbriae of uropathogenic Escherichia coli. The
development and validation of a novel multiply primed polymerase chain reaction (PCR) assay is
described. The assay was 100% sensitive and specific for the three papG variants, whether present
individually or in any combination. PCR products specific for the "class I" (papGJ96 ), "class II"
(papG1A2 ), and "class III" (prsGJ96 ) alleles of papG could be resolved by size in the same lane using
agarose gel electrophoresis after simultaneous amplification in a single tube by multiply primed
PCR. This new papG PCR assay should aid future molecular epidemiologic studies that assess the
contribution of the three variants of papG to the pathogenesis of urinary tract infection.
PapG is the adhesin molecule responsible for Gal(al-4)Galspecific adherence to host epithelial surfaces, the major mechanism whereby P fimbriae of uropathogenic Escherichia coli
contribute to the pathogenesis of urinary tract infection (UTI)
[1- 3]. PapG occurs in three recognized variants, which have
been designated galactoside-binding adhesins "classes" I-III
[4, 5]. These variants share a highly conserved carboxy terminus region, which is the portion of the molecule involved in
associations between PapG and other P fimbrial subunits [5,
6]. In contrast, they are strikingly divergent throughout much
of the remainder of the molecule, where the domains that determine receptor specificity are thought to reside [4-6]. This
structural diversity is seen also among the corresponding papG
genes, which are commonly termed papGJ96 , papG1A2 , and
prsGJ96 with reference to the strains of origin of the three
archetypal papG variants [4, 5].
Not surprisingly, the three PapG variants exhibit disparate
receptor specificities and adherence phenotypes. Whereas all
three PapG classes require Gal(al-4)Gal for binding, they have
varying individual preferences for substituents on this consensus core receptor [5, 7-14]. Unfortunately, the pathogenic and
epidemiologic implications of these differences remain largely
unknown, in large part because of the paucity of epidemiologic
studies evaluating these variant adhesins in a clinical context
[15 -1 7]. Given the enormous importance of UTI as a health
care problem [18] and the central role of P fimbriae in urovirulence [1], such studies are sorely needed as a step toward
finding better preventive and therapeutic measures for UTI.
Received 5 September 1995; revised 29 November 1995.
Grant support: National Institutes of Health (DK-47504).
Reprints or correspondence: Dr. James R. Johnson, Medicine/Infectious Diseases, Box 250 UMHC, 14-102 PWB, 420 Delaware St., S.B., Minneapolis,
MN 55455.
The Journal of Infectious Diseases 1996; 173:920-6
© 1996 by The University of Chicago. All rights reserved.
0022-1899/96/7304-0019$01.00
A barrier to carrying out the needed epidemiologic studies
of PapG variants in UTI is the absence of a convenient assay.
Although genotypic identification of papG variants avoids the
ambiguities ofphenotyping [17], it heretofore has required the
use of DNA hybridization studies [4, 15 -17] that are cumbersome and involve hazardous chemicals, possibly including radionuclides [19]. Le Bougenec et a1. [19] developed a multiply
primed polymerase chain reaction (PCR) method for the rapid
detection of pap, sfalfoc, and afa sequences among E. coli
strains. The simplicity and sensitivity of PCR assays [20, 21]
prompted us to investigate the possibility of using PCR to
detect papG variants as an alternative to traditional DNA-DNA
hybridization assays.
PCR has been used to obtain DNA fragments spanning the
papG genes of wild-type strains for comparative DNA sequencing to reveal evolutionary relationships [4]. However, to our
knowledge, PCR has not been used to directly identify papG
variants. We report here our development of a single-tube PCRbased method for sensitive and specific detection of the three
major recognized variants of papG among wild-type E. coli
strains.
Materials and Methods
Bacterial strains. As controls for developing and validating
the papG peR assay, we used strains representing the pap operons
from which the class I-II-III papG model was initially derived [4,
5]. These included the parent wild-type P fimbriated strains J96
(classes I and III) [22-24] and IA2, ADllO, DS17, and GR12
(class II) [4, 24-28], as well as recombinant papG derivatives of
each, that is, JJ48 (papG J96 ), P678-54/pJFK102 (prsG J96 ), HBlOlI
pDCl (papG1AZ ) , HBlOlIpPILIlO-35 (papG ADlIO ), TGlIpGF19
(papG DS17 )' and AGK302 (papGGR12) [4, 6, 12, 24-26, 28, 29].
Negative controls included strains containing sequences for other
(non-P) adhesins ofuropathogenic E. coli, specifically the Dr hemagglutinin (BN406) [30], the afimbrial adhesin (AFA) I (HBlOlI
pILL22) [31], type 1 fimbriae (SH48) [22, 32], and S fimbriae
papG peR Assay
JID 1996; 173 (April)
papGJ96 ("Class I")
papGIA2 ("Gass II")
prsGJ96 ("Class III")
461 bp
190 bp
258 bp
921
j96-193f
TCGTGCfCAGGTCCGGAATIT
j96-653r
TGGCATCCCCCAACATTATCG
ia2.. 383f
GGGATGAGCGGGOCfITGAT
ia2-572r
CGGGCCCCCAAGTAACfCG
prs-l98f
GGCCfGCAATGGATITACCfGG
prs-455r
CCACCAAATGACCATGCCAGAC
Figure 1. Target (papG class), product size, primer name, and primer sequence (5' -3') of primers specific for 3 papG variants. Nos. in
primer names indicate papG coordinate corresponding to initial 5' primer base. f = forward primer, r = reverse primer.
(536-21) [33] and the adhesin-negative strain HBI01 [34]. Strains
were stored in 50% glycerol and Lurill-Bertani (LB) broth [35] at
-70°C and were subcultured on LB agar with antibiotic supplementation as needed.
peR supplies. Molecular biology- grade reagents (dNTPs, bovine serum albumin, and mineral oil) were obtained from Sigma
(St. Louis). AmpliTaq and PCR buffer were obtained from PerkinElmer (Branchburg, NJ). The gel electrophoresis marker was a 1kb DNA ladder (GIBCO BRL, Gaithersburg, MD). All other reagents were obtained from Fisher Scientific (Pittsburgh).
papG primers. Primer pairs specific for each of the three papG
classes (figures 1, 2) were selected on the basis of published sequences of papGJ96> papG1A2 , papGAD! ro, papGDSI7 ' papGGRI2, and
prsGJ96 [4, 5, 24, 26, 28] assisted by computer applications software (Primer, version 0.5; Lincoln SE, Daly MJ, Lander ES
[Whitehead Institute for Biomedical Research, Cambridge, MA];
and Amplify, version 1.2; Engels B [University of Wisconsin,
Madison]). Sequences were aligned according to the method of
Feng and Doolittle [36]. Primers were selected to avoid primerdimer formation with individual or combined primers, to give
different sized PCR products for the three primer pairs (to allow
resolution of PCR products by gel electrophoresis), and to span
the BglII site in papGJ96 and papG1A2 (to allow detection of papG
insertion mutants created as part of ongoing studies in our laboratory [37]). The resulting primer pairs (figure 1) were predicted to
generate PCR products that would substantially overlap the regions
used by others as papG variant-specific DNA probes (figure 2) [4].
None oftheprimers exhibited >67% (range, 40%-67%) sequence
identity with the aligned regions of the other two papG variants
(figure 3).
papG peR methods. Bacteria from overnight broth cultures
were harvested by centrifugation, resuspended in 1/5 vol of sterile
water, boiled for 10 min, and recentrifuged. Supernatant (10 ,uL)
was used as template DNA for PCR. Amplification conditions
were optimized empirically. Amplification was done in a 50-Ji,L
reaction mixture containing template DNA, 4 mM MgCI2 , 0.2 mM
each of the four dNTPs, and 0.045 mM of each primer in 1 X PCR
buffer. The reactions were overlaid with mineral oil and heated to
75°C in an automated thermal cycler (PTC-100-60; MJ Research,
Watertown, MA). After 5.0 U of AmpliTaq was added in a total
volume of 5 ,uL of 1X PCR buffer, the samples were heated at
95°C for 7 min. This initial denaturation was followed by 25 cycles
of denaturation (94°C, I min) and annealing and extension (nOC,
4 min), and a final extension (72°C, 10 min). Samples were electro-.
phoresed in 2% agarose gels, then stained with ethidium bromide,
destained with distilled water, and photographed using UV transillumination.
Sequence determination and restriction digests. Nucleotide sequence of PCR products was determined using the ABI PRISM
Dye Terminator Cycle Sequencing Ready Reaction Kit and run
on an ABI 373 sequencer (both, Perkin-Elmer, Foster City, CA).
For restriction endonuclease analysis of PCR products, amplification products were purified using a concentrator (Spin-X-UF 30 ;
Costar Scientific, Cambridge, MA) and digested with restriction
enzymes using conditions specified by the manufacturer (New England Biolabs, Beverly, MA, or Boehringer Mannheim, Indianapolis). Digestion products were evalu,\ted by agarose gel electrophoresis as described above.
Dilution experiments. DNA extracted from control strains JJ48
(class I), HBlO1/pDC1 (class II),P678-54/pJFK102 (class III),
J96 (classes I + III), and AD 110 (class II) and an equal volume
mix of DNA from strains J96 (classes I + III) and HB101/pDC1
(class II) were combined individually in serial 10-fold dilutions
with DNA from strain HBlOl. These mixed target DNA samples
containing diminishing amounts of pap-positive DNA were subjected to papG PCR using all three primer pairs in combination,
and PCR products were evaluated by agarose gel electrophoresis.
Results
Singly and multiply primed papG peR with individual control strains. When used separately, each of the three papG
primer pairs yielded a single PCR product with each of the
control strains that contained the corresponding papG variant.
In contrast, no PCR product was seen with control strains that
lacked the corresponding papG variant, regardless of whether
the strains contained pap sequences with a different papG vari-
922
Johnson and Brown
JID 1996;173 (April)
l ;96-1931 I
~
papGJ96
Haelll
8gll1
("Class I")
CD
.,.. ----+----+-I. . . . . . .1• • • r"'---+--~--+---""----+---r
II
L .00
,.
I j96-653r I
461
I ia2-3831 I
papGIA2
~
("Class II")
Smat
8gll1
I 8 • • • III . . . . . . . • II+--~-"""--""---""---"""--"""r
'-
.,..
prs-1981
Haemt
----+----"_
.,..
""0
ia2-572r
-
190
~
CD
I
prsGJ96
Xmnl
I
Hinctl
,*I---
-~--
C'Class III"}
---+---+----+---rL~o
.,..
I prs-455r I
258---~~•
KEY
......I
Restriction site
8gll1
~
or
•••
~
Primer recognition site
PCR product
Probe region
I prs-455r I Primer
Figure 2. Maps of 3 papG variants. Triangles indicate recognition sites for papG-specific primers shown in figures I and 3. Solid bar below
each map indicates size and location of predicted PCR product. Dashed line between restriction sites indicates region used by others as probe
for particular papG variant [4]. Coordinates of cleavage sites for enzymes used in restriction endonuclease analysis of PCR products are BglII,
490 (papGJ96 ) and 493 (papG IA2 ); XmnI, 324 (prsGJ96 ).
ant; no pap sequences, but determinants for a non-P E. coli
adhesin; or no adhesin sequences at all (not shown). In every
instance, the PCR product was of precisely the size predicted
for the particular primer pair (not shown).
When the three primer pairs were used together in combination, results were consistent with the sum of the individual
primer pair PCR results. Each strain exhibited the same band
(or combination of bands) seen in the separate single primer
pair reactions (figure 4). The three papG variants could be
amplified in a single reaction by multiply primed PCR, and the
corresponding PCR products readily resolved by size using
agarose gel electrophoresis, when the papG variants were present together in any combination (e.g., figure 4, lane m; data
not shown for classes I + II and classes II + III target DNA
combinations). No amplification was seen with target DNA
from strains with non-P adhesins ofuropathogenic E. coli (figure 4). In both the singly and multiply primed assays, DNAfree blanks were consistently negative (not shown).
Confirmation ofpapG PCR products. To confirm that the
amplification products obtained by multiply primed papG PCR
JID 1996; 173 (April)
papG peR Assay
j96-653r
Figure 3. Sequences of papG
variant-specific primers (shown in
bold) vs. corresponding regions in
other papG variants. Sequences are
5' to 3'. Ellipses represent gaps introduced for optimal alignment of
papG variants [36]. Bases are underlined in aligned papG sequences
where identical to bases in corresponding primer. Class I = papGJ96 ;
class II = pap G1A2 , papGADllO,
papGDS17 ' and papGGR12; class III =
prsGJ96 (pap-2GJ96 ). *At position 17
of the Class I forward primer (j96193f), A in aligned Class II sequence
is G inpapGDS17 •
ia2-383f
Class I:
TCGTGCTCAGGTCCGGAATTT
Class II:
CAGTGTAATGGTCCTGAGTTC *
Class III:
AT!ITQGC~T§.CAATGGATTTA
Class I:
TGGCATCCCCCAACATTATCG
Class II:
CGGCATCCGCCGATATTC~TA
Class ITI:
CGGCATCCTCCGGTATTT~TA
Class I:
CCCATACATGGA~AAAXAAT
Class II:
GGGATGAGCGGGCCTTTGAT
923
Class ITI: GGGATGAAG ••• ~AAACACA
ia2-572r
prs-l98f
Class I:
T~ATCCTG~CAG.AGATCAT
CI~II:
CGGGCCCCCAAG.TAACTCG
Class III:
~T.
Class I:
§.CTQA§.GTCCGGAATTTG~GAGTGC
Class II:
~TAATIiGTCCTGAGTTCGgTGATGG
TCCACCAATA!MTCAT
Class III: GGCCTGCAATGGATTTACC ••• TOO
prs-455r
Class I:
AgCCTGAATACTAAATCATTAAATTTAT.TGTTCAAC
Class II:
TGTTT AAAAATAATATCGTCAAATTTCTCA~TCAGAC
Class III: CC ••••••• ACCAAATGACCA •••••••• TGCCAGAC
from the control strains truly represented the expected papG
sequences, nucleotide sequence was determined for the class I
and class III papG PCR products from strain J96 and for the
class II papG PCR product from strain IA2 (figure 4). In each
instance, the experimentally determined sequence exhibited
>90% identity with the published sequence of the corresponding
region of papGJ96 , prsGJ96 , or papG1AZ , respectively (not shown).
As a simple confirmatory test for larger scale use, papG
PCR products from strains J96 and IA2 were subjected to
restriction endonuclease analysis with enzymes predicted to
have unique cleavage sites either in the class I and class II
PCR products only (BglII) or in the class III PCR product only
(Xmnl) (figures 2, 5). Digestion with BglIl yielded cleavage
fragments of the predicted sizes for both the class I and class
II PCR products (figure 5, lanes c and f), but left the class III
PCR product intact (figure 5, lane c). In contrast, digestion
with Xmnl yielded cleavage fragments of the predicted sizes
for the class III PCR product (figure 5, lane d) but left the
class I and class II PCR products intact (figure 5, lanes d and
g). Similar class-specific restriction digest results were obtained
with the multiply primed papG peR products from each of the
remaining control strains in figure 4 (not shown).
Sensitivity of the papG peR assay in mixed DNA samples.
To determine if the assay could detect papG sequences in
mixed samples in which the papG-positive component constituted only a minor fraction of the total target DNA, we used
the three primer pairs in combination to assay artificial mixtures
of DNA from positive control strains diluted with DNA from
the adhesin-negative strain HB 101. When a single papG variant
was present in the target, PCR products were easily visibleeven when the pap-positive component of the target DNA was
diluted from 10-4 to 10- 7 (depending on the papG variant)
with DNA from HB101. Products representing each of the
three classes of papG could be detected simultaneously by
multiply primed PCR when target DNA containing all three
papG variants was diluted to 10- 3 (not shown).
924
Johnson and Brown
J
9
6
"Class b
II" +
clones c
1018
506,517
396
298
220,201
154,134
Figure 4. Multiply primed papG PCR with positive and negative
control strains. PCR was done using all 3 papG variant primer pairs
combined. Sizes ofPCR products: class I-III, respectively, 461, 190,
and 258 bp. Lanes: a, molecular weight markers; b, J96; c, IA2; d,
ADllO; e, DS17; f, GR12; g, JJ48; h, P678-54/pJFKI02; i, HBlOl/
pDC1; j, HB10l/pPILllO-35; k, TGl/pGF19; 1, AGK302; m, J96 +
IA2 (combined); n, BN406; 0, HBlOl/pILL22; p, SH48; and q, 53621.
Discussion
papG PCR assay characteristics. Our novel multiply
primed papG PCR assay was 100% sensitive and specific in
identifying the three recognized genetic variants of the P fimbrial adhesin gene papG [4, 5] among positive and negative
control strains that contained determinants for one or more
variant P adhesins or determinants for diverse other (non-P) E.
coli adhesins (figure 4). The assay worked equally well with
wild type and recombinant control strains (figure 4).
The precise concordance ofPCR positivity with the predicted
combinations of primer pairs and known target DNAs, as well
as the generation in each instance of PCR products of exactly
the predicted size for the particular combination of primers and
target DNAs (figure 4), strongly suggested that the assay is
specific for the papG sequences of interest. This was confirmed
by nucleotide sequence determination and restriction endonuclease analysis (figure 5) of PCR products.
Advantages ofPCR assay for papG genotype determination.
Conventional DNA hybridization methods, such as those used
heretofore to detect papG variants [4, 15-17], involve substantially more "hands-on" steps than our PCR assay, take ;::::3
days to complete, and require substantial additional time for
preparation and labeling of probes [19]. Furthermore, separate
probes and hybridizations are required for each of the three
papG alleles. In contrast, our PCR assay was simple to perform,
and results were available the next day. Moreover, the compatibility of the three primer pairs and the different sizes of the
corresponding PCR products allowed the three papG alleles to
JID 1996; 173 (April)
be resolved easily by gel electrophoresis after single-tube PCR,
even when present together in a single specimen (figure 4).
The PCR assay also avoided the use of phenol, chloroform,
and radionuclides. Thus, our papG PCR assay represents a
significant advance over existing methods for detailed P adhesin genotype characterization of uropathogenic E. coli [4].
PCR assay for defining the papG genotype of wild-type
strains. A major application for our papG PCR assay should
be to define the papG genotype of wild-type E. coli strains
from patients with various clinical UTI syndromes (or other
types of infection) and from the fecal flora of healthy hosts,
as done with DNA hybridization assays [4, 15 -17]. Such applications will clarify the clinical significance of the three papG
alleles. In our initial use of this new assay with wild-type
pap-positive strains of undetermined papG genotype, we have
already encountered several strains within serogroup 04 that
exhibit the same papG genotype configuration (i.e., class I +
III alleles) as strain J96, which heretofore was the only strain
known to contain the class I (papGJ96 ) allele [15] (unpublished
data). The availability of a simple, rapid PCR assay for papG
alleles should facilitate further exploration of the prevalence
and epidemiologic significance of the class I variant of papG
and of the other two papG variants.
Use of the PCR assay with mixed bacterial samples. In
contrast to traditional approaches, with PCR, an entire (mixed)
bacterial population can be sampled at once, eliminating the
IA2
B X 4- B X
b c d e f g
J'6
la
+
506,517
396
34A
298
220,20 I
154,134
7S
Figure 5. Restriction analysis of papG PCR products from strains
J96 and IA2. Lanes: a, molecular weight marker; b-d, strain J96 (b,
uncut; c, BgnI digest; d, XmnI digest); and e-g, strain IA2 (e, uncut;
f, BgnI digest; g, XmnI digest). In lane c, BgnI cleaved 461-bp class
I band into 298- and l63-bp fragments without affecting 259-bp class
III band. In lane d, XmnI cleaved 258-bp class III band into 131- and
127-bp fragments without affecting 461-bp class I band. In lane f,
BgnI cleaved 190-bp class II band into 111- and 79-bp fragments,
whereas in lane g, XmnI left class II band intact.
JID 1996; 173 (April)
papG peR Assay
need for isolation and separate testing of individual colonies.
In control experiments, our PCR assay was still able to detect
papG sequences when DNA prepared from a pap-positive
strain was mixed with DNA from a pap-negative strain in
a ratio of 1: 103 - 1:107 . This suggests that for mixed clinical
specimens, a single papG PCR reaction should be able to provide the same sensitivity in detecting papG-positive strains
as that achieved by separate examination of 103 _10 7 isolated
colonies, which clearly is an impossible alternative.
The markedly enhanced sensitivity of our PCR assay for
identifying a minor papG-positive component within a mixed
sample should be extremely valuable for studies of intestinal
or vaginal colonization with P fimbriated E. coli [15, 17, 3840]. In a prospective cohort study involving the members of
3 families, we have found that whereas the predominant colonizing E. coli strains were rarely pap-positive, nearly half of
the corresponding mixed intestinal and vaginal specimens contained papG PCR-positive DNA (unpublished data). Furthermore, several instances of possible simultaneous colonization
with the same pap-positive strain involving 2 individuals within
the same family were suggested by the finding of the same
papG allele in mixed cultures from specimens collected simultaneously from siblings or sex partners, despite the dissimilarity
and pap-negativity of the predominant strain(s) [41] from these
same specimens (unpublished data).
In conclusion, we have developed and rigorously tested a
novel, multiply primed PCR method for simultaneous detection
of the three major genetic variants of papG, the gene encoding
the Gal(al-4)Gal-binding adhesin molecule of P fimbriae of
uropathogenic E. coli. This method can be used to define the
papG genotype of individual E. coli strains in pure culture or
to screen for the presence of papG sequences in mixed samples
containing multiple organisms. The simplicity, accuracy, and
sensitivity of our new papG PCR assay should make it a useful
tool for molecular epidemiologic studies addressing the clinical
and pathogenic significance of the three allelic variants of
papG.
Acknowledgments
We thank our colleagues for providing the strains used in the
study (Barbara Minshew: J96; Scott Hultgren: AD110 and HB 1011
pPILllO-35; David Haslam: DS17 and TG1IpGF19; Sheila Hull:
GR12, AGK302, P678-54/pJFKI02, and SH48; Steve Clegg: IA2
and HBlOlIpDCl; Bogdan Nowicki: BN406 and HBlOlIpILL22;
and Harry Mobley: 536-21), Jodi Aasmundrud for manuscript
preparation, and Bill Oetting, Katherine Staskus, and Neal Dalton
for helpful suggestions and assistance with the DNA software.
References
1. Johnson JR. Virulence factors in Escherichia coli urinary tract infection.
Clin Microbiol Rev 1991;4:80-128.
925
2. Hoschutzky H, Lottspeich F, Jann K. Isolation and characterization of the
a-galactosyl-l,4-,B-galactosyl-specific adhesin (P adhesin) from fimbriated Escherichia coli. Infect Immun 1989; 57:76-81.
3. Lund B, Lindberg F, Marklund BI, Normark S. The papG protein is the
a-D-galactopyranosyl-(l-4)-,B-D-galactopyranose-binding adhesin of
uropathogenic Escherichia coli. Proc Nat! Acad Sci USA
1987; 84:5898-902.
4. Marklund BI, Tennent JM, Garcia E, et al. Horizontal gene transfer of
the Escherichia coli pap and prs pili operons as a mechanism for the
development of tissue-specific adhesive properties. Mol Microbiol
1992; 6:2225 -42.
5. Stromberg M, Marklund BI, Lund B, et al. Host-specificity of uropathogenic Escherichia coli depends on differences in binding specificity to
Galal-4Gal-containing isoreceptors. EMBO J 1990;9:2001-10.
6. Klann AG, Hull RA, Palzkill T, Hull SI. Alanine-scanning mutagenesis
reveals residues involved in binding of pap-3 -encoded pili. J Bacteriol
1994; 176:2312-7.
7. Senior D, Baker N, Cedergren B, et al. Globo-A-a new receptor specificity for attaching Escherichia coli. FEBS Lett 1988;237:123-7.
8. Lund B, Marklund EI, Stromberg N, Lindberg F, Karlsson KA, Normark
S. Uropathogenic Escherichia coli can express serologically identical
pili of different receptor binding specificities. Mol Microbiol
1988;2:255-63.
9. Stromberg N, Nyholm PG, Pascher I, Normark S. Saccharide orientation
at the cell surface affects glycolipid receptor function. Proc Nat! Acad
Sci USA 1991; 88:9340-4.
10. Lindstedt R, Baker N, Falk P, et al. Binding specificities of wild-type and
cloned Escherichia coli strains that recognize Globo-A. Infect Immun·
1989; 57:3389-94.
11. Lindstedt R, Larson G, Falk P, Jodal U, Leffler H, Svanborg C. The
receptor repertoire defines the host range for attaching Escherichia coli
strains that recognize Globo-A. Infect Immun 1991; 59: 1086-92.
12. Karr IF, Nowicki B, Truong LD, Hull RA, Hull SI. Purified P fimbriae
from two cloned gene clusters of a single pyelonephritogenic strain
adhere to unique structures in the human kidney. Infect Immun
1989; 57:3594-600.
13. Karr IF, Nowicki BJ, Truong LD, Hull RA, Moulds JJ, Hull SI. pap-2encoded fimbriae adhere to the P blood group-related glycosphingolipid stage-specific embryonic antigen 4 in the human kidney. Infect
Immun 1990;58:4055-62.
14. Johanson I, Lindstedt R, Svanborg C. Roles of the pap-and prs-encoded
adhesins in Escherichia coli adherence to human uroepithelial cells.
Infect Immun 1992;60:3416-22.
15. Johanson 1M, Plos K, Marklund BI, Svanborg C. Pap, papG and prsG
DNA sequences in Escherichia coli from the fecal flora and the urinary
tract. Microb Pathog 1993; 15:121-9.
16. Otto G, Sandberg T, Marklund EI, Ulleryd P, Svanborg C. Virulence
factors and pap genotype in Escherichia coli isolates from women with
acute pyelonephritis, with or without bacteremia. Clin Infect Dis
1993; 17:448-56.
17. Plos K, Connell H, Jodal U, et al. Intestinal carriage of P fimbriated
Escherichia coli and the susceptibility to urinary tract infection in young
children. J Infect Dis 1995; 171 :625 - 31.
18. Johnson JR, Stamm WE. Urinary tract infections in women: diagnosis and
treatment. Ann Intern Med 1989; III :906-17.
19. Le Bouguenec C, Archambaud M, Labigne A. Rapid and specific detection
of the pap, afa, and sfa adhesin-encoding operons in uropathogenic
Escherichia coli strains by polymerase chain reaction. J Clin Microbiol
1992; 30: 1189-93.
20. Persing DH. Polymerase chain reaction: trenches to benches. J Clin MicrobioI 1991;29:1281-5.
21. Naber SP. Molecular pathology-diagnosis of infectious disease [review].
N Engl J Med 1994;331:1212-5.
22. Hull FA, Gill RE, Hsu P, Minshew BH, Falkow S. Construction and
expression of recombinant plasmids encoding type 1 or D-Mannose-
926
23.
24.
25.
26.
27.
28.
29.
30.
31.
Johnson and Brown
resistant pili from a urinary tract infection Escherichia coli isolate.
Infect Immun 1981;33:933-8.
Minshew BH, Jorgensen J, Counts GW, Falkow S. Association of hemolysin production, hemagglutination of human erythrocytes, and virulence
for chicken embryos of extraintestinal Escherichia coli isolates. Infect
Immun 1978; 20:50-4.
Lund B, Lindberg F, Normark S. Structure and antigenic properties ofthe
tip-located P pilus proteins of uropathogenic Escherichia coli. J Bacteriol 1988; 170: 1887-94.
Clegg S, Pierce JK. Organization of genes responsible for the production of
mannose-resistant fimbriae of a uropathogenic Escherichia coli isolate.
Infect Immun 1983;42:900-6.
Van Die I, van den Hondel C, Hamstra HJ, Hoekstra W, Bergmans H.
Studies on the fimbriae of an Escherichia coli 06:K2:HI:F7 strain:
molecular cloning of a· DNA fragment encoding a fimbrial antigen
responsible for mannose-resistant hemagglutination of human erythrocytes. FEMS Microbiol Lett 1983; 19:77-82.
Tullus K, Harlin K, Svenson SB, Kallenius G. Epidemic outbreaks of
acute pyelonephritis caused by nosocomial spread ofP fimbriated Escherichia coli in children. J Infect Dis 1984; 150:728-36.
Klann AG, Hull RA, Hull SI. Sequences of the genes encoding the minor
tip components of pap-3 pili of Escherichia coli. Gene 1992; 119:95100.
Johnson JR, Swanson JL, Neill MA. Avian PI antigens inhibit agglutination
mediated by P fimbriae ofuropathogenic Escherichia coli. Infect Immun
1992; 60:578-83.
Nowicki B, Barrish JP, Korhonen T, Hull RA, Hull SI. Molecular cloning
of the Escherichia coli 075X adhesin. Infect Immun 1987;55:316873.
Labigne-Roussel AF, Lark D, Schoolnik G, Falknow S. Cloning and expression ofan afimbrial adhesin (AFA-I) responsible for P blood groupindependent, mannose-resistant hemagglutination from a pyelonephritic
Escherichia coli strain. Infect Immun 1984;46:251-9.
JID 1996; 173 (April)
32. Orndorff PE, Falkow S. Organization and expression of genes responsible
for type 1 piliation in Escherichia coli. J Bacteriol 1984; 159:736-44.
33. Hacker J, Schmidt G, Hughes C, Knapp S, Marget M, Goebel W. Cloning
and characterization of genes involved in production of mannose-resistant, neuraminidase-susceptible (X) fimbriae from a uropathogenic
06:KI5:H31 Escherichia coli strain. Infect Immun 1985;47:434-40.
34. Boyer HW, Roulland-Dussoix D. A complementation analysis of the restriction and modification of DNA in Escherichia coli. J Mol BioI
1969;41:459-72.
35. Maniatis T, Fritsch EF, Sambrook 1. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press,
1982.
36. Feng DF, Doolittle RF. Progressive sequence alignment as a prerequisite
to correct phylogenetic trees. J Mol Evol 1987; 25:351-60.
37. Johnson JR, Berggren T. Creation of virulence factor "knockout" mutants
of wild-type uropathogenic Escherichia coli strains using a sucroseselectable suicide plasmid. In: Proceedings of the annual meeting of the
American Society for Microbiology (Atlanta). Washington, DC: ASM,
1993.
38. Stapleton A, Hooton TM, Fennell C, Roberts PL, Stamm WE. Effect
of secretor status on vaginal and rectal colonization with fimbriated
Escherichia coli in women with and without recurrent urinary tract
infection. J Infect Dis 1995; 171:717-20.
39. Wold AE, Caugant DA, Lidin-Janson G, de Man P, Svanborg C. Resident
colonic Escherichia coli strains frequently display uropathogenic characteristics. J Infect Dis 1992; 165:46-52.
40. Tullus K, Fryklund B, Berglund B, Kallenius G, Burman LG. Influence
of age on faecal carriage of P-fimbriated Escherichia coli and other
gram-negative bacteria in hospitalized neonates. J Hosp Infect
1988; 11:349-56.
41. Lidin-Janson G, Kaijser B, Lincoln K, OIling S, Wedel H. The homogeneity of the faecal coliform flora of normal school-girls, characterized by
serological and biochemical properties. Med Microbiol Immunol (Berl)
1978; 164:247-53.