Human Reproduction Vol.21, No.9 pp. 2281–2289, 2006
doi:10.1093/humrep/del176
Advance Access publication June 8, 2006.
Identification of estrogen receptor b-positive intraepithelial
lymphocytes and their possible roles in normal and tubal
pregnancy oviducts
Shirendeb Ulziibat1,2, Kuniaki Ejima1, Yasuaki Shibata3, Yoshitaka Hishikawa1,
Michio Kitajima2, Akira Fujishita2, Tadayuki Ishimaru2,5 and Takehiko Koji1,4
1
Division of Histology and Cell Biology, Department of Developmental and Reconstructive Medicine, Nagasaki University Graduate
School of Biomedical Sciences, 2Department of Obstetrics and Gynecology, Nagasaki University School of Medicine and 3Division
of Oral Pathology and Bone Metabolism, Department of Developmental and Reconstructive Medicine, Nagasaki University Graduate
School of Biomedical Sciences, Nagasaki, Japan
4
To whom correspondence should be addressed at: Division of Histology and Cell Biology, Department of Developmental and
Reconstructive Medicine, Nagasaki University Graduate School of Biomedical Sciences, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan.
E-mail: [email protected]
5
Present address: Sasebo Chuo Hospital, Sasebo, Nagasaki, Japan
BACKGROUND: Although intraepithelial lymphocytes (IELs) in human oviductal epithelium have been implicated in
the regulation of local immunity, the precise kinetics and mechanism of steroid regulation of IEL are largely unknown.
METHODS: We examined the localization of estrogen receptors (ERs) and progesterone receptors (PRs) in 41 human
oviducts by immunohistochemistry. These tissues were obtained from various menstrual cycles, also from both postmenopausal women and tubal pregnancies. The expressions of ERb mRNA and membrane (m)PR mRNA were examined
by in situ hybridization and RT–PCR, respectively. RESULTS: Most of the IEL expressed ERb at both mRNA and protein levels. The number of ERb-positive IEL, which were identified as CD8-positive T lymphocytes and also were mPR
positive, was increased in the late proliferative, the mid-secretory and late secretory phases in normally cycling women
(P < 0.05). Interestingly, in tubal pregnancy, ERb-positive IELs were consistently abundant. In addition, we found a high
Ki-67-labelling index for IEL, although ERa was entirely absent in the tubal pregnancy oviducts. CONCLUSIONS:
These results suggest that the number of IEL fluctuated because of estrogen and progesterone levels probably through
ERb and mPR, respectively. ERb-positive IEL may be involved in regulating immune tolerance in tubal pregnancy oviducts.
Key words: estrogen receptors/human oviduct/intraepithelial lymphocytes/membrane progesterone receptor/tubal pregnancy
Introduction
Intraepithelial lymphocytes (IELs) in human oviductal
mucous membranes are involved in the regulation of local
immune tolerance, such that sperm and blastocysts are transported through the oviduct without the activation of a local
immune reaction (Kutteh et al., 1990). A dysfunctional local
immunity may damage the epithelial function, including oviduct transportation. Mammalian oviduct consists of ciliated
cells, secretory cells and basal cells (Verhage et al., 1979;
Crow et al., 1994). Of these, the basal cells are considered
unique and are morphologically characterized in rabbit oviduct as specialized lymphocytes (Odor, 1974). However,
detailed knowledge of the IEL in human oviduct is limited. In
particular, the responsiveness of the cell kinetics to sex steroids such as estrogen and progesterone would be worthy of
analysis because the structure and function of oviduct are
highly dependent upon steroid action.
Ectopic pregnancies are responsible for ∼10% of all maternal
mortality (Dorfman, 1983), among which 99% are tubal pregnancies occurring in the ampullaris part of the oviduct (Seifer
et al., 1995). The major cause of tubal pregnancy is postulated
to be the dysfunction of the ciliated cells due to various infectious diseases (Walters et al., 1988; McGee et al., 1999). However, the involvement of local immunity mediated by the IEL
in this process is poorly understood. Moreover, serum levels of
estrogen and progesterone are generally lower in patients with
ectopic pregnancy, and the expression of estrogen receptor
(ER)α and progesterone receptor (PR) is also decreased, compared with normal pregnancy (Radwanska et al., 1978; Sadan
et al., 2002).
Estrogen is crucial for maintaining the structure and function
of various female reproductive organs via binding to specific
classical nuclear ERα and the newly identified ERβ (Kuiper
et al., 1996). However, ERβ may act via a molecular mechanism
© The Author 2006. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved.
For Permissions, please email: [email protected]
2281
S.Ulziibat et al.
different from that of ERα in various tissues including reproductive organs such as uterus, ovary, mammary gland, prostate
and intestine (Critchley et al., 2001; Lecce et al., 2001;
Hishikawa et al., 2003, 2004; Tsurusaki et al., 2003; Kawano
et al., 2004; Tamaru et al., 2004). In the normal epithelium and
stroma of the human oviduct, ERα increases in the follicular
phase, reaching a peak at mid-cycle and then decreasing in the
late luteal phase (Amso et al., 1994). In contrast, expression
studies of ERβ in mammalian oviducts have yielded significant
discrepancies (Saunders et al., 1997; Wang et al., 2000). Wang
et al. (2000) reported no expression of ERβ protein in the luminal epithelium of rat oviduct, whereas Taylor and Al-Azzawi
(2000) reported ERβ expression in the cytoplasm of ciliated
epithelial and stromal cells in normal human oviduct, although
they did not examine the menstrual cycle dependency of this
expression pattern. Therefore, the precise role of ERβ in normal and tubal pregnancy oviducts is not fully understood.
Progesterone is also a key component in the regulation of
growth, development and function in female reproductive tissues via binding to PR (Brenner et al., 1991; Slayden et al.,
1993; Noe et al., 1999; Gava et al., 2004). Classical PRs (PR A
and PR B) are localized in the nuclei of epithelial and stromal
cells but not IEL in mammalian and human oviducts (Amso
et al., 1994; Christow et al., 2002; Sun et al., 2003; Ulbrich
et al., 2003). Recently, the presence of membrane PR (mPR)
was reported in the rat granulosa cells, in bovine corpus luteum
cells of the female reproductive system and in human testis
(Peluso et al., 2001; Bramley et al., 2002; Shah et al., 2005).
However, the expression of mPR in human oviduct remains to
be clarified.
This study aimed to clarify the population kinetics of IEL in
human normal and tubal pregnancy oviducts and to clarify the
menstrual cycle-dependent expression and localization of
ERα, ERβ and PR in human oviduct using in situ hybridization
(ISH) and immunohistochemistry. We also examined the
expression of mPR mRNA in the oviducts to understand
the responsiveness to progesterone, by RT–PCR and ISH. On
the basis of the findings, we discuss the possible role of ERβpositive IEL in the mucosal immune system in normal and
tubal pregnancy oviducts.
proliferative phase (n = 4), late proliferative phase (n = 8), early secretory phase (n = 4), mid-secretory phase (n = 5) and late secretory
phase (n = 4). All specimens were collected in accordance with the
guidelines of the Declaration of Helsinki and with the approval of the
Nagasaki University Institutional Review Board.
Immunohistochemistry
Tissue samples were fixed in 4% paraformaldehyde (PFA; Merck,
Darmstadt, Germany) in 10 mM phosphate-buffered saline (PBS) and
embedded in paraffin using standard procedures. The tissues were cut
into 4-μm-thick sections and were dewaxed with toluene and rehydrated through a graded ethanol series. The sections were autoclaved
at 120°C for 15 min (except CD3) in 10 mM sodium citrate (pH 6.0).
After the inhibition of endogenous peroxidase activity with 0.3%
H2O2 in methanol for 15 min, the sections were pre-incubated with
500 μg ml–1 of normal goat IgG (Sigma Chemical, St Louis, MO,
USA) and 1% bovine serum albumin in PBS for 1 h. Then, the sections were reacted with the primary antibodies (Table I) overnight.
After washing with 0.075% Brij 35 in PBS, the sections were incubated with horse-radish peroxidase (HRP)-labelled goat anti-mouse
IgG (1:100; Chemicon International, Temecula, CA, USA) or HRPlabelled goat anti-rabbit IgG (1:200; MBL, Nagoya, Japan) for 1 h.
The sites of HRP were visualized with 3,3′-diaminobenzidine (DAB;
Dojin Chemical Co., Kumamoto, Japan), Ni2+, Co2+ and H2O2. As a
negative control, some sections were reacted with normal mouse or
rabbit IgG (Sigma Chemical) at the same concentrations instead of the
specific antibodies.
RNA isolation and RT–PCR of mPR mRNA
The oviduct tissue was frozen immediately with liquid nitrogen and
crushed using a Multi-Beads Shocker (Yasui Kikai, Nagoya, Japan).
Total RNA was extracted from the sample powder using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the instructions
provided by the manufacturer. Aliquots of 2 μg of total RNA were
reverse-transcribed with True Script II reverse transcriptase (Sawady
Technology, Tokyo, Japan) in the presence of an oligo(dT) primer.
Using a Light Cycler instrument (Roche Molecular Biochemicals,
Mannheim, Germany), the cDNAs were amplified with specific primers and DNA Master SYBR Green I kit according to the instructions
provided by the manufacturer. The primer sequences used for amplification were selected with the aid of Primer 3 software (Whitehead
Institute for Biomedical Research, Cambridge, UK) and were as follows: forward, 5′-GTGCACCAAGAGCAAAGGAT-3′; reverse, 5′GGAGAGCAAACACCTGTTCC-3′. The region of PCR amplification
was 980–1487, GenBank accession no. NM_006667; Gerdes et al.,
Materials and methods
Patients
Ampullaris parts of human oviduct were obtained from 41 patients
with informed consent: 25 premenopausal patients (aged 35–49 years)
with regular menstrual cycles (28-33 day intervals), eight post-menopausal patients (aged 52–78 years) who had undergone hysterectomy
and bilateral salpingo-oophorectomy due to uterine fibroids and eight
patients (aged 21–33 years) who underwent salpingoectomy for tubal
pregnancy. None of the patients had been treated with any hormonal
medications for a minimum of 3 months before tissue sampling. In all
patients, accurate menstrual dating could be carried out according to
the last and next menstrual periods and the basal body temperature.
This was corroborated with appropriate histologic dating of
endometrium as described previously (Gompel and Silverberg, 1994;
Ishimaru et al., 2004; Khan et al., 2005).
The surgical specimens were classified according to menstrual
cycle and histological examination into the following groups: early
2282
Table I. List of primary antibodies for immunohistochemistry
Antigen
Antibody
Working
dilution
Source
ERα
ERβ
PR
ER88a
ERβ88b
PR88a
(PR A and PR B)
MIB-1a
PS1a
L26a
1A5a
4B12a
1:160
1:200
1:40
Biogenex (San Ramon, CA, USA)
Biogenex (San Ramon, CA, USA)
Biogenex (San Ramon, CA, USA)
1:100
1:50
1:50
1:100
1:100
Immunotech (Marseille, France)
Immunotech (Marseille, France)
Immunotech (Marseille, France)
MBL (Nagoya, Japan)
MBL (Nagoya, Japan)
Ki-67
CD3
CD20
CD8
CD4
ER, estrogen receptor; MBL, Medical and Biological Laboratories; PR, progesterone receptor.
a
Mouse monoclonal antibody.
b
Rabbit polyclonal antibody.
Intraepithelial lymphocytes in human oviduct
1998). Thus, the expected size of amplified DNA was 507 bp. Each
PCR cycle consisted of denaturation at 94°C for 3 min, annealing at
55°C for 15 s and extension at 72°C for 40 s. Thirty-five cycles were
performed, followed by a final extension at 72°C for 5 min. To confirm the specificity of the PCR product, the electrophoretic patterns of
Hind III digests were analysed. Moreover, the corresponding PCR
product was size-fractionated and subcloned into pGEM-T Easy Vector (Promega, Madison, WI, USA) to confirm the specificity of the
PCR product. The PCR products were sequenced by CER 8000 Beckman Coulter, and the product of each primer pair was confirmed in
both directions (forward and reverse). The PCR product was compared with published human mPR sequences by BLAST similarity
search (http://www.ncbi.nlm.nih.gov), and we found 100% homology
with the published mPR sequences (Gerdes et al., 1998).
Laser microdissection
Frozen sections (5–20 μm) of the oviducts were cut and mounted on
glass slides covered with PEN foil (2.5 μm thick; Leica Microsystems, Wetzlar, Germany) for the microdissection system. The sections
were stained with haematoxylin, followed by eosin and then air-dried.
A part of the epithelium, stroma or the IEL was dissected from the
frozen sections of the oviduct with the Laser microdissection (LMD)
system, as described previously (Kolble, 2000). The samples were
immediately placed into 30 μl of Trizol solution, and total RNA was
extracted from the epithelium, stroma and IEL, as described above.
Preparation of oligo-DNA probes
A 45-base sequence corresponding to ERβ mRNA, nucleotide no.
861-905 (Tsurusaki et al., 2003), and a 39-base sequence corresponding to human mPR cDNA, nucleotide no. 102-140, were selected
(Gerdes et al., 1998). These antisense and sense sequences were synthesized together with two and three TTA repeats, at the 5′ and 3′
ends, and used as probes after haptenization with thymine–thymine
(T–T) dimer, as described previously in detail (Koji and Nakane,
1996). The sequence of antisense probe for ERβ was 5′-TTATTA-C
ACTAGCTGCTCGGGGCTCAGGGCGTCCAGCAGCAGCTCCC
GCAC-ATTATTATT-3′ (Tsurusaki et al., 2003). The sequence of
antisense probe for mPR was 5′-TTATTA-GGGTCGGCGCCAGT
CGCCACCACATCCTCGGCAGCCAT-ATTATTATT-3′.
A computer-assisted search of GenBank for the above antisense and
sense sequences revealed no significant homology with any known
sequences. The T–T dimer was introduced into the oligo-DNAs by
UV irradiation (254 nm) at a dose of 12 000 J m–2. The generation of
T–T dimer was verified immunochemically using a mouse monoclonal
HRP-labelled anti-T–T IgG (1:80; Kyowa Medex, Tokyo, Japan).
ISH for ERb and mPR mRNA
Before ISH, we performed dot-blot hybridization analysis to determine the specificity and sensitivity of the DNA probe (Yoshii et al.,
1995; Koji and Nakane, 1996; Koji, 2000). Non-radioactive ISH was
performed as described previously (Koji and Brenner, 1993; Yoshii
et al., 1995; Koji and Nakane, 1996; Fujishita et al., 1997; Koji, 2000;
Shirota et al., 2005). The sections were treated with 0.3% H2O2 in
methanol for 15 min to inhibit endogenous peroxidase activity, followed by 0.2 N HCl for 20 min and 50 μg ml–1 of proteinase K (Wako
Pure Chemicals, Osaka, Japan) at 37°C for 15 min. After post-fixation
with 4% PFA in PBS, the sections were immersed in 2 mg ml–1 of
glycine in PBS for 30 min and kept in 40% deionized formamide
(Nacalai Tesque, Kyoto, Japan) in 4 × standard saline citrate (SSC)
until used for hybridization. Hybridization was carried out for 15 h at
37°C with 2 μg ml–1 of T–T dimerized antisense oligo-DNA for ERβ
and mPR dissolved in the hybridization medium. Then, the slides
were washed three times with 2 × SSC/50% formamide/0.075% Brij
35, twice with 0.5× SSC/50% formamide/0.075% Brij 35 and finally
followed by 2 × SSC. The signals were detected immunohistochemically, as described previously (Koji and Brenner, 1993; Yoshii et al.,
1995; Koji and Nakane, 1996; Fujishita et al., 1997; Koji, 2000;
Shirota et al., 2005). In every run, consecutive tissue sections were
hybridized with T–T dimerized ERβ and mPR sense oligo-DNA as a
negative control. To evaluate the level of hybridizable RNAs in the
tissue sections, a 28S rRNA probe was used as a positive control
(Yoshii et al., 1995). Furthermore, some sections were hybridized
with antisense probe in the presence of an excess amount of unlabelled antisense or unlabelled sense probe to provide definitive evidence for the sequence specificity of the signal.
Statistical analysis
For quantitative analysis, more than 2000 cells were counted in random fields at ×400 magnification, and the number of IEL, ERβ-positive and Ki-67-positive cells was expressed as a percentage of positive
cells per total number of counted cells. The number of IEL positive
for Ki-67 and CD8 was counted in more than 200 IELs and expressed
as a percentage of positive cells per total number of counted cells. Cell
counts were performed in a blind fashion by three individuals. The
data are expressed as mean ± SEM. Differences between groups
were examined for statistical significance using the Student’s t-test.
P < 0.05 denoted a statistically significant difference. All analyses
were performed with a statistical software package (StatView, version
5.0; Abacus Concepts, Berkeley, CA, USA).
Results
Immunohistochemical identification of lymphocyte markers
in the IEL
To confirm the IEL cell type, we performed immunohistochemistry for T- and B-lymphocyte markers. The T-lymphocyte
cell marker (T-supressor), CD8, was detected in all IEL
(Figure 1A). Most of the IELs showed co-staining for CD3
(pan-T cell) (data not shown). However, no staining was
detected for either CD4 (T helper) or CD20 (B-lymphocyte
marker) (data not shown).
Kinetics of IEL density
Next, we performed quantitative analysis of the IEL. The
percentage of IEL per total number of epithelial cells was
increased in the late proliferative (9.2 ± 0.6%) and late secretory (8.9 ± 0.5%) menstrual phase and in tubal pregnancies (9.1
± 0.5%), whereas there was a significant decrease in the
proportion of IEL in the early secretory phase (5.3 ± 1.1%) and
post-menopausal (6.7 ± 0.6%) specimens (Figure 1C).
Immunohistochemical localization of Ki-67 and CD8 in
human oviduct
The IEL were then immunostained for Ki-67, a marker of
proliferating cells. Ki-67 was localized in the nuclei of the IEL
and secretory cells of the epithelium (Figure 2A and C) and all
of the Ki-67-positive IEL co-expressed CD8 (Figure 2B and D).
The labelling index revealed a marked increase in Ki-67-positive
IEL in tubal pregnancy (6.1 ± 0.5%), early proliferative phase
(4.5 ± 0.5%) and late secretory phase cases (3.5 ± 0.9%) than
in the post-menopausal women (1.0 ± 0.2%) (Figure 2E). In
2283
S.Ulziibat et al.
A
B
C
*
*
*
*
*
10
of secretory cells and not detected in the ciliated cells (Figure 3B,
E, H and K). Virtually all of the IEL were ERβ-positive, and
the intensity of ERβ staining was much stronger in these cells
than in the secretory cells. ERβ was also localized in the
stromal cells and vascular endothelial cells. Interestingly, ERβpositive IEL and stromal cells were abundant in tubal pregnancy oviducts (Figure 3K); however, there was no substantial
difference in the intensity of ERβ staining between premenopausal and post-menopausal oviducts; ERβ was still detected
in the epithelial and stromal cells of post-menopausal oviduct
(Figure 3H). Quantitative analysis of the ERβ-positive IEL
staining revealed similar data to that shown in Figure 1C
because all IELs were positive for ERβ (data not shown).
% of IEL /epithelial cells
8
ISH of ERb mRNA in human oviduct
6
4
2
0
y
e
y e
e
y
y
tiv rativ etor etor etor aus anc
a
r
r
r
r
p
n
e
fe lif
ec sec sec no
eg
oli
p r e pr o r l y s i d - a t e t - m e a l p r
y
M L os
t
rl
b
Ea
La
P
Ea
Tu
Figure 1. Immunohistochemical analysis of T lymphocytes in oviduct during mid-secretory phase. Oviduct tissue sections were incubated with anti-CD8 antibody (A) or normal mouse IgG (B) as a
negative control. Arrows indicate the CD8-positive intraepithelial
lymphocytes (IEL) of human oviduct. Scale bar = 20 μm. Original
magnification ×400. (C) Quantitative analysis of IEL per epithelial
cells during menstrual cycling, in post-menopausal and tubal pregnancy oviducts. Data are presented as the mean ± SEM. *P < 0.05.
contrast, the index of secretory cells was increased in the late
proliferative-phase (5.0 ± 0.9%), early secretory-phase (5.5 ±
1.5%) and tubal pregnancy (4.4 ± 1.4%) cases but significantly
decreased in the early proliferative (0.7 ± 0.5%) and late secretory phases (0.8 ± 0.5%) (Figure 2F).
Immunohistochemical localization of ERa, ERb and PR in
human oviduct
Immunohistochemistry of ERα, ERβ and PR in the premenopausal, post-menopausal and tubal pregnancy oviducts
revealed staining for ERα and PR in the nuclei of secretory
epithelial cells but not in the ciliated cells, IEL or endothelial
cells during the normal menstrual cycle (Figure 3). The
staining intensity for ERα and PR was very high in the late
proliferative phase but was significantly decreased in the midsecretory phase (Figure 3A, C, D and F). However, the expression of these proteins in the oviduct epithelial cells was almost
completely lost in post-menopausal women, whereas the
stroma retained the same levels as during menstrual cycling
(Figure 3G and I). In tubal pregnancies, ERα was not found in
any cell of the oviduct, whereas PR was expressed in the secretory cells and stromal cells but not in IEL (Figure 3J and L).
In contrast, ERβ expression was predominantly seen in the
nuclei of IEL and secretory cells, weakly detected in the cytoplasm
2284
Next, we performed ISH for ERβ mRNA to examine its synthesis. As shown in Figure 4A, ERβ mRNA was localized in the
IEL, epithelial cells, stromal cells and vascular endothelial cells
of the oviduct tissue. Mirror sections indicated that the cellular
distribution of ERβ mRNA was essentially similar to that of ERβ
protein (Figure 4B). No significant staining was detected when
adjacent sections were reacted with the sense probe (Figure 4C).
In addition, when adjacent sections were hybridized with ERβ
antisense probe in the presence of a 100-fold excess amount of
unlabelled corresponding antisense oligo-DNA, the signal for
ERβ mRNA was markedly decreased (Figure 4D).
Kinetics of CD8-positive IEL and its correlation with
ERb-positive IEL
Approximately 90.5 ± 3.0% of the IEL showed immunostaining
for CD8 during the normal menstrual cycle, in post-menopausal
and in tubal pregnancy oviducts (Figure 5A). Moreover, to
clarify the association between the expression of CD8 and
ERβ, we immunostained serial sections of IEL during menstrual
cycles. As shown in Figure 5B, all CD8-positive IELs were
also ERβ positive (Figure 5C).
Expression of mPR mRNA in human oviduct detected by
RT–PCR using LMD and ISH
To address the possible mechanism by which progesterone regulates IEL proliferation, we examined the expression of mPR
mRNA, because PR A and PR B were not detected in the IEL
(Figure 6). RT–PCR to assess whether mPR mRNA is expressed in
human oviduct tissue revealed a single band of 507 bp (Figure 6A).
A control sample without reverse transcriptase revealed that the
extract was free of genomic mPR DNA contamination. The specificity of the PCR product was confirmed by digestion with
Hind III, revealing two fragments of 325 and 182 bp (Figure 6A).
Next, we localized mPR mRNA in the epithelial and stromal
parts of the oviduct tissue, which were separated by LMD. The
staining intensity of the 507-bp band was much higher in the epithelial cells than in the stroma (Figure 6B). To clarify whether
IEL express mPR mRNA, the IELs (about 100 cells) were dissected by LMD and the extract was analysed by RT–PCR,
revealing a significant band of 507 bp, as expected (Figure 6C).
Finally, we identified mPR mRNA-positive cells in the sections of human oviduct by ISH. Before the experiment, we
Intraepithelial lymphocytes in human oviduct
CD 8
A
B
C
D
*
E
F
*
*
Ki-67-positive IEL/ total IEL (%)
8
7
6
*
**
5
4
3
2
1
0
ve tive ory ory ory use
cy
t
t
ati
t
an
n
fl er lifera cre ecre ecre nopa
i
g
s
ro
re
e
se -s
ro
y p te p arly Mid Late st-m bal p
l
r
E
Ea
La
Po
Tu
*
8
**
Ki-67-positive secretory cells /
total secretory cells (%)
Ki-67
7
*
*
*
6
5
4
3
2
1
0
ve ive tory tory tory use
cy
ati rat
an
re cre cre opa
n
c
fli er life
g
e
se en
se -se
ro
ro
pr
y p ate p arly Mid Late st-m bal
l
r
E
L
Po
Tu
Ea
Figure 2. Immunohistochemical analysis of Ki-67 and CD8 in the oviduct of premenopausal women. The panels were obtained from the late
proliferative phase (A and B) and from the late secretory phase (C and D). Arrows indicate Ki-67-positive cells in the intraepithelial lymphocytes
(IEL) (A and C). Ki-67 and CD8 were co-localized in the same IEL in serial sections (A–D). Scale bar = 20 μm. Original magnification ×400.
Quantitative analysis of Ki-67-positive IEL (E) and Ki-67-positive secretory cells (F) during menstrual cycling, in post-menopausal and tubal
pregnancy oviducts. Data are presented as the mean ± SEM. *P < 0.05, **P < 0.001.
confirmed the sensitivity and specificity of the probes by dotblot hybridization and determined that the T–T dimerized mPR
antisense oligo-DNA could detect down to 10-pg mPR sense
DNA specifically (data not shown). ISH of the oviductal sections of the secretory phase localized mPR mRNA in IEL,
secretory cells and some stromal cells but not in ciliated cells
(Figure 7B). The transcript staining intensity was markedly
higher in the IEL than in the secretory cells. Moreover, the
intensity of signal in the IEL did not change during the menstrual phases (data not shown). No significant staining was
2285
S.Ulziibat et al.
Figure 3. Immunohistochemical analysis of estrogen receptor (ER)α , ERβ and progesterone receptor (PR) in human oviduct during the menstrual cycle, post-menopause and tubal pregnancy. Oviduct tissue sections were reacted with anti-ERα (A, D, G and J), anti-ERβ (B, E, H and K)
and anti-PR (C, F, I and L). The panels were obtained from the late proliferative phase (A–C), from the mid-secretory phase (D–F) of the
menstrual cycle, from post-menopausal women (G–I) and tubal pregnancy (J–L). Arrows indicate positive cells. ERα and PR disappeared in the
epithelial cells but not the stromal cells in post-menopausal women compared with premenopausal women (G and I). In tubal pregnancy, ERα
disappeared from epithelium and stroma (J), whereas PR was expressed in the epithelium and stroma (L). ERβ was expressed strongly in the
intraepithelial lymphocytes (IEL), secretory cells, endothelial cells and some stromal cells of premenopausal, post-menopausal women and tubal
pregnancy (B, E, H and K). S, secretory cell; E, endothelial cell; St, stroma; Ep, epithelium. Scale bar = 20 μm. Original magnification ×400.
2286
Intraepithelial lymphocytes in human oviduct
Figure 4. Localization of estrogen receptor (ER)β by in situ hybridization and immunohistochemistry in mirror sections of oviduct during mid-secretory phase. (A) ERβ antisense thymine–thymine (T–T)
dimerized oligo-DNA probe. ERβ mRNA was strongly expressed in
the intraepithelial lymphocytes, epithelial cells and some stromal
cells. (B) Expression of ERβ protein in the oviduct. (C) ERβ sense
T–T dimerized oligo-DNA probe as a negative control. (D) Competition assay; the section was hybridized with ERβ antisense probe in
the presence of a 100-fold excess amount of unlabelled corresponding antisense oligo-DNA. Arrows indicate cells positive for ERβ
mRNA (A) and ERβ protein (B). Scale bar = 20 μm. Original magnification ×400.
CD8-positive IEL/ total IEL (%)
A
100
80
60
40
20
0
e
y
y
y
ve tive
cy
us
or
to r
tor
ati
re opa gnan
re cret
c
fl er lifera
c
i
se en
se -se
re
ro
ro
rly Mid Late st-m bal p
y p te p
l
a
r
E
Po
Ea
La
Tu
ER
CD8
B
C
Figure 6. (A) RT–PCR analysis of membrane progesterone receptor
(mPR) mRNA in extracts of human oviduct tissue in secretory phase.
M, DNA molecular weight marker; 1, mPR mRNA; 2, a negative control with no cDNA. The PCR product was digested with Hind III, producing two DNA fragments of 325 and 182 bp (3). (B) RT–PCR analysis
of mPR mRNA in extracts of epithelium (Ep) and stroma (St) from the
human oviduct in secretory phase. (C) RT–PCR analysis of mPR
mRNA in extracts from intraepithelial lymphocytes (IEL) of human
oviduct in secretory phase.
detected when adjacent sections were hybridized with the
sense probe (Figure 7C). In addition, when adjacent sections
were hybridized with mPR antisense probes in the presence
of a 100-fold excess amount of unlabelled corresponding
antisense oligo-DNA, the signal was markedly decreased
(Figure 7D).
Discussion
Figure 5. Quantitative analysis of CD8-positive intraepithelial
lymphocytes (IEL) per total IEL during menstrual cycling in postmenopausal and tubal pregnancy oviducts. Immunohistochemical analysis of CD8 and ERβ in oviduct during mid-secretory phase. Arrows
indicate that CD8 (B) and ERβ (C) were co-localized in the same IEL
in serial sections. Scale bar = 20 μm. Original magnification ×400.
This study provides new information regarding the expression
and localization of ERβ mRNA and protein in normal human
oviduct during the menstrual cycling. We found that ERβ was
specifically co-expressed in CD8-positive IEL and secretory
cells of the epithelium. Interestingly, the number of ERβ-positive
IEL in the oviducts fluctuated depending on the menstrual
2287
S.Ulziibat et al.
Figure 7. In situ localization of membrane progesterone receptor
(mPR) mRNA expression in the oviduct during secretory phase. (A)
28S rRNA complementary oligo-DNA. (B) mPR mRNA antisense
oligo-DNA. (C) mPR sense oligo-DNA. (D) Competition assay; the
section was hybridized with mPR mRNA antisense probe in the presence of a 100-fold excess amount of unlabelled corresponding antisense oligo-DNA. Arrows indicate positive cells. Scale bar = 20 μm.
Original magnification ×400.
cycles and seemed to increase in a progesterone-dependent
manner. This increase was probably mediated via mPR, the
expression of which was reported for the first time in oviductal
epithelial cells including IEL. Moreover, in oviduct from cases
of tubal pregnancy, the number of ERβ-positive IEL was
increased significantly, possibly indicating damage to the local
immune system in the oviduct.
A better understanding of the function and hormonal regulation of the oviduct epithelium is important for reproductive
biology because the normal transport of sperm and blastocysts
through the oviduct relies on the inhibition of local immunity
(Kutteh et al., 1990). IELs in human oviduct are positive for
CD8 and CD3 (Kutteh et al., 1990). Moreover, CD8-positive
IELs are also expressed in normal intestine (Brimnes et al.,
2005) where they play a possible role in mediating immune tolerance to luminal antigens by suppressing the immune
response. In this study, we show for the first time that the CD8positive IELs in human oviduct were also positive for ERβ.
ERβ expression has also been reported in the infiltrating leucocytes of the rat vagina (Wang et al., 2000) and human cervix
(Stygar et al., 2001); therefore, we postulated that the IEL in
oviduct epithelia might play a key role in the inflammatory
response causing tubal pregnancy (Witkin, 2002). In our study,
2288
the number of ERβ-positive IEL was increased significantly in
the tubal pregnancy samples, whereas ERα was not found in the
epithelium or stroma of any tubal pregnancy oviducts (eight
cases). Sadan et al. (2002) also reported that ERα was
expressed in only one case of the 12 tubal pregnancy oviducts.
This finding implicates ERβ, but not ERα, as a dominant
hormonal player in the oviduct of tubal pregnancies. It may
therefore be proposed that differential expression of ERα and
ERβ in tubal pregnancy oviduct is involved in the abnormal
transport of the fertilized oocyte into the uterus.
It is well known that plasma levels of estrogen increase
during the proliferative phase of the menstrual cycle, whereas
progesterone levels increase during the secretory phase (Palter
and Olive, 2002). This study revealed that the population density of ERβ-positive IEL altered biphasically in premenopausal
women; one peak was in the proliferative phase, and the other
was in the mid-secretory and late secretory phases. These
results may indicate that the proliferative-phase peak of IEL is
mediated by estrogen via ERβ, whereas the peak in the midsecretory and late secretory phases indicates possible regulation of IEL by progesterone via PR. As classical PR A and PR
B were not detected in the IEL during the menstrual cycle, we
examined the involvement of a new type of PR, mPR, which is
localized in the cell membrane (Peluso et al., 2001; Bramley
et al., 2002; Shah et al., 2005). Indeed, mPR mRNA was
detected in the oviduct IEL. We also found that the number of
Ki-67-positive IEL correlated exactly with ERβ and mPR
expression and was significantly increased in the early proliferative phase and the late secretory phase. Interestingly, in tubal
pregnancy oviducts, the number of Ki-67- and ERβ-positive
IEL increased significantly, probably reflecting an increased
proliferation of IEL possibly mediated via ERβ. Taken
together with these results, our findings indicate that the fluctuation and the proliferative activity of IEL in the premenopausal
oviduct may be associated with the plasma levels of estrogen
via ERβ and progesterone via mPR, respectively.
In conclusion, we found that the IEL of human oviduct
expressed ERβ and mPR and that the number of IEL fluctuated, probably because of estrogen levels in the proliferative
phase and progesterone levels during the secretory phase.
Furthermore, our study strongly implicated the possible
involvement of ERβ-positive IEL in regulating immune function in normal and tubal pregnancy oviducts.
Acknowledgements
We thank Dr Keiko Shukuwa for excellent technical assistance (Division of Histology and Cell Biology, Department of Developmental
and Reconstructive Medicine, Nagasaki University Graduate School
of Biomedical Sciences) and Dr Koichi Hiraki for sample collection
(Department of Obstetrics and Gynecology, Nagasaki University
School of Medicine). This study was supported in part by a Grant-inAid for Scientific Research from the Japanese Ministry of Education,
Science, Sports and Culture (nos 1247003, 15390058 and 16659047).
References
Amso NN, Crow J and Shaw RW (1994) Comparative immunohistochemical
study of oestrogen and progesterone receptors in the fallopian tube and
uterus at different stages of the menstrual cycle and the menopause. Hum
Reprod 9,1027–1037.
Intraepithelial lymphocytes in human oviduct
Bramley TA, Menzies GS, Rae MT and Scobie G (2002) Non-genomic steroid
receptors in the bovine ovary. Domest Anim Endocrinol 23,3–12.
Brenner RM, McClellan MC, West NB, Novy MJ, Haluska GJ and Sternfeld
MD (1991) Estrogen and progestin receptors in the macaque endometrium.
Ann N Y Acad Sci 622,149–166.
Brimnes J, Allez M, Dotan I, Shao L, Nakazawa A and Mayer L (2005)
Defects in CD8+ regulatory T cells in the lamina propria of patients with
inflammatory bowel disease. J Immunol 174,5814–5822.
Christow A, Sun X and Gemzell-Danielsson K (2002) Effect of mifepristone
and levonorgestrel on expression of steroid receptors in the human Fallopian
tube. Mol Hum Reprod 8,333–340.
Critchley HO, Brenner RM, Henderson TA, Williams K, Nayak NR, Slayden
OD, Millar MR and Saunders PT (2001) Estrogen receptor beta, but not estrogen receptor alpha, is present in the vascular endothelium of the human and
nonhuman primate endometrium. J Clin Endocrinol Metab 86,1370–1378.
Crow J, Amso NN, Lewin J and Shaw RW (1994) Morphology and ultrastructure of fallopian tube epithelium at different stages of the menstrual cycle
and menopause. Hum Reprod 9,2224–2233.
Dorfman SF (1983) Deaths from ectopic pregnancy, United States, 1979 to
1980. Obstet Gynecol 62,334–338.
Fujishita A, Nakane PK, Koji T, Masuzaki H, Chavez RO, Yamabe T and
Ishimaru T (1997) Expression of estrogen and progesterone receptors in
endometrium and peritoneal endometriosis: immunohistochemical and in
situ hybridization study. Fertil Steril 67,856–864.
Gava N, Clarke CL, Byth K, Arnett-Mansfield RL and deFazio A (2004)
Expression of progesterone receptors A and B in the mouse ovary during the
estrous cycle. Endocrinology 145,3487–3494.
Gerdes D, Wehling M, Leube B and Falkenstein E (1998) Cloning and tissue
expression of two putative steroid membrane receptors. Biol Chem
379,907–911.
Gompel C and Silverberg SG (1994) Cyclical variation of endometrium. In
Gompel C and Silverberg SG (eds) Pathology of Gynecology and Obstetrics. Lippincott, Philadelphia, PA, pp. 171–205.
Hishikawa Y, Damavandi E, Izumi S and Koji T (2003) Molecular and histochemical analysis of estrogen receptors α and β expressions in the mouse
ovary: in situ hybridization and southwestern histochemistry. Med Electron
Microsc 36,67–73.
Hishikawa Y, Tamaru N, Ejima K, Hayashi T and Koji T (2004) Expression of
keratinocyte growth factor and its receptor in human breast cancer: its inhibitory role in the induction of apoptosis possibly through the overexpression
of Bcl-2. Arch Histol Cytol 67,455–464.
Ishimaru T, Khan KN, Fujishita A, Kitajima M and Masuzaki H (2004)
Hepatocyte growth factor may be involved in cellular changes to the
peritoneal mesothelium adjacent to pelvic endometriosis. Fertil Steril
81,810–818.
Kawano N, Koji T, Hishikawa Y, Murase K, Murata I and Kohno S (2004)
Identification and localization of estrogen receptor α- and β-positive cells in
adult male and female mouse intestine at various estrogen levels. Histochem
Cell Biol 121,399–405.
Khan KN, Masuzaki H, Fujishita A, Kitajima M, Sekine I, Matsuyama T and
Ishimaru T (2005) Estrogen and progesterone receptor expression in macrophages and regulation of hepatocyte growth factor by ovarian steroids in
women with endometriosis. Hum Reprod 20,2004–2013.
Koji T (2000) Springer Laboratory Manual: Molecular Histochemical Techniques. Springer-Verlag, Tokyo.
Koji T and Brenner RM (1993) Localization of estrogen receptor messenger ribonucleic acid in rhesus monkey uterus by nonradioactive in situ
hybridization with digoxigenin-labeled oligonucleotides. Endocrinology
132,382–392.
Koji T and Nakane PK (1996) Recent advances in molecular histochemical
techniques: in situ hybridization and southwestern histochemistry. J Electron Microsc 45,119–127.
Kolble K (2000) The LEICA microdissection system: design and applications.
J Mol Med 78,24–25.
Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S and Gustafsson JA (1996)
Cloning of a novel estrogen receptor expressed in rat prostate and ovary.
Proc Natl Acad Sci USA 93,5925–5930.
Kutteh WH, Blackwell RE, Gore H, Kutteh CC, Carr BR and Mestecky J
(1990) Secretory immune system of the female reproductive tract II. Local
immune system in normal and infected fallopian tube. Fertil Steril 54,51–55.
Lecce G, Meduri G, Ancelin M, Bergeron C and Perrot-Applanat M (2001)
Presence of estrogen receptor β in the human endometrium through the
cycle: expression in glandular, stromal and vascular cells. J Clin Endocrinol
Metab 86,1379–1386.
McGee ZA, Jensen RL, Clemens CM, Taylor-Robinson D, Johnson AP and
Gregg CR (1999) Gonococcal infection of human fallopian tube mucosa in
organ culture: relationship of mucosal tissue TNF-alpha concentration to
sloughing of ciliated cells. Sex Transm Dis 26,160–165.
Noe M, Kunz G, Herbertz M, Mall G and Leyendecker G (1999) The cyclic
pattern of the immunocytochemical expression of oestrogen and progesterone receptors in human myometrial and endometrial layers: characterization
of the endometrial-subendometrial unit. Hum Reprod 14,190–197.
Odor DL (1974) The question of “basal” cells in oviductal and endocervical
epithelium. Fertil Steril 25,1047–1062.
Palter SF and Olive DL (2002) Reproductive physiology. In Berek JS (ed.)
Novak’s Gynecology, 13th edn. Lippincott Williams & Wilkins, Philadelphia,
PA, pp. 160–161.
Peluso JJ, Fernandez G, Pappalardo A and White BA (2001) Characterization
of a putative membrane receptor for progesterone in rat granulosa cells. Biol
Reprod 65,94–101.
Radwanska E, Frankenberg J and Allen EI (1978) Plasma progesterone levels
in normal and abnormal early human pregnancy. Fertil Steril 30,398–402.
Sadan O, Ginath S, Rotmensch S, Boaz M, Golan A and Glezerman M (2002)
Role of steroid receptors in the pathogenesis of tubal pregnancy. J Reprod
Med 47,1031–1034.
Saunders PTK, Maguire SM, Gaughan J and Millar MR (1997) Expression of
estrogen receptor beta (ERβ) in multiple rat tissues visualized by immunohistochemistry. J Endocrinol 154,13–16.
Seifer DB, DeCherney AH, Bartimus J and Frickleton J (1995) Complications
of early pregnancy. In O’Grady JP, Gimovsky ML and McIlhargie CJ (eds)
Operative Obstetrics. Williams & Wilkins, Baltimore, MD, pp. 4–5.
Shah C, Modi D, Sachdeva G, Gadkar S and Puri C (2005) Coexistence of
intracellular and membrane-bound progesterone receptors in human testis. J
Clin Endocrinol Metab 90,474–483.
Shirota K, Tateishi K, Koji T, Hishikawa Y, Hachisuga T, Kuroki M and
Kawarabayashi T (2005) Early human preantral follicles have relaxin and
relaxin receptor (LGR7), and relaxin promotes their development. J Clin
Endocrinol Metab 90,516–521.
Slayden OD, Hirst JJ and Brenner RM (1993) Estrogen action in the reproductive tract of rhesus monkeys during antiprogestin treatment. Endocrinology
132,1845–1856.
Stygar D, Wang H, Vladic YS, Ekman G, Eriksson H and Sahlin L (2001) Colocalization of estrogen receptor β and leucocyte markers in the human
cervix. Mol Hum Reprod 7,881–886.
Sun X, Christow A, Marions L and Gemzell-Danielsson K (2003) Progesterone receptor isoform B in the human fallopian tube and endometrium
following mifepristone. Contraception 67,319–326.
Tamaru N, Hishikawa Y, Ejima K, Nagasue N, Inoue S, Muramatsu M,
Hayashi T and Koji T (2004) Estrogen receptor-associated expression of
keratinocyte growth factor and its possible role in the inhibition of apoptosis
in human breast cancer. Lab Invest 84,1460–1471.
Taylor AH and Al-Azzawi F (2000) Immunolocalization of estrogen receptor
beta in human tissues. J Mol Endocrinol 24,145–155.
Tsurusaki T, Aoki D, Kanetake H, Inoue S, Muramatsu M, Hishikawa Y and
Koji T (2003) Zone-dependent expression of estrogen receptors alpha and
beta in human benign prostatic hyperplasia. J Clin Endocrinol Metab
88,1333–1340.
Ulbrich SE, Kettler A and Einspanier R (2003) Expression and localization
of estrogen receptor α, estrogen receptor β and progesterone receptor in
the bovine oviduct in vivo and in vitro. J Steroid Biochem Mol Biol
84,279–289.
Verhage HG, Bareither ML, Jaffe RC and Akbar M (1979) Cyclic changes in
ciliation, secretion and cell height of oviductal epithelium in women. Am J
Anat 156,505–521.
Walters MD, Eddy CA, Gibbs RS, Schachter J, Holden AE and Pauerstein CJ
(1988) Antibodies to Chlamydia trachomatis and risk for tubal pregnancy.
Am J Obstet Gynecol 159,942–946.
Wang H, Eriksson H and Sahlin L (2000) Estrogen receptors α and β in the
female reproductive tract of the rat during the estrous cycle. Biol Reprod
63,1331–1340.
Witkin SS (2002) Immunological aspects of genital chlamydia infections. Best
Pract Res Clin Obstet Gynaecol 16,865–874.
Yoshii A, Koji T, Ohsawa N and Nakane PK (1995) In situ localization of
ribosomal RNAs is a reliable reference for hybridizable RNA in tissue
sections. J Histochem Cytochem 43,321–327.
Submitted on March 10, 2006; resubmitted on April 18, 2006; accepted on
April 25, 2006
2289