Published December 4, 2014
NANOG is a key factor for induction of pluripotency
in bovine adult fibroblasts1
H. Sumer, J. Liu, L. F. Malaver-Ortega, M. L. Lim, K. Khodadadi, and P. J. Verma2
Centre for Reproduction and Development, Monash Institute of Medical Research,
Monash University, Clayton 3168, Victoria, Australia
ABSTRACT: Since the first reports on isolation of
pluripotent mouse embryonic stem (ES) cells 3 decades
ago, there have been numerous attempts to derive ES
cell lines from commercially important livestock species
with limited success. The recent discovery that ectopic
expression of a handful of stem cell-related genes was capable of inducing pluripotency in rodents and primates
provided a novel approach to derivation of pluripotent
stem cell lines. We used this approach in cattle and
demonstrated that the ectopic expression of POU5F1
(also known as Oct4), SOX2, KLF4, and c-MYC alone
was not sufficient for stable induction of pluripotency
in bovine adult fibroblasts and that the additional expression of NANOG to the reprogramming cocktail was
essential for the generation of stable bovine (b) induced
pluripotent stem (iPS) cells. The resulting biPS cells
were characterized by reverse-transcription PCR for a
panel of ES marker genes. Immunocytochemical localization of POU5F1, SSEA-1, SSEA-4, and colorimetic
alkaline phosphatase activity was measured in the iPS
clones. The differentiation potential of the biPS cells
was determined in vitro by expression of differentiation
markers in embryoid bodies. Injection of biPS into immunocompromised mice resulted in teratomas containing cell types of the 3 germ lineages. This study reports
the first generation of bovine induced pluripotent cell
lines and paves the way for the use of biPS cells for
biotechnological and agricultural purposes.
Key words: induced pluripotent stem cell, reprogramming
©2011 American Society of Animal Science. All rights reserved.
J. Anim. Sci. 2011. 89:2708–2716
doi:10.2527/jas.2010-3666
INTRODUCTION
Mouse and human somatic cells can be reprogrammed
to a pluripotent state by the ectopic expression of the
transcription factors Oct4 and Sox2, in combination
with c-Myc and Klf-4 (Takahashi and Yamanaka, 2006)
or with NANOG and LIN28 (Yu et al., 2007). The resulting induced pluripotent stem (iPS) cells exhibit
similarities to embryonic stem (ES) cells with regard to
gene expression profile, epigenetic state, differentiation
potential both in vitro and in vivo, and ability to give
rise to germ line competent chimeras (Takahashi and
Yamanaka, 2006; Okita et al., 2007). Reprogrammed
1
This project was supported by seed funding from Dairy Australia, funding from the Dairy Futures Cooperative Research Centres,
and Monash Institute of Medical Research infrastructure funding
supported by the Victorian government’s Operational Infrastructure
Support Program (Melbourne, Australia).
2
Corresponding author: [email protected]
Received November 5, 2010.
Accepted March 28, 2011.
iPS cells have been established from several species including monkeys (Liu et al., 2008), rats (Li et al., 2009;
Liao et al., 2009), and pigs (Esteban et al., 2009; Ezashi
et al., 2009; Wu et al., 2009; West et al., 2010).
The bovine is an important agricultural species with
significant commercial value and also is an attractive
large model for biomedical and biotechnology research.
The generation of robust bovine pluripotent stem cell
lines may allow for complex genetic manipulations, including gene knockin and knockout technology. Bovine
iPS cells may redefine our ability to develop transgenic
cattle for the production of therapeutic proteins in their
milk, to introduce disease resistance and other valuable
traits, or to introduce genetic material to develop large
animal models for research.
In this study we demonstrate that ectopic expression
of POU5F1, SOX2, KLF4, and c-MYC alone was insufficient for stable induction of pluripotency in bovine
adult fibroblasts. The addition of NANOG, a key regulator of pluripotency, to the retroviral induction cocktail was essential for generation of bovine iPS (biPS).
The pluripotential properties of the resulting biPS cells
were characterized both in vitro and in vivo.
2708
Bovine induced pluripotent stem cells
MATERIALS AND METHODS
All animal experimentation was conducted with protocols and ethics approved by the Monash Medical
Centre Animal Welfare Committee.
Cell Culture
Bovine adult fibroblasts (BAF), derived from
the skin of the ear obtained from abattoir material,
were cultured in Dulbecco’s modified Eagle medium
(DMEM, Invitrogen, Mulgrave, Australia) supplemented with 15% Hyclone fetal bovine serum, 1 mM l-glutamine (Invitrogen), 1% nonessential AA (Invitrogen),
and 0.5% penicillin-streptomycin (Invitrogen). After
viral transduction, bovine cells were cultured in bovine
ES medium; Minimum Essential Medium Alpha (Invitrogen) supplemented with 20% Hyclon fetal bovine serum (Thermo Scientific, Scoresby, Australia), 1 mM lglutamine, 0.1 mM β-mercaptoethanol (Sigma, Castle
Hill, Australia), 1% nonessential AA, 0.5% penicillinstreptomycin, insulin-transferrin-selenium (Invitrogen),
10 ng/mL of bovine fibroblast growth factor (FGF),
and 4 ng/mL of human (h) leukemia inhibitory factor
(LIF, Millipore, North Ryde, Australia). Cultures were
maintained in a humidified incubator at 39°C, with 5%
CO2 in air.
Cell Differentiation
For embryoid body formation, 1 × 106 cells were
plated on Petri dishes in bovine ES medium minus LIF
and bovine FGF for 14 d. To examine teratoma formation, 2 to 4 × 106 cells were injected into the rear leg
muscle of 4- to 6-wk-old severe combined immunodeficient (SCID) mice (Animal Resource Centre, Canning
Vale, Australia). All mice were housed at the Monash
Medical Centre Animal Facilities, Clayton, Australia.
After 8 wk, the mice were euthanized. The teratomas
were excised and fixed in 4% paraformaldehyde, embedded in paraffin, sectioned at 5 µM, and stained with
hematoxylin and eosin by the Histology Laboratory
core facility at Monash Institute of Medical Research.
Optimization of Viral Transduction
The retroviral vector, pMX-GFP, was transfected
into PLAT-A packaging cells stably expressing gag, pol,
and env genes (Cell BioLabs, Jomar Biosciences, Kensington, Australia) for the production of amphotropic
virus. The production of pseudotyped retrovirus was
accomplished by transfection of pMX-GFP and pVSVG into GP2-293 cells (Clontech Retroviral Gene Transfer, Clontech, Scientifix, Cheltenham, Australia). Infectious lentiviral particles were produced by transfection
of HEK293T with pMX-GFP and plasmids coding for
2709
GAG-POL and ENV (a kind gift from R. Jaenisch,
Whitehead Institute, MIT, Cambridge, MA). Culture
supernatants containing the retrovirions or lentivirus
were collected and used for all BAF transduction optimization parameters. Transduction efficiencies were
determined by flow cytometry using a MoFlo BTA cytometer and Summit software (Dako, Bella Vista, Australia).
Retroviral Transduction of Cells
and Induction of Pluripotency
The biPS cells were generated from BAF as described
previously for mice (Takahashi et al., 2007a; Sumer et
al., 2009), with some modifications. Briefly, the Retroviral Gene Transfer and Expression system was used to
generate VSVG pseudotyped retroviral particles (Clontech). An overnight culture of GP2-293 (3 × 106) was
transfected with 9 μg each of pVSV-G, pMX-POU5F1,
pMX-SOX2, pMX-KLF4, pMX-c-Myc, and pMXNANOG in 54 μL of FuGene 6 (Roche, Castel Hill,
Australia). The culture medium was then changed the
next day, and viral supernatants collected and filtered
at both 48 and 72 h for 2 separate rounds of transductions of BAF that were plated at 1 × 105 cells/100-mm
dish. After the second round of overnight incubation of
viral supernatants, the media on the BAF was replaced
with bovine ES medium. Putative biPS colonies were
observed between 7 and 14 d posttransduction and
manually picked and replated onto mouse embryonic
fibroblast feeder layers. The biPS clones were manually
passaged before adaptation to enzymatic passage with
4 mg/mL of Dispase (Invitrogen). The reprogramming
efficiency was calculated by dividing the total iPS cell
colonies isolated by the number of cells capable of being reprogrammed (the number of cells receiving all
factors by using the pMX-GFP transduction efficiency) as described previously (Takahashi et al., 2007a).
The average and SD were calculated, and a t-test of
unequal variance was performed. The biPS cells were
stably transduced using GP2-293 cells, which were cotransfected with the pVSV-G and CAG-GFP plasmids
(Zhao et al., 2006).
PCR
Genomic DNA was extracted using the DNeasy
Blood and Tissue kit (Qiagen, Doncaster, Australia).
Amplification of integrated transgenes was performed
using gene-specific primers (Table 1) and GoTaq Green
Master Mix (Promega, South Sydney, Australia). The
PCR reaction included an initial denaturation at 94°C
for 5 min followed by 30 cycles of denaturation at 94°C
for 1 min, annealing at 58°C for 45 s, and extension at
72°C for 75 s, followed by final extension at 72°C for 5
min. Amplicons were separated through a 1% agarose
gel at 100 V for 1 h.
2710
Sumer et al.
Table 1. The PCR primer sequences used in this study
Product
size
Gene1
Forward primer
Reverse primer
ALP1
REX1
SOX2
POU5F1
AFP
NANOG
KLF4
c-MYC
SST
ALB
NES
VIM
TUBB3
HBZ
BMP4
UCP2
ACTB
pMX-OCT4
pMX-SOX2
pMX-KLF4
pMX-c-MYC
pMX-NANOG
TTCAAACCGAAACACAAGCAC
GCAGAATGTGGGAAAGCCT
CATCCACAGCAAATGACAGC
GTTCTCTTTGGAAAGGTGTTC
AAGGCACCCTGTCCTGTATG
GTGTTTGGTGAACTCTCCTG
GCCCCTAGAGGCCCACTT
CGCGGTCGCCTCCTTCTCGCCCAGG
CCTGGAGCCTGAAGATTTGTC
ACCAGGAAAGTACCCCAAGTG
CACCTCAAGATGTCCCTCAGC
GATGTTTCCAAGCCTGACCTC
CATCCAGAGCAAGAACAGCAG
TCAAGTTCCTGTCCCATTGC
TCGTTACCTCAAGGGAGTGG
CCGACAGAACTGCCTATACCC
GGAATCCTGTGGCATCCATGAAAC
CTAGTTAATTAAGAATCCCAGTG
CTAGTTAATTAAGGATCCCAGG
ACAAAGAGTTCCCATCTCAAGGTG
CTAGTTAATTAAGGATCCCAGTG
CTAGTTAATTAAGAATCCCAGTG
GGTAAAGACGTGGGAGTGGTC
GACTGAATAAACTTCTTGC
TTTCTGCAAAGCTCCTACCG
ACACTCGGACCACGTCTTTC
AGACACTCCAGCACGTTTCC
GGGAATTGAAATACTTGACAG
CACAACCATCCCAGTCACAG
GTCCGGGGAAGCGCAGGGC
GTGAGAAGGGGTTTGGAGAAG
GTTTCAACAGCTCAACAAGTGC
TCTTCAGAAAGGTTGGCACAG
GGCGTTCCAGAGACTCGTTAG
GATTCCTCCTCATCGTCTTCG
CATTCTCTCCCGTCACTCTCC
GGCTTTGGGGATACTGGAAT
TTGAACCCAACCATAATGACG
AAAACGCAGCTCAGTAACAGTCCG
CACTAGCCCCACTCCAACCT
TGTTGTGCATCTTGGGGTTCT
TCCAAGCTAGCTTGCCAAACCTACAGG
CAGCAGCTCGAATTTCTTCC
GGGTAGGTAGGTGCTGAGGC
378
220
251
313
330
307
433
418
213
370
253
253
336
293
345
311
220
300
300
250
500
550
1
ALP1 (alkaline phosphatase), AFP (α-feto-protein), SST (somatostatin), ALB (albumin), NES (nestin), VIM (vimentin), TUBB3 (β-3tubulin), HBZ (zeta globin), BMP4 (bone morphogenic protein 4), UCP2 (uncoupling protein 2), and ACTB (β-actin).
Reverse-Transcription PCR
Total RNA was extracted from cells using the
RNeasy kit (Qiagen) according to the manufacturer’s
instructions. To remove contaminating genomic DNA,
the resulting total RNA was subjected to DNaseI treatment by using the DNA-free kit (Ambion, Applied Biosystems, Scoresby, Australia). Two micrograms of RNA
was used to synthesize cDNA using the SuperScript
III reverse transcriptase kit (Invitrogen). The cDNA
samples were subjected to PCR amplification with the
primer pairs in Table 1.
Histochemistry and Immunohistochemistry
Cells were cultured in 4-well glass culture slides
(BD Biosciences, North Ryde, Australia) and fixed in
100% ice-cold ethanol for 10 min and washed 3 times
with an excess of PBS. For detection of SSEA-1 and
SSEA-4, fixed cells were incubated in blocking solution (5% goat serum, 1% BSA in PBS) for 30 min at
room temperature to remove nonspecific antigen sites.
The cells subsequently incubated with anti-SSEA-1
(MC 480, Millipore) or anti-SSEA-4 (MC-813-70, Millipore) diluted 1:40 in blocking solution overnight at
4°C. For the immunocytochemical detection of Oct4,
the fixed cells were incubated with blocking solution
containing 0.1% Triton X100 before incubation with
anti-Oct4 (C-10, Santa Cruz, Scoresby, Australia) diluted 1:40 in blocking solution overnight at 4°C. After
extensive washing with PBS, the slides were incubated
at room temperature for 1 h with goat anti-mouse IgMAlexaFluor-488 (SSEA-1), goat anti-mouse IgG Alexa-
Fluor-594 (SSEA-4; Oct4) diluted 1:1,000 in blocking
solution. All second antibodies were purchased from
Invitrogen. After 3 washes with PBS, the slides were
mounted in Vectashield + DAPI (Vector Laboratories,
Abacus ALS, East Brisbane, Australia), and a coverslip
was placed. Alkaline phosphatase activity was detected
with an alkaline phosphatase kit (Chemicon, Millipore,
North Ryde, Australia) according to the manufacturer’s instructions.
Karyotype Analysis
Karyotype analysis of the biPS cell lines was performed by Southern Cross Pathology Australia (Clayton, Australia). At least 25 metaphase spreads were
assessed by G-banding for each sample.
RESULTS
Optimization of Retroviral Transduction
of Bovine Adult Fibroblasts
Retroviral transduction was optimized to obtain maximum viral transduction efficiency because the efficient
delivery of reprogramming factors is the first hurdle
to inducing pluripotency (Maherali and Hochedlinger,
2008). In preliminary studies, several variables were
tested by using the pMX-GFP plasmid including retroviral and packaging cell types, number of rounds of
transductions, and the number of target cells plated for
transductions (data not shown). Lentiviral transduction failed to result in any significant transgene expres-
Bovine induced pluripotent stem cells
2711
Figure 1. Optimization of viral transduction of bovine adult fibroblasts (BAF). A) Fluorescence activated cell sorting (FAC) profiles showing
green fluorescence protein (GFP) fluorescence in BAF after various viral transductions. i) Control BAF, ii) lentiviral transduction, iii) retroviral
transduction using supernatant from PLAT-A packaging cells, and iv) retroviral transduction using supernatant from GP2 293 packaging cells.
B) GFP fluorescence in BAF after GP2 293-mediated retroviral transduction. Scale bar = 200 µm. Color version available in the online PDF.
sion as determined by flow cytometry (Figure 1A ii).
Amphotropic retrovirus was optimized to yield a maximum of 23.42% transduction efficiency after 2 rounds
of transductions and when the target cells were reduced
to 4 × 104 cells/10 cm2 (Figure 1A iii). The VSVG
pseudotyped retroviral delivery by using GP2-293 packaging cells was identified as the most efficient method
of transgene delivery to BAF. Two rounds of transduction of 1 × 105 cells/10 cm2 were shown to have close to
100% GFP transduction (Figure 1A iv, B).
We next hypothesized that the inclusion of NANOG,
a transcription factor important for maintaining pluripotency in cattle (Munoz et al., 2008), would enhance
stable induction of pluripotency in BAF. After transduction with retrovirus coding for human POU5F1,
SOX2, KLF4, c-MYC, and NANOG, we were able to
obtain robust biPS colonies that were large and round
Generation of Bovine iPS Cells
Once the VSVG pseudotyped retroviral delivery
was identified as the most efficient method of transgene delivery to BAF, we transduced the cells by using the experimental outline shown in Figure 2A. Initially, BAF were transduced with retrovirus coding for
human POU5F1, SOX2, KLF4, and c-MYC. These 4
transcription factors are sufficient to reprogram human
(Takahashi et al., 2007b), monkey (Liu et al., 2008), rat
(Li et al., 2009; Liao et al., 2009), and porcine cells (Esteban et al., 2009; Ezashi et al., 2009; Wu et al., 2009;
West et al., 2010). We found that despite the identification of putative iPS colonies 2 wk after transduction,
these colonies could not be expanded beyond passage 7
to 9 (Table 2).
Figure 2. Generation of bovine induced pluripotent stem (biPS)
cells. A) Schematic diagram of transduction protocol for the generation of biPS cells. B) Morphology of a typical biPS colony grown on
mouse embryonic fibroblast feeder layer showing a large and round
colony with a distinct boundary imaged using an inverted microscope
at passage 12. C) Alkaline phosphatase activity of biPS cells at passage 8. Scale bar = 200 µm. ES = embryonic stem cell. Color version
available in the online PDF.
2712
Sumer et al.
Table 2. Reprogramming efficiency of bovine fibroblasts by using different combinations of reprogramming factors
Experiment
Reprogramming factors delivered
Exp.
Exp.
Exp.
Exp.
 
Exp.
 
Exp.
 
POU5F1,
POU5F1,
POU5F1,
POU5F1,
POU5F1,
POU5F1,
POU5F1,
POU5F1,
POU5F1,
1
1
2
3
4
5
6
SOX2,
SOX2,
SOX2,
SOX2,
SOX2,
SOX2,
SOX2,
SOX2,
SOX2,
KLF4,
KLF4,
KLF4,
KLF4,
KLF4,
KLF4,
KLF4,
KLF4,
KLF4,
c-MYC
c-MYC
c-MYC
c-MYC
c-MYC, NANOG
c-MYC
c-MYC, NANOG
c-MYC
c-MYC, NANOG
Transduction
efficiency
Colonies
obtained
iPS cell1
clones
established
93.6
95.3
90.2
87.3
87.3
92.4
92.4
94.7
94.7
17
21
23
22
24
25
28
32
33
—
—
—
—
12
—
11
—
8
Reprogramming
efficiency
—
—
—
—
0.000209462
—
0.000192006
—
0.000139641
iPS = induced pluripotent stem cell.
with distinct boundaries (Figure 2B). Putative iPS
colonies were expanded and initially characterized by
alkaline phosphatase staining at passage 12 and found
to be positive (Figure 2C). These colonies could be
maintained for extended periods in culture, initially by
manually passage (8 to 10) before adaptation to enzy-
Figure 3. Genomic DNA analysis and pluripotent gene expression profile of 3 bovine induced pluripotent stem (biPS) cell lines. A) Genomic
PCR confirming the integration of the 5 transgenes. B) Gene expression profile of biPS cells compared with the parental bovine adult fibroblasts
and mouse embryonic fibroblast feeder cells, showing expression of endogenous and exogenous (Exo) pluripotency genes. C) Representative karyotype biPS-1 cell line showing a normal female karyotype of 60 chromosomes. ALP1 = alkaline phosphatase; ACTB = β-actin.
Bovine induced pluripotent stem cells
2713
Figure 4. Immunoflourescence staining of pluripotent markers and fluorescence expression of bovine induced pluripotent stem (biPS) cells at
passage 14. A) Immunostaining of biPS for POU5F1 counterstained with DAPI (Vector Laboratories, Abacus ALS, East Brisbane, Australia).
B) Immunostaining of biPS for SSEA-1 counterstained with DAPI. C) Immunostaining of biPS for SSEA-4 counterstained with DAPI. D) Green
fluorescence protein (GFP) expression in biPS-11-GFP cell line containing the CAG-eGFP reporter construct. Scale bar = 200 µm.
matic passage, summarized in Table 2. The reprogramming efficiency (the theoretical proportion of cells that
were reprogrammed that received all 5 factors) was calculated as 0.00018 ± 0.000036 SD (n = 3) and found to
be statistically significant (P-value = 0.0066) by comparison with transductions without NANOG (Table 2).
Characterization of Bovine iPS Cells
Three biPS clones designated biPS-1, biPS-11, and
biPS-19 were expanded for further characterization.
We confirmed the integration of the 5 reprogramming factors into the genome of the biPS clones by
genomic DNA PCR analysis (Figure 3A) and found
that these factors continued to be expressed in the
biPS cells (Figure 3B). Gene expression analysis by
reverse-transcription PCR showed that the biPS cells
expressed the endogenous pluripotency markers ALP1
(alkaline phosphatase), REX1, POU5F1, SOX2, and
NANOG, as well as c-MYC and KLF4, which were also
expressed by the parental BAF cell line (Figure 3B).
All 3 clones had a normal diploid chromosome count
of 60 (Figure 3C).
We further tested the protein localization of several pluripotency markers by immunohistochemistry
and found the correct localization and positive staining for nuclear POU5F1 (Figure 4A) and cell surface
expression of stage-specific embryonic antigens 1 and
4 (SSEA-1 and SSEA-4; Figures 4B and 4C). The reprogrammed cells were modified genetically to express
GFP and produce the subclone, biPS-11-GFP (Figure
4D).
2714
Sumer et al.
Differentiation Potential of Bovine iPS Cells
The differentiation potential of the biPS cells was
confirmed both in vitro and in vivo. When the growth
factors LIF and bovine fibroblast growth factor (FGF)
were removed from the cultures and the cells were plated in the absence of feeders in nonadhesive dishes, the
biPS cells formed noncystic embryoid bodies (Figure
5A). The cells were allowed to differentiate for 14 d
and then analyzed for the presence of differentiation
markers. The reverse-transcription PCR analysis revealed that the biPS cells could differentiate into cell
types indicative of the 3 germ lineages (Figure 5B) as
evidenced by expression of endodermal markers [AFP
(α-feto-protein), SST (somatostatin), and ALB (albumin)], ectodermal markers [NES (nestin), VIM (vimentin), TUBB3 (β-3-tubulin)], and mesodermal markers
[HBZ (zeta globin), BMP4 (bone morphogenic protein
4), and UCP2 (uncoupling protein 2)].
To further test for pluripotency in vivo, cells from
each biPS clone were injected into the hind leg of 2
SCID mice. After 6 to 8 wk, all mice were found to have
developed solid tumors, about 10 mm in size at the injection site. Histological examination revealed that the
teratoma contained cell types indicative of the 3 germ
lineages including adipose tissue (mesoderm), neural
rosettes (ectoderm), and secretory epithelium (endoderm; Figure 5C).
Figure 5. Differentiation potential of bovine induced pluripotent stem (biPS) cells. A) Embryoid body formation of biPS cells grown in suspension in the absence of leukemia inhibitory factor and basic fibroblast growth factor. Scale bar = 500 µm. B) Gene expression profile of biPS cells
after embryoid body differentiation. C) Histology of differentiated tissues found in the thigh muscle of severe combined immunodeficient mice after
injection of biPS cells included i) neurogenic differentiation with rosettes (ectodermal), ii) adipose differentiation (mesodermal), and iii) epithelial
differentiation (endodermal). Scale bar = 200 µm. BAF = bovine adult fibroblasts; AFP = α-feto-protein; SST = somatostatin; ALB = albumin;
NES = nestin; VIM = vimentin; TUBB3 = β-3-tubulin, HBZ = zeta globin; UCP2 = uncoupling protein 2; BMP4 = bone morphogenic protein
4; and ACTB = β-actin. Color version available in the online PDF.
Bovine induced pluripotent stem cells
DISCUSSION
To date, it has been difficult to establish and maintain robust pluripotent ES cells from bovine embryos.
The induction of pluripotency by ectopic expression of
reprogramming factors in somatic cells has allowed for
the generation and maintenance of iPS cells in species
in which it has previously been difficult to isolate and
culture ES cells (Esteban et al., 2009; Ezashi et al.,
2009; Li et al., 2009; Liao et al., 2009; Wu et al., 2009;
West et al., 2010). Herein, we report the first generation of biPS cells in cattle and that the induction and
maintenance of pluripotency in BAF requires the ectopic expression of NANOG in addition to the Yamanaka
reprogramming factors POU5F1, SOX2, KLF4, and cMYC. We further demonstrate that the resulting biPS
cells display properties of pluripotent stem cells, both
in vitro and in vivo.
The retroviral-delivered and integrated MMLV promoter-driven transgenes were not silenced after the
induction of pluripotency in our biPS cells. This is a
phenomenon that is also seen in iPS cells in other species including mice (Okita et al., 2007), humans (Liu
et al., 2009), rats (Li et al., 2008), monkeys (Liu et al.,
2008), and pigs (Esteban et al., 2009; Ezashi et al.,
2009), suggesting that some species may inherently be
unable to silence these promoters. It also is possible
that the maintenance of pluripotency is reliant on the
expression of these transgenes, as seen in porcine iPS
cells generated by using dox-inducible reprogramming
factors (Wu et al., 2009), and that additional factors
are required for certain species.
Initial induction of pluripotency through ectopic expression of POU5F1, SOX2, KLF4, and c-MYC failed
to yield biPS clones that could be expanded beyond 8
to 10 passages. The addition of NANOG to the reprogramming cocktail resulted in more stable biPS clones.
NANOG is a transcription factor and key indicator
and regulator of pluripotent stem cells (Chambers et
al., 2003). NANOG is expressed in the inner cell mass
(ICM) of both mouse and human blastocysts, and its
downregulation in mouse and human ES cells induces
differentiation toward extra-embryonic lineages (Hyslop
et al., 2005; Hough et al., 2006). Furthermore, NANOG
expression is restricted to the pluripotent stem cells of
the ICM as well as ICM-derived ES-like cells in cattle
(Muñoz et al., 2008). In reprogramming experiments,
NANOG, along with LIN28, can supplement c-MYC
and KLF4 to induce pluripotency (Yu et al., 2007)
and can further enhance reprogramming efficiency
when added along with POU5F1, SOX2, KLF4, and
c-MYC (Liao et al., 2008). Furthermore, the addition
of NANOG along with LIN28 to the reprogramming
cocktail when generating porcine iPS cells resulted in
cells capable of generating chimeric offspring (West et
al., 2010). Interestingly, the first germline competent
mouse iPS cells were generated by using endogenous
Nanog as the selection marker for pluripotency (Okita
et al., 2007).
2715
In summary, we show that pluripotency can be induced upon bovine fibroblasts by the retroviral delivery and ectopic expression of POU5F1, SOX2, KLF4,
c-MYC, and NANOG. The plasticity of the biPS cells
was confirmed by expression of key pluripotency genes;
immunostaining for POU5F1, SSEA-1, and SSEA-4;
alkaline phosphatase staining; and the ability to differentiate into cell types indicative of the 3 germ layers
both in vitro and in vivo. This work opens a plethora
of opportunities in the biotechnology and agricultural
industries in cattle.
LITERATURE CITED
Chambers, I., D. Colby, M. Robertson, J. Nichols, S. Lee, S. Tweedie, and A. Smith. 2003. Functional expression cloning of Nanog,
a pluripotency sustaining factor in embryonic stem cells. Cell
113:643–655.
Esteban, M. A., J. Xu, J. Yang, M. Peng, D. Qin, W. Li, Z. Jiang,
J. Chen, K. Deng, M. Zhong, J. Cai, L. Lai, and D. Pei. 2009.
Generation of induced pluripotent stem cell lines from Tibetan
miniature pig. J. Biol. Chem. 284:17634–17640.
Ezashi, T., B. P. Telugu, A. P. Alexenko, S. Sachdev, S. Sinha,
and R. M. Roberts. 2009. Derivation of induced pluripotent
stem cells from pig somatic cells. Proc. Natl. Acad. Sci. USA
106:10993–10998.
Hough, S. R., I. Clements, P. J. Welch, and K. A. Wiederholt. 2006.
Differentiation of mouse embryonic stem cells after RNA interference-mediated silencing of OCT4 and Nanog. Stem Cells
24:1467–1475.
Hyslop, L., M. Stojkovic, L. Armstrong, T. Walter, P. Stojkovic,
S. Przyborski, M. Herbert, A. Murdoch, T. Strachan, and M.
Lako. 2005. Downregulation of NANOG induces differentiation of human embryonic stem cells to extraembryonic lineages.
Stem Cells 23:1035–1043.
Li, P., C. Tong, R. Mehrian-Shai, L. Jia, N. Wu, Y. Yan, R. E. Maxson, E. N. Schulze, H. Song, C. L. Hsieh, M. F. Pera, and Q. L.
Ying. 2008. Germline competent embryonic stem cells derived
from rat blastocysts. Cell 135:1299–1310.
Li, W., W. Wei, S. Zhu, J. Zhu, Y. Shi, T. Lin, E. Hao, A. Hayek, H.
Deng, and S. Ding. 2009. Generation of rat and human induced
pluripotent stem cells by combining genetic reprogramming and
chemical inhibitors. Cell Stem Cell 4:16–19.
Liao, J., C. Cui, S. Chen, J. Ren, J. Chen, Y. Gao, H. Li, N. Jia,
L. Cheng, H. Xiao, and L. Xiao. 2009. Generation of induced
pluripotent stem cell lines from adult rat cells. Cell Stem Cell
4:11–15.
Liao, J., Z. Wu, Y. Wang, L. Cheng, C. Cui, Y. Gao, T. Chen, L.
Rao, S. Chen, N. Jia, H. Dai, S. Xin, J. Kang, G. Pei, and L.
Xiao. 2008. Enhanced efficiency of generating induced pluripotent stem (iPS) cells from human somatic cells by a combination of six transcription factors. Cell Res. 18:600–603.
Liu, H., F. Zhu, J. Yong, P. Zhang, P. Hou, H. Li, W. Jiang, J. Cai,
M. Liu, K. Cui, X. Qu, T. Xiang, D. Lu, X. Chi, G. Gao, W. Ji,
M. Ding, and H. Deng. 2008. Generation of induced pluripotent
stem cells from adult rhesus monkey fibroblasts. Cell Stem
Cell 3:587–590.
Liu, J., K. L. Jones, H. Sumer, and P. J. Verma. 2009. Stable transgene expression in human embryonic stem cells after simple
chemical transfection. Mol. Reprod. Dev. 76:580–586.
Maherali, N., and K. Hochedlinger. 2008. Guidelines and techniques
for the generation of induced pluripotent stem cells. Cell Stem
Cell 3:595–605.
Muñoz, M., A. Rodriguez, C. De Frutos, J. N. Caamano, C. Diez, N.
Facal, and E. Gomez. 2008. Conventional pluripotency markers
are unspecific for bovine embryonic-derived cell-lines. Theriogenology 69:1159–1164.
2716
Sumer et al.
Okita, K., T. Ichisaka, and S. Yamanaka. 2007. Generation of
germline-competent induced pluripotent stem cells. Nature
448:313–317.
Sumer, H., K. L. Jones, J. Liu, C. Heffernan, P. A. Tat, K. Upton,
and P. J. Verma. 2009. Reprogramming of somatic cells after
fusion with iPS and ntES cells. Stem Cells Dev. 19:239–246.
Takahashi, K., K. Okita, M. Nakagawa, and S. Yamanaka. 2007a.
Induction of pluripotent stem cells from fibroblast cultures.
Nat. Protoc. 2:3081–3089.
Takahashi, K., and S. Yamanaka. 2006. Induction of pluripotent
stem cells from mouse embryonic and adult fibroblast cultures
by defined factors. Cell 126:663–676.
Takahashi, K., K. Tanabe, M. Ohnuki, M. Narita, T. Ichisaka, K.
Tomoda, and S. Yamanaka. 2007b. Induction of pluripotent
stem cells from adult human fibroblasts by defined factors. Cell
131:861–872.
West, F. D., S. L. Terlouw, D. J. Kwon, J. L. Mumaw, S. K. Dhara,
K. Hasneen, J. R. Dobrinsky, and S. L. Stice. 2010. Porcine in-
duced pluripotent stem cells produce chimeric offspring. Stem
Cells Dev. 19:1211–1220.
Wu, Z., J. Chen, J. Ren, L. Bao, J. Liao, C. Cui, L. Rao, H. Li, Y.
Gu, H. Dai, H. Zhu, X. Teng, L. Cheng, and L. Xiao. 2009.
Generation of pig induced pluripotent stem cells with a druginducible system. J. Mol. Cell. Biol. 1:46–54.
Yu, J., M. A. Vodyanik, K. Smuga-Otto, J. Antosiewicz-Bourget,
J. L. Frane, S. Tian, J. Nie, G. A. Jonsdottir, V. Ruotti, R.
Stewart, I. I. Slukvin, and J. A. Thomson. 2007. Induced pluripotent stem cell lines derived from human somatic cells. Science 318:1917–1920.
Zhao, C., E. M. Teng, R. G. Summers Jr., G. L. Ming, and F. H.
Gage. 2006. Distinct morphological stages of dentate granule
neuron maturation in the adult mouse hippocampus. J. Neurosci. 26:3–11.