From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
RED CELLS
Human potassium chloride cotransporter 1 (SLC12A4) promoter is regulated by
AP-2 and contains a functional downstream promoter element
Guo-Ping Zhou, Clara Wong, Robert Su, Scott C. Crable, Kathleen P. Anderson, and Patrick G. Gallagher
Most K-Cl cotransport in the erythrocyte
is attributed to potassium chloride cotransporter 1 (KCC1). K-Cl cotransport is
elevated in sickle erythrocytes, and the
KCC1 gene has been proposed as a modifier gene in sickle cell disease. To provide
insight into our understanding of the regulation of the human KCC1 gene, we
mapped the 5ⴕ end of the KCC1 cDNA,
cloned the corresponding genomic DNA,
and identified the KCC1 gene promoter.
The core promoter lacks a TATA box and
is composed of an initiator element (InR)
and a downstream promoter element
(DPE), a combination found primarily in
Drosophila gene promoters and rarely
observed in mammalian gene promoters.
Mutational analyses demonstrated that
both the InR and DPE sites were critical
for full promoter activity. In vitro DNase I
footprinting, electrophoretic mobility shift
assays, and reporter gene assays identified functional AP-2 and Sp1 sites in this
region. The KCC1 promoter was transacti-
vated by forced expression of AP-2 in
heterologous cells. Sequences encoding
the InR, DPE, AP-2, and Sp1 sites were
100% conserved between human and murine KCC1 genes. In vivo studies using
chromatin immunoprecipitation assays
with antihistone H3 and antihistone H4
antibodies demonstrated hyperacetylation of this core promoter region. (Blood.
2004;103:4302-4309)
© 2004 by The American Society of Hematology
Introduction
K-Cl cotransport is a major pathway for the coupled, electroneutral
release of potassium and chloride from nonexcitable cells. Potassium chloride cotransporters (KCCs) are members of the cation
Cl⫺ cotransporter gene superfamily.1,2 To date, 4 mammalian KCCs
have been cloned and characterized.3-9 KCC1 and KCC3 are widely
expressed and play important roles in transepithelial transport, cell
volume regulation, and regulation of intracellular chloride concentration.3,5-10 Mutation of the KCC3 gene is associated with an
autosomal recessive disorder characterized by mental retardation,
peripheral neuropathy, and agenesis of the corpus callosum.11 Mice
lacking KCC3 demonstrate peripheral neuropathy and defects in
locomotion and sensorimotor gating.11 KCC3 may also play a role
in cell growth regulation.12 KCC2 is expressed throughout the
central nervous system4,13,14 and plays an important role in synaptic
transmission.15,16 KCC4 is expressed primarily in kidney, heart,
lung, and liver.6 Mice lacking KCC4 exhibit deafness and renal
tubular acidosis.17
Most K-Cl cotransport in the erythrocyte is attributed to KCC1.
KCC1 activity is volume-, pH-, and chloride-dependent.3,9,18 The
complex mechanisms that regulate KCC activity have been the
focus of intensive study. These mechanisms include cell volume,
pH, PO2, magnesium, calcium, and oxidative changes.19 Another
regulatory pathway of KCC activity is a phosphorylation/
dephosphorylation cycle (for a review, see Merciris and Giraud20)
with phosphorylation of the transporter or a regulatory protein
decreasing KCC activity and dephosphorylation increasing activ-
ity. Erythrocytes from mice deficient in the Src family kinases Fgr
and Hck demonstrate elevated KCC activity.21
The KCC system contributes to the erythrocyte abnormalities in
patients with various hemoglobinopathies, particularly sickle cell
disease (for a review, see Lauf et al18). K-Cl cotransport activity is
activated in sickle cell erythrocytes,19,22 contributing to the formation of dense erythrocytes as a consequence of cellular dehydration
and potassium loss.1,3,9 Dense erythrocytes play a role in the
vasoocclusive manifestations of sickle cell disease. It has been
proposed that the KCC1 gene is a candidate modifier gene
contributing to the clinical course and response to therapy in sickle
cell disease.2,23,24 It is possible that genetic variants of KCC1 exist,
particularly in patients with sickle cell disease, with some variants
causing increased K-Cl cotransport, cellular dehydration, hemoglobin S polymerization, sickling, and increased disease severity.
Because KCC1 is a major contributor to the dehydration of sickle
erythrocytes, pharmacologic agents that block this pathway are
being examined as therapeutic agents to prevent or ameliorate the
complications of sickle cell disease.25,26
Although the mechanisms regulating K-Cl cotransport activity
are beginning to be revealed, nothing is known about the regulation
of KCC1 at the transcriptional level. Understanding the transcriptional regulation of the KCC1 gene may provide additional
information on KCC1 activity in wild-type and sickle erythrocytes
and may contribute to therapeutic strategies aimed at decreasing
KCC activity in sickle erythrocytes.
From the Department of Pediatrics, Yale University School of Medicine, New
Haven, CT; Cincinnati Comprehensive Sickle Cell Center, Cincinnati Children’s
Hospital Research Foundation, Cincinnati, OH; and Department of Pediatrics,
University of Cincinnati College of Medicine, Cincinnati, OH.
The online version of the article contains a data supplement.
Submitted January 14, 2003; accepted February 2, 2004. Prepublished
online as Blood First Edition Paper, February 19, 2004; DOI 10.1182/blood2003-01-0107.
Supported in part by grants from the National Institutes of Health (P60
HL58421) and the March of Dimes Birth Defects Foundation.
4302
Reprints: Patrick G. Gallagher, Department of Pediatrics, Yale University
School of Medicine, PO Box 208064, 333 Cedar St, New Haven, CT 065208064; e-mail: [email protected].
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
© 2004 by The American Society of Hematology
BLOOD, 1 JUNE 2004 䡠 VOLUME 103, NUMBER 11
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
BLOOD, 1 JUNE 2004 䡠 VOLUME 103, NUMBER 11
Furthermore, it is possible that multiple alternate promoters
regulate KCC1 expression in a tissue-specific manner, including in
erythroid cells. Review of expressed sequence tags (EST) database
information revealed a large number of alternately spliced KCC1
cDNA isoforms isolated from different tissues, several with
alternate 5⬘ ends encoding novel NH2 termini with new initiator
methionines (eg, BI828860 and BI829320). Initial studies have
demonstrated that multiple KCC1 isoform exists in sickle and
normal erythroid cells (Anderson et al27; and K.P.A. et al,
manuscript submitted). Based on functional data obtained with
artificial NH2- and COOH-terminal KCC1 truncation mutants,28
several of the KCC1 isoforms encoded by these cDNAs are
predicted to alter KCC1 function. Recent studies have demonstrated that promoter choice influences splice site selection,
determining the composition of alternately spliced cDNA isoforms
and influencing protein structure and function.29-31 Thus, study of
the 5⬘ ends of KCC1 cDNA isoforms and the identification and
characterization of the corresponding promoter(s) is an important
priority in the study of KCC1 regulation.
In this report, we describe the identification and characterization
of the human KCC1 (hKCCl) gene promoter located immediately
5⬘ of the major KCC1 cDNA transcript. Interestingly, the core
promoter lacks a TATA box and contains a functional initiator
element (InR) and a functional downstream promoter element
(DPE), a combination found primarily in Drosophila gene promoters and rarely observed in mammalian gene promoters. Sp1 and
AP-2 binding proteins contribute significantly to KCC1 promoter
function. This core promoter region is hyperacetylated in erythroid
and nonerythroid cells.
Materials and methods
Isolation of the human KCC1 gene
Primary screening of a human genomic DNA BAC library (Genome
Systems, St Louis, MO) was performed with a pair of oligonucleotide
primers, A and B (Table 1), as described.32 These primers flank exon 1 of the
hKCC1 gene33 and amplify a 115–base pair (bp) fragment. Amplificationpositive clones were purified, subcloned, and analyzed by restriction
endonuclease digestion, Southern blotting, and partial nucleotide sequencing.
Mapping of the KCC1 transcription initiation site
Total RNA was prepared from human tissues or from the human tissue
culture cell lines K562 or HeLa as described.34 The transcription initiation
site of the hKCC1 gene cDNA was determined using a primer extension
assay. Oligonucleotide primer C (Table 1) was end-labeled with 32Padenosine triphosphate (32P-ATP) using T4 polynucleotide kinase (Promega, Madison, WI) followed by ethanol precipitation with template RNA.
Templates in these reactions were 25 ␮g K562 or HeLa cell total RNA or
HUMAN KCC1 PROMOTER
4303
10 ␮g transfer RNA (tRNA). Labeled primer was annealed to template
RNA for 30 minutes at 75°C, cooled for 10 minutes at room temperature,
then extended for 30 minutes at 43°C in the presence of buffer (50 mM
Tris-HCl, pH 8.3, 50 mM KCl, 10 mM MgCl2, 20 mM dithiothreitol, 1 mM
each of 4 dNTPs, and 0.5 mM spermidine), and 20 U avian myoblastosis
virus (AMV) reverse transcriptase. Extension products were ethanol
precipitated, dissolved in loading buffer, and analyzed on an 8% acrylamide
gel adjacent to a sequencing reaction of genomic DNA primed with the
same oligonucleotide.
5ⴕ rapid amplification of cDNA ends
Single-stranded oligonucleotide ligation was carried out as described.35
Nested polymerase chain reaction (PCR) was performed using either
human bone marrow or brain cDNA as template with Advantage-2 GC
polymerase (Clontech, Palo Alto, CA). The primers used in PCR amplification were D and E (first amplification), then F and G (second amplification)
(Figure 1A). Amplification products were subcloned and sequenced.
Preparation of nuclear extracts
Nuclear extracts were prepared from K562 and HeLa cells by hypotonic
lysis followed by high salt extraction of nuclei, as described by Andrews
and Faller.36
DNase I footprinting in vitro
Probes for DNase I footprinting were by produced by PCR amplification of
plasmids p-369/⫹18 and p-369/⫹81 containing hKCC1 genomic fragments (see “Results”) with oligonucleotide primers C and H or C and J,
respectively (Table 1). In each reaction, one of the primers had been 5⬘
end–labeled with 32P-ATP using polynucleotide kinase before use in PCR.
Reaction mixes contained 75 ␮g K562 cell nuclear extracts, 20 000 cpm
labeled probe, and 1 ␮g poly(dI-dC). After digestion with DNase I, samples
were electrophoresed in 6% denaturing polyacrylamide gels, and the gels
were dried and subjected to autoradiography.
Preparation of promoter-reporter plasmids
for transfection assays
A 387-bp fragment corresponding to 5⬘ flanking hKCC1 genomic DNA
from ⫺369 to ⫹18 relative to the transcription initiation site was amplified
using primers H and I (Table 1). This fragment was subcloned in both
orientations upstream of the firefly luciferase reporter gene in the plasmid
pGL2B (Promega), yielding plasmids p-369/⫹18 and p⫹18/⫺368 reverse.
Additions, truncations, and mutations of this fragment in the pGL2B
plasmid were performed using PCR amplification. Integrity of test plasmids
was confirmed by sequencing.
Cell culture
Human tissue culture cell lines K562 (ATCC, CCL 243), HeLa (CCL 2),
and HepG2 (primary liver cancer, ATCC HB-8605) were used to study
expression of the hKCC1 gene.
Transient transfection analyses
Table 1. Oligonucleotide primers
A
5⬘-GGCAGGAAGCTGATGGCCTCCC-3⬘
B
5⬘-CCTCACTTCACCCCTGCCCACCAG-3⬘
C
5⬘-CGGGCTCGGCCCCGCCGCACCCGCCG-3⬘
D
5⬘-CCTCAAACAGTGCCAGGTTCCTGTC-3⬘
E
5⬘-CCATCCTAATACGACTCACTATAGGGC-3⬘
F
5⬘-CTGGCACCACGGTGAAGTGAGGCATC-3⬘
G
5⬘-ACTCACTATAGGGCTCGAGCGGC-3⬘
H
5⬘-GCCAGATCTCCTGGGCAGGTGGCTTCTGCAGTCC-3⬘
I
5⬘-GTCCAAGCTTCTCCCCGCTGCGCTCACTTCCTCCG-3⬘
J
5⬘-GCCAAGCTTCCGCCGCTGTCCCCGCCGCTGTCC-3⬘
K
5⬘-GCCAGATCTGGGCGGCCCGGGGGGCGGGCGGAG-3⬘
L
5⬘-GTCCAAGCTTACACGCCCCGCCCGCTCGCATTC-3⬘
All plasmids tested were purified using Qiagen columns (Qiagen, Chatsworth, CA) or cesium chloride plasmid purification, and at least 2
preparations of each plasmid were tested in triplicate. K562 and HeLa cell
transfections were performed as described.37 All assays were performed in
triplicate. Differences in transfection efficiency were determined by cotransfection with the pCMV␤ plasmid. For transactivation assays, HepG2 cells
were transfected using 1 ␮g reporter plasmid and varying amounts of
AP-2␣, AP-2␤, AP-2␥, and AP-2␦ cDNA expression plasmids (kindly
supplied by Drs Trevor Williams (University of Colorado Health Sciences
Center, Denver), Helen Hurst (Hammersmith Hospital, London, United
Kingdom), Feng Zhao (Mount Sinai School of Medicine, New York, NY),
and Bruce Gelb (Mount Sinai School of Medicine)), and the reporter gene
activity was assayed.
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
4304
BLOOD, 1 JUNE 2004 䡠 VOLUME 103, NUMBER 11
ZHOU et al
Results
Cloning of the human KCC1 gene
Screening a human genomic DNA BAC library yielded an approximately 90–kilobase (kb) genomic clone containing all the exons of
the hKCC1 gene.33 An approximately 13.5-kb XbaI fragment
containing exons 1 to 3 and the 5⬘ flanking KCC1 sequence was
isolated from the BAC clone for further characterization. A limited
restriction map of this region is shown in Figure 1A.
Mapping the human KCC1 mRNA transcription initiation site
Figure 1. The 5ⴕ end of the human KCC1 gene. (A) Genomic organization of the 5⬘
end of the human KCC1 gene. One clone containing the KCC1 gene was isolated
from a human genomic DNA library. This clone spanned a distance of approximately
90 kb and contained exons 1 to 3 of the KCC1 cDNA in an approximately 13.5-kb XbaI
fragment. A partial restriction map of this 13.5-kb fragment with BamHI (b) and XbaI
(X) is shown. (B) Structure of the 5⬘ end of the human KCC1 cDNA. A diagram of the
5⬘ end of the human KCC1 cDNA is shown. The location of the initiation codon is
shown, as is the location of intron/exon boundaries. Box denotes sequences obtained
by 5⬘ RACE. Arrows denote oligonucleotide primers used in 5⬘ RACE. 5⬘ ends of the
published cDNA and the 5⬘-most EST (IMAGE 5174748) are shown.
Gel mobility shift assays
Binding reactions were carried out as described.37 Competitor oligonucleotides were added at molar excesses of 100-fold. Antibodies to AP-2 and Sp1
were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).
To identify the 5⬘ end of the human KCC1 cDNA, primer extension
was performed using total RNA from K562 cells. These experiments identified a single transcription initiation site (Figure S1; see
the Supplemental Materials link at the top of the online article on
the Blood website) and predicted the presence of an additional 22
bp in the mRNA upstream of the sequence from the 5⬘-most EST
(IMAGE clone 5174748). This is 52 bp upstream of the 5⬘ end
previously identified by cDNA cloning (Figure 1B).3 Similar
results were obtained using RNA from HeLa cells. The additional
22 bp of upstream 5⬘-untranslated sequence was obtained by 5⬘
rapid amplification of cDNA ends (RACE). Sequences obtained by
RACE were verified by comparison with corresponding genomic
DNA sequences (Figure 2). The sequences around the transcription
start site, GAA⫹1GTGA, do not precisely match the consensus for
an InR, YYA⫹1NWYY.41 However, they do match the most
critical sequences of A at ⫹1 and T at ⫹3.42,43 More important, they
meet the definition for a functional InR—that is, transcription
initiates at this location and mutational analyses demonstrate their
functional importance (see “Results”).41 No additional in-frame
ATGs were present in the 5⬘-untranslated sequences. Taken together, these data suggest that this sequence is at or very near the 5⬘
end of the human KCC1 cDNA.
5ⴕ-flanking genomic DNA sequence of the hKCC1 gene
The nucleotide sequence of the genomic DNA upstream of the
hKCC1 cDNA transcription start site is shown in Figure 3.
Quantitative ChIP assays
Antidiacetylated histone H3 (06-599) and antitetraacetylated histone H4
(06-866) antibodies were obtained from Upstate Biotechnology (Lake
Placid, NY). Quantitative chromatin immunoprecipitation (ChIP) analysis
was performed as described.38,39 After formaldehyde fixation, chromatin
was fragmented by sonication 9 times for 10 seconds each. Extracts were
precleared with protein G Sepharose, and antibody was added and
incubated overnight at 4°C. After elution and extraction, immunoprecipitated DNA was analyzed by quantitative real-time PCR (iCycler; Bio-Rad,
Hercules, CA). PCR primers K and L (Table 1) amplify a 108-bp fragment
corresponding to the core KCC1 promoter. Samples from at least 3
independent immunoprecipitations were analyzed. SYBR green fluorescence in 25 ␮L PCR reactions was determined, and the amount of product
was determined relative to a standard curve generated from a titration of
input chromatin. Amplification of a single amplification product was
confirmed by dissociation curve analysis and agarose gel electrophoresis
with ethidium bromide staining. Parallel controls for each experiment
included samples of no chromatin, no antibody, nonimmune rabbit immunoglobulin G (IgG), and rabbit nonimmune serum.
Computer analyses
Computer analyses were performed using the BLAST algorithm (National
Center for Biotechnology Information, Bethesda, MD).40
Figure 2. 5ⴕ Flanking genomic DNA sequence. Nucleotide sequence of the 5⬘
flanking genomic DNA of the human KCC1 gene is shown. Consensus sequences for
potential GATA and AP-2 DNA–protein binding sites are underlined; potential
Sp1-binding sites are also underlined. A indicates the transcription initiation site ⫹1
contained within the InR. The initiator methionine is marked by a dotted line. The 5⬘
ends of the published cDNA (Pub) and of the 5⬘-most EST (EST) are shown.
Sequences beginning intron 1 are in lowercase. The arrowhead indicates the end of
exon 1.
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
BLOOD, 1 JUNE 2004 䡠 VOLUME 103, NUMBER 11
HUMAN KCC1 PROMOTER
4305
hKCC1 gene promoter fragment is active in erythroid
and nonerythroid cells
Figure 3. Activity of the KCC1 gene promoter in erythroid and nonerythroid cell
lines in transient transfection assays. Plasmids containing 5⬘ flanking DNA of the
KCC1 gene inserted upstream of the firefly luciferase gene were transfected into
K562 or HeLa cells as described in “Materials and methods.” Relative luciferase
activity was expressed as that obtained from the test plasmids compared with the
activity obtained from the promoterless plasmid pGL2B plasmid, taking into account
the transfection efficiency. Data are mean ⫾ SD of at least 6 independent transfection
experiments.
Inspection of the sequence reveals a lack of consensus TATA or
CCAAT sequences. Consensus sequences for a number of potential
DNA-binding proteins, including GATA-1 (2 imperfect sites),
GC/CACC-binding related proteins (3 sites), and AP-2 (3 sites) are
present in the 5⬘-flanking sequences. GATA motifs bind GATA-1, a
zinc finger transcription factor essential for erythroid development.44,45 GC or GT/CACC motifs are the binding sites for a
number of transcription factors, including ubiquitous proteins such
as Sp1 and cell-restricted proteins such as members of the KLF
family.45,46 AP-2 proteins bind GC-rich sequences and are important in a wide variety of processes, including development,
apoptosis, and cell cycle control.47
When compared with the draft human genomic DNA sequence
(NT_010478), we identified an additional 12 bp of sequence,
CGGCGGGGACAG, in the 5⬘-untranslated region of the core
KCC1 promoter not present in the database. This sequence, which
contains consensus-binding sequences for CGCC/CACCC-related
proteins, follows a direct repeat in the genomic DNA. We analyzed
this region in 24 alleles from unrelated persons and found that all
24 alleles contained the 12 bp. The EST clone that extends through
this region (IMAGE clone 5174748) also contains the 12 bp.
To begin to identify sequences essential for KCC1 gene expression,
plasmids containing 5⬘-flanking sequences linked to a luciferase
reporter gene were transiently transfected into K562 and HeLa
cells. Plasmids containing KCC1 gene fragments from ⫺1938,
⫺720, and ⫺369 to ⫹81 directed high levels of relative luciferase
expression (Figure 3). A plasmid with the 3⬘ end of ⫺369/⫹81
deleted at the 3⬘ end, from ⫹81 to ⫹18, p-369/⫹18, directed levels
of relative luciferase expression 25.5 ⫾ 5.8-fold over background
in K562 cells and 138.1 ⫾ 1.9-fold over background in HeLa cells
(Figure 3). A plasmid with this promoter fragment in reverse
orientation, p⫹18/⫺386 reverse, directed decreased expression or
no expression of the reporter gene. Further deletion of this
promoter fragment at the 5⬘ end to create p-199/⫹18 also directed
activity in erythroid and nonerythroid cells (Figure 3). This
promoter fragment contains potential binding sites for GATA-1 and
for Sp1 and CACCC-related proteins, a combination shown to be
adequate for expression of a minimal promoter in erythroidspecific genes.45,47,48
hKCC1 promoter contains binding sites for Sp1 and AP-2
binding proteins
To identify binding sites for transcription factors within the ⫺199 to
⫹81 hKCC1 promoter region, DNase I footprinting analysis with
nuclear extracts from K562 cells was performed. A single protected
region from ⫺24 to ⫺9 was observed (Figure S2). This protected region
contains consensus-binding sequences for AP-2 (AP-2 site 2; Figures
2-3) and Sp1 (Sp1 site 1; Figures 2-3). The upstream GATA-1 and AP-2
consensus-binding sequences (GATA sites 1-2, AP-2 site 1; Figure 3)
and the downstream AP-2 and Sp1 consensus-binding sequences (AP-2
site 3, Sp1 sites 2-3), all contained within the sequence of the
footprinting probes, were not protected.
AP-2 proteins bind to the hKCC1 gene core promoter in vitro
To determine whether nuclear proteins could bind the footprinted
AP-2 site in vitro, double-stranded oligonucleotides containing the
corresponding hKCC1 promoter AP-2 sequences or control sequences (Table S1)49 were prepared and used as probes in gel shift
analyses. A single major complex was identified using the KCC1
AP-2 probe that migrated at the same mobility as the control AP-2
probe with both K562 (erythroid) (Figure 4A) and HeLa (not
shown) extracts. This complex was effectively competed away by
Figure 4. Gel mobility shift assays of the AP-2 and Sp1 sites of the hKCC1 gene promoter. Gel mobility shift assays using oligonucleotide probes corresponding to the
AP-2 site 2 and Sp1 site 1 consensus-binding sequences of the human KCC1 promoter were performed using K562 nuclear extracts. (A) The probe used in lanes 1 to 5
corresponds to wild-type KCC1 AP-2, the probe used in lanes 6 to 10 corresponds to mutant KCC1 AP-2, and the probe used in lanes 11 to 15 corresponds to a control AP-2.
Unlabeled, double-stranded oligonucleotide was added to the reactions as competitor where indicated. (B) The probe used in lanes 1 to 5 corresponds to wild-type KCC1 AP-2,
and the probe used in lanes 6 and 7 corresponds to control AP-2. Specific AP-2 antibody was added to the reaction mixtures where indicated. (C) The probe used in lanes 1 to 3
corresponds to wild-type KCC1 Sp1, the probe used in lanes 4 to 6 corresponds to mutant KCC1 Sp1, and the probe used in lanes 7 to 9 corresponds to control Sp1. Specific
Sp1 antibody was added to the reaction mixtures where indicated.
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
4306
ZHOU et al
BLOOD, 1 JUNE 2004 䡠 VOLUME 103, NUMBER 11
mutation known to disrupt GATA-1 binding and promoter function
(GATA to GTTA)53 into the KCC1 promoter GATA-1 sites did not
significantly affect promoter activity in erythroid cells (GATA 1,
186.1 ⫹ 39.5; GATA 2, 160.8 ⫹ 19.8).
AP-2 transactivates the hKCC1 gene promoter
in heterologous cells
Figure 5. Forced expression of the hKCC1 gene promoter in HepG2 cells.
A human KCC1 promoter/luciferase reporter plasmid was cotransfected with increasing amounts of AP-2 cDNA expression plasmids. Dose-dependent activation of the
hKCC1 promoter was observed with all 4 AP-2–binding proteins. Error bars indicate
SD.
an excess of unlabeled homologous or control AP-2 oligonucleotide. A mutant KCC1 AP-2 oligonucleotide did not form a
DNA–protein complex, nor did it effectively displace wild-type
KCC1 AP-2 or control AP-2 oligonucleotides in competition assays
(Figure 4A). The inclusion of AP-2 ␣, AP-2 ␤, AP-2 ␥, or AP-2 ␦
antisera abolished the DNA binding (Figure 4B). These data
indicated that AP-2–related proteins bind in vitro to a site of the
hKCC1 gene promoter.
Sp1 binds to the hKCC1 gene core promoter in vitro
Similarly, to determine whether nuclear proteins could bind the
footprinted Sp1 site in vitro, double-stranded oligonucleotides
containing the corresponding hKCC1 promoter Sp1 sequences or
control sequences (Table S1)50 were prepared and used as probes in
gel shift analyses. A major complex was identified using the KCC1
Sp1 probe that migrated at the same mobility as the control Sp1
probe with K562 and HeLa extracts (Figure 4C). The inclusion of
anti-Sp1 antisera supershifted most of the complex. A mutant
KCC1 Sp1 oligonucleotide (Table S1) did not form a DNA–protein
complex. These data indicate that Sp1 binds in vitro to a site of the
hKCC1 gene promoter.
AP-2 proteins are major activators of the hKCC1 gene promoter
To further assess the relative importance of AP-2 in promoter
function, mutations known to disrupt AP-2 binding (GCCCGGGGG to GACCGGTGG)51 were introduced into the AP-2
site protected in DNase I footprinting in the KCC1 promoterreporter gene plasmid, and its effect was assayed in transiently
transfected K562 cells. Mutation of this AP-2 site reduced promoter activity by more than half, from 194.1 ⫾ 12.6 (wild-type
promoter activity) to 82.7 ⫾ 31.0. Similarly, a mutation known to
disrupt Sp1 binding (GGCGGG to GTCGGG)52 was introduced
into the Sp1 site protected in DNase I footprinting in the KCC1
promoter–reporter gene plasmid, and its effect was assayed in
transiently transfected K562 cells. Mutation of this Sp1 site
reduced promoter activity by one third, to 120.3 ⫾ 10.1.
To determine whether other potential transcription factor–
binding sites contributed to promoter function in vitro, individual
mutations were introduced into the remaining Sp1, AP-2, and
GATA-1 sites shown in Figure 3. Mutation of the other AP-2 and
Sp1 sites did not significantly affect promoter activity (wild-type
promoter, 194.1 ⫾ 12.6; AP-2 1, 158.4 ⫾ 26.2; AP-2 3, 189.9 ⫾ 9.9;
Sp12, 185.1 ⫾ 18.5; Sp1 3 166.7 ⫾ 18.2). Introduction of a
Cotransfection of a minimal hKCC1 promoter/luciferase plasmid,
p-117/⫹81 (see below) with AP-2 ␣, AP-2 ␤, AP-2 ␥, or AP-2 ␦
cDNA expression plasmids into HepG2 cells resulted in increasing
luciferase activity with increasing amounts of AP-2 plasmid
(Figure 5). The ability of AP-2 to transcriptionally activate the
hKCC1 promoter in a dose-dependent manner in HepG2 cells,
which do not contain AP-2 related proteins, further demonstrates
the importance of AP-2 proteins in hKCC1 promoter function.
TATA-less KCC1 gene core promoter contains functional InR
and DPE sequences
Transfection assays in K562 and HeLa cells demonstrated that
deletion of 63 bp of a 3⬘ sequence from the 5⬘ flanking DNA in the
KCC1 promoter plasmid, p-369/⫹81 to p-369/⫹18, significantly
decreased reporter gene activity more than 10-fold (Figure 3). This
sequence contains consensus-binding sites for AP-2– and CGCC/
CACCC–related proteins. However, mutation of the AP-2 site (site
3, GCCCGGGGC to GCACGGGTC)51 and the Sp1 sites (sites 2
and 3)52 had no effect on reporter gene activity. Comparison of the
sequence from this region between human and mouse revealed
100% conservation of the protected AP-2 and Sp1 sites. In addition,
43 of 44 nucleotides from position ⫺6 to ⫹38 (numbering
according to human) were homologous. This region encodes the
transcription initiation site (the InR) and the sequences GGGCG at
position ⫹34 to ⫹ 38.
These sequences closely match the consensus-binding sequences and location/spacing for a downstream promoter element,
or DPE (KCC1, GGGCGT; DPE, A/G/T C/G A/T C/T A/C/G
CT).54,55 The presence of an InR and a DPE in a TATA-less
promoter, a combination found primarily in Drosophila gene
promoters,55-57 is beginning to be recognized as an important
component of mammalian core promoters.58-60 Most DPEs function
cooperatively with the InR to direct basal transcription of TATAless promoters. In other cases, they act to recruit transcription
factors not generally regarded as part of the basal transcription
machinery to regulate transcription (Figure 6).61
To examine whether a promoter fragment that maintained the
DPE but deleted the remainder of downstream 5⬘ flanking sequences still directed high-level luciferase expression, the plasmid
p-369/⫹41 was examined in transfection assays. Luciferase expression was reduced by only 20% (Figure S3). To test whether the
downstream DPE consensus sequences were functional, a mutation
predicted to disrupt DPE function (GGGCGTG to CCCACCC)
was introduced into the hKCC1 DPE consensus sequence, p⫹369/
⫹81MutantDPE, and the effect was examined in transfected K562
cells. This mutation decreased luciferase activity by more than two
Figure 6. Comparison of human and murine KCC1 core promoter sequences.
The AP-2, Sp1, InR, and core DPE sites are conserved between species. The bold A
indicates the transcription insertion site.
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
BLOOD, 1 JUNE 2004 䡠 VOLUME 103, NUMBER 11
thirds (Figure S3). In promoters with functional DPEs, the spacing
between the InR and the DPE is strictly regulated, usually with the
DPE beginning at position ⫹28. However, there is variability, with
some DPEs starting between positions ⫹29 and ⫹32, such as the
Drosophila engrailed or E75A DPE, located at position ⫹32.56 In
Drosophila promoters, adding 3 bp between the InR and the DPE
has been shown to decrease the expression of a linked reporter
gene. Introducing a 3-bp spacer between the hKCC1 InR and DPE
(AGA inserted between nucleotides [nts] ⫹18 and ⫹19), p-369/
⫹813bpInsert, decreased luciferase reporter gene activity by more
than one third in transfected cells (Figure S3). To test whether a
minimal promoter fragment with the downstream promoter sequences still conferred high-level activity to a reporter gene, a core
promoter fragment containing the footprinted Sp1 site, the footprinted AP-2 site, and the InR was linked to downstream containing
the DPE in a luciferase reporter plasmid, p-117/⫹81. In transiently
transfected K562 cells, this plasmid directed luciferase expression
at levels just slightly less than the p-369/⫹81 bp promoter fragment
(Figure S3).
Additional transfection assays were performed in HeLa cells
using minimal core promoter fragments in luciferase reporter
plasmids to examine the effect of mutations of individual elements
on promoter function. A fragment containing single Sp1 and AP-2
sites, the InR and the DPE p-26/⫹81, directed significant luciferase
activity, 180.5 ⫾ 31.7 (Figure 7A). Deleting 10 bp, which removed
the AP-2 site p-16/⫹81, reduced activity by one third (Figure 7A).
Mutation of the Sp1 site, p-16/⫹81MutantSp1, decreased activity
by almost half. Mutation of the InR, the DPE, or both completely
abolished promoter function.
To gain additional insight into the function of the KCC1
promoter, the KCC1 InR and DPE elements were substituted into
the minimal human TAFII55 promoter. TAFII55 is a TATA-less gene
that contains a functional initiator and a downstream promoter
element beginning at position ⫹29.62 Two plasmids were prepared.
One was a minimal wild-type TAFII55 promoter, 5⬘-CCGGGTACCCCTCCCGCCCCGCGTCGCGACGTAGCACTTCCGTTT
TTGCTGGG TAGGCGACCCGGACGGGAGAAGCTTGCC-3⬘,
linked to a luciferase reporter gene. The other was a TAFII55
promoter, with the wild-type InR and DPE replaced by the human
KCC1 promoter InR and DPE elements, 5⬘-CCGGGTACCCCTCCCGCCCCGCGTCGCGACG TAGAAGTGCCGTTTTTGCTGGG TAGGCGACCCGGGGCGTGAGAAGCTTGCC-3⬘ (Figure
7B). If the KCC1 InR and DPE elements were nonfunctional, no
luciferase activity would have been directed by the TAFII55/KCC1
HUMAN KCC1 PROMOTER
4307
hybrid promoter. The TAFII55/KCC1 hybrid promoter directed
levels of luciferase expression approximately 70% of the wild-type
TAFII55 promoter (Figure 7B), indicating functionality of these
elements in a different promoter context.
Chromatin immunoprecipitation analysis of the minimal hKCC1
promoter region
Histone modifications within the minimal hKCC1 gene promoter were examined using a ChIP assay with antidiacetyl
histone H3 and antitetraacetyl histone H4 antibodies and PCR
primers (K and L) that amplified across a 128-bp core promoter
region. Plots of SYBR green fluorescence (relative units)
compared with initial input DNA concentrations were linear for
K562 (erythroid) and HeLa (nonerythroid) cells, with R2 ranging
from 0.097 to 0.99 (not shown). Representative amplification
plots for quantitative analysis of histones H3 and H4 in K562
and HeLa cells are shown in Figure 8A. Dissociation plots from
individual amplicons demonstrated single peaks, indicating
amplification of a single amplicon. This was verified by
ethidium bromide–stained agarose gel electrophoresis.
The core histones H3 and H4 were hyperacetylated in this
region in chromatin from K562 cells and HeLa cells (Figure 8B).
Acetylation of core histones in nucleosomes is a critical chromatin
modification. Histone acetylation alters the structure of the nucleosome and higher-order chromatin, increasing the accessibility of
nucleosomal DNA, and the acetyl lysine residue may provide a
platform for the interaction of proteins involved in transcription.
Discussion
The chloride-dependent, sodium-independent cotransport of potassium and chloride in a 1:1 stoichiometry in the erythrocyte has been
studied in great detail.1,17 Initially, K-Cl cotransport was viewed as
a developmental process in which cotransporter activity promotes
the efflux of potassium followed by water from high-potassium
erythroid precursors and reticulocytes, decreasing cell volume with
cellular maturation. This cotransport activity, which is negligible in
mature erythrocytes, was increased in certain hemoglobinopathies,
particularly sickle cell disease, contributing to cellular dehydration.
In the erythrocyte, K-Cl cotransport activity has been attributed to
KCC1 with possibly some contribution from KCC3.63
Figure 7. InR and DPE are both critical for hKCC1 promoter function. (A) Plasmids containing minimal hKCC1 gene promoter fragments inserted upstream of the firefly
luciferase gene were transfected into HeLa cells and luciferase activity was determined as described in “Materials and methods.” Mutations are marked with the letter X. See
“Materials and methods” for details. Data are mean ⫾ SD of at least 6 independent transfection experiments. (B) Plasmids containing either a minimal wild-type hTAFII55
promoter fragment or an hTAFII55 promoter fragment with the InR and DPE elements replaced by the human KCC1 InR and DPE elements, inserted upstream of the firefly
luciferase gene, were transfected into HeLa cells, and luciferase activity was determined as described.
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
4308
BLOOD, 1 JUNE 2004 䡠 VOLUME 103, NUMBER 11
ZHOU et al
Figure 8. Quantitative ChIP analysis of the hKCC1
core promoter region. (A) Representative amplification
plots of preimmune serum and DNA from chromatin
immunoprecipitated with anti-H3 and anti-H4 antibodies
at the hKCC1 gene core promoter in K562 and HeLa
cells. PI indicates preimmune serum. (B) The core
promoter region of the hKCC1 gene is hyperacetylated
by H3 and H4 in K562 and HeLa cells in chromatin
immunoprecipitation assays. See text for details. Error
bars indicate SD.
Northern blot analyses with KCC1-specific probes demonstrated that the RNA is ubiquitously distributed, suggesting function for KCC1 outside the erythrocyte.3,9 Beyond its possible
housekeeping function, the role of KCC1 in volume regulation and
transepithelial transport in renal cells, in vascular reactivity, in
cervical cancer, and in the genesis of arrhythmias after myocardial
ischemia are some of the functions under investigation.2,64-68
The identification of a TATA-less KCC1 gene promoter containing functional InR and DPE elements is an unusual finding in a
mammalian promoter. In Drosophila, approximately half of all core
promoters contain a TATA box and an InR at the transcription
initiation site. The other half lack a TATA box and contain an InR
and a DPE located approximately 30 bp 3⬘ of the transcription
initiation site.54,59 The TATA box, the InR, and the DPE are capable
of recognizing the TFIID complex. In mammalian genes, core
promoter structure is more complex than Drosophila. Fewer
promoters contain TATA boxes,69 fewer promoters have TATA
boxes and InR, DPEs have been rarely described,62,70,71 and many
mammalian promoters lack all 3 core promoter elements.60 It is
likely that the variable occurrence of TATA, InR, and DPE use
makes an important contribution to combinatorial gene regulation,60,72-76 with differences arising not from mechanisms of
transcription initiation from different core promoter structures but
from interactions with transcription factors not considered part of
the general transcription machinery.31,60,61
Similar to the KCC1 promoter, several TATA-less promoters
are regulated by Sp1 and AP-2 proteins.69,76,77 One of these, the
human TAFII55 gene, is one of the few mammalian genes
described with function InR and DPE elements.69 It will be
interesting to determine whether this combination—that is, a
TATA-less core promoter with functional InR and DPEs regulated by Sp1 and AP-2—emerges as a common mammalian core
promoter arrangement.
Acknowledgment
Sequences reported in this paper have been deposited in the
GenBank database (AY211326).
References
1. Lauf PK, Adragna NC. K-Cl cotransport: properties and molecular mechanism. Cell Physiol Biochem. 2000;10:341-354.
2. Mount DB, Gamba G. Renal potassium-chloride
cotransporters. Curr Opin Nephrol Hypertens.
2001;10:685-691.
3. Gillen CM, Brill S, Payne JA, Forbush B 3rd. Molecular cloning and functional expression of the
K-Cl cotransporter from rabbit, rat, and human:a
new member of the cation-chloride cotransporter
family. J Biol Chem. 1996;271:16237-16244.
4. Payne JA, Stevenson TJ, Donaldson LF. Molecular characterization of a putative K-Cl cotransporter in rat brain: a neuronal-specific isoform.
J Biol Chem. 1996;271:16245-16252.
5. Hiki K, D’Andrea RJ, Furze J, et al. Cloning, characterization, and chromosomal location of a novel
human K⫹-Cl⫺ cotransporter. J Biol Chem. 1999;
274:10661-10667.
6. Mount DB, Mercado A, Song L, et al. Cloning and
characterization of KCC3 and KCC4, new members of the cation-chloride cotransporter gene
family. J Biol Chem. 1999;274:16355-16362.
7. Race JE, Makhlouf FN, Logue PJ, Wilson FH,
Dunham PB, Holtzman EJ. Molecular cloning and
functional characterization of KCC3, a new K-Cl
cotransporter. Am J Physiol. 1999;277:C1210C1219.
8. Su W, Shmukler BE, Chernova MN, et al. Mouse
K-Cl cotransporter KCC1: cloning, mapping,
pathological expression, and functional regulation. Am J Physiol. 1999;277:C899-C912.
9. Pellegrino CM, Rybicki AC, Musto S, Nagel RL,
Schwartz RS. Molecular identification and expression of erythroid K:Cl cotransporter in human
and mouse erythroleukemic cells. Blood Cells
Mol Dis. 1998;24:31-40.
10. Mercado A, Song L, Vazquez N, Mount DB,
Gamba G. Functional comparison of the K⫹-Cl⫺
cotransporters KCC1 and KCC4. J Biol Chem.
2000;275:30326-30334.
11. Howard HC, Mount DB, Rochefort D, et al. The
K-Cl cotransporter KCC3 is mutant in a severe
peripheral neuropathy associated with agenesis
of the corpus callosum. Nat Genet. 2002;32:384392.
12. Shen MR, Chou CY, Hsu KF, et al. The KCl cotransporter isoform KCC3 can play an important
role in cell growth regulation. Proc Natl Acad Sci
U S A. 2001;98:14714-14719.
13. Williams JR, Sharp JW, Kumari VG, Wilson M,
Payne JA. The neuron-specific K-Cl cotransporter, KCC2: antibody development and initial
characterization of the protein. J Biol Chem.
1999;274:12656-12664.
14. Song L, Mercado A, Vazquez N, et al. Molecular,
functional, and genomic characterization of human KCC2, the neuronal K-Cl cotransporter.
Brain Res Mol Brain Res. 2002;103:91-105.
15. Rivera C, Voipio J, Payne JA, et al. The K⫹/Cl⫺
co-transporter KCC2 renders GABA hyperpolarizing during neuronal maturation. Nature. 1999;
397:251-255.
16. Hubner CA, Stein V, Hermans-Borgmeyer I,
Meyer T, Ballanyi K, Jentsch TJ. Disruption of
KCC2 reveals an essential role of K-Cl cotransport already in early synaptic inhibition. Neuron.
2001;30:515-524.
17. Boettger T, Hubner CA, Maier H, Rust MB, Beck
FX, Jentsch TJ. Deafness and renal tubular acidosis in mice lacking the K-Cl co-transporter
Kcc4. Nature. 2002;416:874-878.
18. Lauf PK, Bauer J, Adragna NC, et al. Erythrocyte
K-Cl cotransport: properties and regulation. Am J
Physiol. 1992;263:C917-C932.
19. Bookchin RM, Lew VL. Sickle red cell dehydration: mechanisms and interventions. Curr Opin
Hematol. 2002;9:107-110.
20. Merciris P, Giraud F. How do sickle cells become
dehydrated? Hematol J. 2001;2:200-205.
21. De Franceschi L, Fumagalli L, Olivieri O, Corrocher R, Lowell CA, Berton G. Deficiency of Src
family kinases Fgr and Hck results in activation of
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
BLOOD, 1 JUNE 2004 䡠 VOLUME 103, NUMBER 11
erythrocyte K/Cl cotransport. J Clin Invest. 1997;
99:220-227.
22. Olivieri O, Vitoux D, Galacteros F, et al. Hemoglobin variants and activity of the (K⫹Cl⫺) cotransport system in human erythrocytes. Blood. 1992;
79:793-797.
23. Zhou GP, Anderson KP, Joiner CH, Gallagher PG.
Modification of erythrocyte hydration in the treatment of sickle cell disease. Blood Cells Mol Dis.
2001;27:65-68.
24. Nagel RL. Pleiotropic and epistatic effects in
sickle cell anemia. Curr Opin Hematol. 2001;8:
105-110.
HUMAN KCC1 PROMOTER
40. Altschul SF, Gish W, Miller W, Myers EW, Lipman
DJ. Basic local alignment search tool. J Mol Biol.
1990;215:403-410.
61. Willy PJ, Kobayashi R, Kadonaga JT. A basal
transcription factor that activates or represses
transcription. Science. 2000;290:982-985.
42. Javahery R, Khachi A, Lo K, Zenzie-Gregory B,
Smale ST. DNA sequence requirements for transcriptional initiator activity in mammalian cells.
Mol Cell Biol. 1994;14:116-127.
62. Zhou T, Chiang CM. The intronless and TATAless human TAF(II)55 gene contains a functional
initiator and a downstream promoter element.
J Biol Chem. 2001;276:25503-25511.
43. Bucher P. Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements
derived from 502 unrelated promoter sequences.
J Mol Biol. 1990;212:563-578.
63. Lauf PK, Zhang J, Delpire E, Fyffe RE, Mount DB,
Adragna NC. K-Cl co-transport: immunocytochemical and functional evidence for more than
one KCC isoform in high K and low K sheep
erythrocytes. Comp Biochem Physiol A Mol Integr
Physiol. 2001;130:499-509.
44. Cantor AB, Orkin SH. Transcriptional regulation of
erythropoiesis: an affair involving multiple partners. Oncogene. 2002;21:3368-3376.
26. De Franceschi L, Bachir D, Galacteros F, et al.
Oral magnesium pidolate: effects of long-term
administration in patients with sickle cell disease.
Br J Haematol. 2000;108:284-289.
46. Bieker JJ. Kruppel-like factors: three fingers in
many pies. J Biol Chem. 2001;276:34355-34358.
28. Casula S, Shmukler BE, Wilhelm S, et al. A dominant negative mutant of the KCC1 K-Cl cotransporter: both N- and C-terminal cytoplasmic domains are required for K-Cl cotransport activity.
J Biol Chem. 2001;276:41870-41878.
29. Wang X, Su H, Bradley A. Molecular mechanisms
governing Pcdh-gamma gene expression: evidence for a multiple promoter and cis-alternative
splicing model. Genes Dev. 2002;16:1890-1905.
30. Tasic B, Nabholz CE, Baldwin KK, et al. Promoter
choice determines splice site selection in protocadherin alpha and gamma pre-mRNA splicing.
Mol Cell. 2002;10:21-33.
31. Auboeuf D, Honig A, Berget SM, O’Malley BW.
Coordinate regulation of transcription and splicing
by steroid receptor coregulators. Science. 2002;
298:416-419.
32. Shepherd NS, Pfrogner BD, Coulby JN, et al.
Preparation and screening of an arrayed human
genomic library generated with the P1 cloning
system. Proc Natl Acad Sci U S A. 1994;91:26292633.
33. Holtzman EJ, Kumar S, Faaland CA, et al. Cloning, characterization, and gene organization of
K-Cl cotransporter from pig and human kidney
and C. elegans. Am J Physiol. 1998;275:F550F564.
34. Chomczynski P, Sacchi N. Single-step method of
RNA isolation by acid guanidinium thiocyanatephenol-chloroform extraction. Anal Biochem.
1987;162:156-159.
35. Edwards JB, Delort J, Mallet J. Oligodeoxyribonucleotide ligation to single-stranded cDNAs: a
new tool for cloning 5⬘ ends of mRNAs and for
constructing cDNA libraries by in vitro amplification. Nucleic Acids Res. 1991;19:5227-5232.
36. Andrews NC, Faller DV. A rapid micropreparation
technique for extraction of DNA-binding proteins
from limiting numbers of mammalian cells.
Nucleic Acids Res. 1991;19:2499.
37. Gallagher PG, Forget BG. An alternate promoter
directs expression of a truncated, muscle- specific isoform of the human ankyrin 1 gene. J Biol
Chem. 1998;273:1339-1348.
38. Johnson KD, Bresnick EH. Methods. 2002;26:2736.
39. Im H, Park C, Feng Q, et al. J Biol Chem. 2003;
278:18346-18352.
combinatorial gene regulation. Genes Dev. 2001;
15:2503-2508.
41. Lo K, Smale ST. Generality of a functional initiator
consensus sequence. Gene. 1996;182:13-22.
25. De Franceschi L, Bachir D, Galacteros F, et al.
Oral magnesium supplements reduce erythrocyte
dehydration in patients with sickle cell disease.
J Clin Invest. 1997;100:1847-1852.
27. Anderson K, Crable SC, Gallagher PG, Joiner
CH. Expression of multiple KCl cotransporter isoforms in sickle and normal erythroid cells [abstract]. Blood 2002;100:666a.
4309
45. Bieker JJ. Erythroid-specific transcription. Curr
Opin Hematol. 1998;5:145-150.
47. Hilger-Eversheim K, Moser M, Schorle H, Buettner R. Regulatory roles of AP-2 transcription factors in vertebrate development, apoptosis and
cell-cycle control. Gene. 2000;260:1-12.
48. Orkin SH. Transcription factors and hematopoietic development. J Biol Chem. 1995;270:49554958.
49. Williams T, Tjian R. Analysis of the DNA-binding
and activation properties of the human transcription factor AP-2. Genes Dev. 1991;5:670-682.
50. Hartzog GA, Myers RM. Discrimination among
potential activators of the beta-globin CACCC
element by correlation of binding and transcriptional properties. Mol Cell Biol. 1993;13:44-56.
51. Ren Y, Liao WS. Transcription factor AP-2 functions as a repressor that contributes to the liverspecific expression of serum amyloid A1 gene.
J Biol Chem. 2001;276:17770-17778.
52. Berg JM. Sp1 and the subfamily of zinc finger
proteins with guanine-rich binding sites. Proc Natl
Acad Sci U S A. 1992;89:11109-11110.
64. Liapis H, Nag M, Kaji DM. K-Cl cotransporter expression in the human kidney. Am J Physiol.
1998;275:C1432-C1437.
65. Adragna NC, White RE, Orlov SN, Lauf PK. K-Cl
cotransport in vascular smooth muscle and erythrocytes: possible implication in vasodilation. Am J
Physiol Cell Physiol. 2000;278:C381-C390.
66. Shen MR, Chou CY, Ellory JC. Swelling-activated
taurine and K⫹ transport in human cervical cancer cells: association with cell cycle progression.
Pflugers Arch. 2001;441:787-795.
67. Shen MR, Chou CY, Hsu KF, et al. KCl cotransport is an important modulator of human cervical
cancer growth and invasion. J Biol Chem. 2003;
278:39941-39950.
68. Yan GX, Chen J, Yamada KA, Kleber AG, Corr
PB. Contribution of shrinkage of extracellular
space to extracellular K⫹ accumulation in myocardial ischaemia of the rabbit. J Physiol. 1996;
490:215-228.
69. Zhang MQ. Identification of human gene core
promoters in silico. Genome Res. 1998;8:319326.
53. Zon LI, Youssoufian H, Mather C, Lodish HF, Orkin SH. Activation of the erythropoietin receptor
promoter by transcription factor GATA-1. Proc
Natl Acad Sci U S A. 1991;88:10638-10641.
70. Knutson A, Castano E, Oelgeschlager T, Roeder
RG, Westin G. Downstream promoter sequences
facilitate the formation of a specific transcription
factor IID-promoter complex topology required for
efficient transcription from the megalin/low density lipoprotein receptor-related protein 2 promoter. J Biol Chem. 2000;275:14190-14197.
54. Kutach AK, Kadonaga JT. The downstream promoter element DPE appears to be as widely used
as the TATA box in Drosophila core promoters.
Mol Cell Biol. 2000;20:4754-4764.
71. Croager EJ, Gout AM, Abraham LJ. Involvement
of Sp1 and microsatellite repressor sequences in
the transcriptional control of the human CD30
gene. Am J Pathol. 2000;156:1723-1731.
55. Butler JE, Kadonaga JT. The RNA polymerase II
core promoter: a key component in the regulation
of gene expression. Genes Dev. 2002;16:25832592.
72. Hansen SK, Tjian R. TAFs and TFIIA mediate differential utilization of the tandem Adh promoters.
Cell. 1995;82:565-575.
56. Burke TW, Kadonaga JT. Drosophila TFIID binds
to a conserved downstream basal promoter element that is present in many TATA-box–deficient
promoters. Genes Dev. 1996;10:711-724.
57. Burke TW, Kadonaga JT. The downstream core
promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFII60
of Drosophila. Genes Dev. 1997;11:3020-3031.
58. Smale ST, Jain A, Kaufmann J, Emami KH, Lo K,
Garraway IP. The initiator element: a paradigm for
core promoter heterogeneity within metazoan
protein-coding genes. Cold Spring Harb Symp
Quant Biol. 1998;63:21-31.
59. Burke TW, Willy PJ, Kutach AK, Butler JE, Kadonaga JT. The DPE, a conserved downstream
core promoter element that is functionally analogous to the TATA box. Cold Spring Harb Symp
Quant Biol. 1998;63:75-82.
60. Smale ST. Core promoters: active contributors to
73. Novina CD, Roy AL. Core promoters and transcriptional control. Trends Genet. 1996;12:351355.
74. Ren B, Maniatis T. Regulation of Drosophila Adh
promoter switching by an initiator- targeted repression mechanism. EMBO J. 1998;17:10761086.
75. Butler JE, Kadonaga JT. Enhancer-promoter
specificity mediated by DPE or TATA core promoter motifs. Genes Dev. 2001;15:2515-2519.
76. Mavrothalassitis GJ, Watson DK, Papas TS. Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene. Proc
Natl Acad Sci U S A. 1990;87:1047-1051.
77. Weis L, Reinberg D. Accurate positioning of RNA
polymerase II on a natural TATA-less promoter is
independent of TATA-binding-protein-associated
factors and initiator-binding proteins. Mol Cell
Biol. 1997;17:2973-2984.
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
2004 103: 4302-4309
doi:10.1182/blood-2003-01-0107 originally published online
February 19, 2004
Human potassium chloride cotransporter 1 (SLC12A4) promoter is
regulated by AP-2 and contains a functional downstream promoter
element
Guo-Ping Zhou, Clara Wong, Robert Su, Scott C. Crable, Kathleen P. Anderson and Patrick G.
Gallagher
Updated information and services can be found at:
http://www.bloodjournal.org/content/103/11/4302.full.html
Articles on similar topics can be found in the following Blood collections
Gene Expression (1086 articles)
Red Cells (1159 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.