International Journal of Systematic and Evolutionary Microbiology (2015), 65, 3392–3399
DOI 10.1099/ijsem.0.000426
Lachancea quebecensis sp. nov., a yeast species
consistently isolated from tree bark in the
Canadian province of Québec
Kelle C. Freel,1 Guillaume Charron,2 Jean-Baptiste Leducq,2
Christian R. Landry2 and Joseph Schacherer1
Correspondence
Joseph Schacherer
1
[email protected]
2
Department of Genetics, Genomics and Microbiology, University of Strasbourg/CNRS, UMR7156,
Strasbourg, France
Département de Biologie, Institut de Biologie Intégrative et des Systèmes, PROTEO Université
Laval, Québec, Canada
A thorough sampling of maple, oak, birch, and apple tree bark in North America yielded a set of
isolates that represent a yeast species not yet formally described. The strains obtained were all
isolated from the Canadian province of Québec. These four isolates have identical
electrophoretic karyotypes, distinct from other species of the genus Lachancea, and are most
closely related to the formally recognized species Lachancea thermotolerans according to the
D1/D2 domain of the LSU rDNA gene and 5.8S–ITS region. Previous studies revealed the
existence of a population of strains closely related to L. thermotolerans, with unique D1/D2
sequences and the ability to grow on melibiose, which is also true for these isolates. The
sequences obtained here (for the D1/D2, and 5.8S–ITS region) are identical among the four
strains, and in a phylogenetic analysis of the D1/D2 region, the strains form a distinct clade
with the previously described population closely related to L. thermotolerans, composed of
isolates from Japan, as well as from the provinces of Ontario and Québec in Canada. On the
basis of select physiological and phylogenetic characteristics, a novel ascosporogenous yeast
species, Lachancea quebecensis sp. nov., is proposed. The type strain LL11_022T (5CBS
14138T5CLIB 1763T5UCDFST 15-106T) was isolated from maple tree bark in the Station
Duchesnay, QC region of Québec, Canada. The MycoBank number is MB811749.
INTRODUCTION
While yeast research has traditionally focused on the
well-known model species Saccharomyces cerevisiae, multiple isolates from various lineages have also been obtained
from natural substrates including soil, tree bark and
insects. Additionally, S. cerevisiae has a population
structure strongly influenced by human domestication
(Schacherer et al., 2009) and does not accurately reflect
the diversity among wild yeast lineages. While yeasts are
closely linked to a variety of industrial processes and are
commonly associated with wine- and beer-making as well
as bread production, they are also important members of
natural microbial communities. Thus, it is imperative to
expand the current knowledge concerning divergent natural
Abbreviation: PFGE, pulsed-field gel electrophoresis.
The GenBank/EMBL/DDBJ accession numbers for the D1/D2
sequence of strains LL11_022T, LL12_068, LL12_073 and LL12_078
are KP793239–KP793242, respectively, and those for the ITS region
sequence of the same strains are KP793243–KP793246, respectively.
3392
populations of yeasts in order to ultimately clarify the mechanisms of genome evolution across the Saccharomycotina.
Within this subphylum, the genus Lachancea represents
an interesting group for comparative genomic studies
because it is composed of various lineages both closely
and distantly related (Souciet et al., 2009). In addition,
this genus is an ideal model for population genomic studies
due to the broad range of intraspecific polymorphisms
found among isolates. Indeed, recent work revealed that
two species of the genus Lachancea, Lachancea kluyveri
and Lachancea thermotolerans, share similar high levels of
variation in their mitochondrial (Friedrich et al., 2015;
Jung et al., 2012) and nuclear genomes (p50.014 and
0.012, respectively) (Friedrich et al., 2012, 2015; Jung
et al., 2012; Freel et al., 2014).
In 2003, a set of closely related lineages within the
Saccharomycotina, including Kluyveromyces waltii, Zygosaccharomyces cidri, Zygosaccharomyces fermentati, Saccharomyces kluyveri and Kluyveromyces thermotolerans were
reclassified into the genus Lachancea, based various
gene sequences (Kurtzman, 2003). Since then, a variety of
Downloaded from www.microbiologyresearch.org by
000426 G 2015 IUMS
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:07:46
Printed in Great Britain
Lachancea quebecensis sp. nov.
additional lineages have been added to this group including
Lachancea dasiensis (Lee et al., 2009), Lachancea meyersii
(Fell et al., 2004), Lachancea mirantina (Pereira et al.,
2011), Lachancea nothofagi (Mestre et al., 2010) and
Lachancea lanzarotensis (González et al., 2013). These
organisms have been isolated from different sources that
are both natural, such as fern leaves and tree bark, as
well as linked to industrial processes, including the fermentation of cachaça (Pereira et al., 2011). The genus Lachancea represents an interesting group of closely related species
that is an ideal model system for inter- and intra-specific
diversity studies, as they constitute a range of phylogenetic
relationships at different evolutionary distances. The
species L. thermotolerans is particularly interesting as it
was previously found to include isolates representing divergent populations (Naumova et al., 2005, 2007; Lachance &
Kurtzman, 2011).
In order to further explore natural lineages of yeasts, and
in particular, to examine the northern distribution of
Saccharomyces paradoxus and S. cerevisiae, over 800
samples (including tree exudate, bark, soil, insects, slugs,
flowers and fruits) were collected over the course of two
years (Charron et al., 2014). These samples were obtained
from the higher latitudes of North America, with the
majority taken in Québec, a traditionally poorly sampled
region (Charron et al., 2014). This exhaustive study yielded
over 100 isolates from a variety of genera in the Saccharomycetaceae. Among the strains identified were four isolates
of the genus Lachancea that were initially considered to be
L. thermotolerans. Further analysis revealed that in fact,
these strains are related to isolates previously identified as
a distinct population of L. thermotolerans, which share
identical D1/D2 sequences, unique electrophoretic karyotypes and the ability to assimilate melibiose (Naumova
et al., 2005, 2007; Lachance & Kurtzman, 2011). Additionally, previous work highlighted that both isolate UWOPS
79-139 and isolate UWOPS 82-231 have atypical isoenzymic profiles, perhaps the first indication that they belong
to a distinct lineage (Sidenberg & Lachance, 1986). This
group of divergent strains is represented by UWOPS
79-139, isolated from black knot on a cherry tree in
St. Anicet in Québec, Canada (Sidenberg & Lachance,
1986), and has been suggested to be a novel species of
the genus Lachancea (Naumova et al., 2007, Lachance &
Kurtzman, 2011). The other three isolates in this previously
described population include two from Japan and one
from Pinery Provincial Park in Ontario, Canada.
The group of four strains identified in this study share
identical pulsed-field gel electrophoresis (PFGE) profiles,
D1/D2 sequences and ITS sequences and were all isolated
from tree bark in the Canadian province of Québec.
On the basis of both phenotypic and phylogenetic analyses,
a novel species of the genus Lachancea is proposed,
Lachancea quebecensis sp. nov.
METHODS
Sample collection and isolation of yeasts. The four strains
recently isolated and discussed in this study were obtained from
maple and oak tree bark samples collected in 2011 from various
locations in Québec, Canada (Table 1) as was reported in 2014
(Charron et al., 2014) using previously described methods
Table 1. Origin of strains isolated from tree bark in North America as well as the strains previously suggested to represent a novel
species of the genus Lachancea
The only previously reported isolate for which a GenBank accession number is available is UWOPS 79-139, the accession numbers for other isolates
are not available (NA ). The original locations of sample collection are listed along with the ecological origin as well as the GenBank accession numbers for the D1/D2 and ITS sequences used in the phylogenetic analysis.
Strain
Geographical Origin
T
LL11_022
LL12_068
LL12_073
LL12_078
NBRC 10066
NBRC 10067
UWOPS 79-139
UWOPS 82-231
St Lawrence Valley, Québec, Canada
(Location 5, (Charron, et al., 2014))
St Lawrence Valley, Québec, Canada
[Location 13, (Charron, et al., 2014)]
Gaspé Peninsula, Québec, Canada
[Location 22, (Charron, et al., 2014)]
Gaspé Peninsula, Québec, Canada
[Location 16, (Charron, et al., 2014)]
Japan (Naumova, et al., 2005)
Japan (Naumova, et al., 2005)
St. Anicet, Québec, Canada
(Sidenberg & Lachance, 1986)
Pinery Provincial Park, Ontario, Canada
(Sidenberg & Lachance, 1986)
http://ijs.microbiologyresearch.org
Ecological Origin
GenBank accession number for:
D1/D2 sequence
ITS sequence
Maple tree bark
KP793239
KP793243
Oak tree bark
KP793240
KP793244
Maple tree bark
KP793241
KP793245
Maple tree bark
KP793242
KP793246
Dead leaves
Flowers
Black knot of cherry tree
(Prunus serotina)
Drosophila sp.
NA
NA
NA
NA
EF46104
NA
NA
NA
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:07:46
3393
K. C. Freel and others
(Sniegowski et al., 2002). Specifically, the type strain LL11_022T was
collected from maple bark at Station Duchesnay in Québec.
Electrophoretic karyotyping. To obtain the PFGE karyotypes of the
strains from L. quebecensis sp. nov., studied here, intact chromosomal
DNA was prepared. The strains examined were grown in 30 ml YPG
overnight in 50 ml centrifuge tubes. The following morning, the
culture was diluted to an OD600 of 0.5 in 40 ml media. Cells were
centrifuged and the supernatant was removed; all centrifugation steps
were for 10 min at 2500 r.p.m. Pellets were then washed with 20 ml
cold 50 mM EDTA (pH 8) and centrifuged. Next, the samples were
washed again with 10 ml CPES [1| CPE (80 mM citric acid,
240 mM Na2HPO4, 40 mM EDTA, H20 to final volume), 1.2 M sorbitol, and 5 mM DTT] and kept on ice until centrifuged. After centrifugation, the supernatant (10 ml) was removed, and cells were
resuspended in 1 ml CPES. In order to prepare plugs required for
electrophoresis, 0.5 ml each cell suspension was added to 50 ml
Zymolase 20T solution (100 mg ml21) in a 15 ml tube, and incubated
at 37 uC for 3 min. After 3 min, 0.5 ml hot 1.2 % agarose was placed
into the 15 ml tube with the cells, vortexed briefly, and using a glass
pipette the cell and agarose suspension was pipetted into the prepared
plug mold. Once dry, the plugs from all wells were removed and put
into containers with approximately 15 ml CPE and 150 ml Zymolase
solution, then incubated for 2 h at 37 uC. While cells incubated, a lysis
buffer (10 mM Tris at pH 8, 0.45 M EDTA, 1 % SDS and 0.25–0.5 ml
proteinase K) was prepared. The CPE/Zymolase buffer was removed
from each sample, replaced with lysis solution and allowed to incubate overnight at 50 uC. In the morning, the plugs were rinsed twice
for 30 min with dH20 at 50 uC followed by two rinses in dH2O for
30 min at ambient temperature. After rinsing, the dH2O was removed
and replaced with 10 ml of 0.25 M EDTA. The plugs were either used
immediately or stored at 4 uC until further analysis. Chromosomal
DNA bands were separated on a 0.9 % agarose gel made with 0.5|
TBE buffer (45 mM Tris/borate, 1 mM EDTA; pH 8.0) run at 14 uC
using the following three steps over 46 h: (1) field switch time of 480 s
for 8 h at 100 V; (2) 360 s for 24 h at 120 V; (3) 90 s for 14 h at 200 V.
After electrophoresis, the gels were stained with ethidium bromide
(0.5 mg ml21) and photographed under UV illumination.
Yeast identification, characterization, DNA sequencing and
phylogenetic analysis. All four L. quebecensis sp. nov., strains
identified were used for phenotypic characterization and sequence
analysis. Standard tests to define taxonomy, as well as sequencing,
were used for strain identification. Physiological, biochemical and
ascospore examination of the yeasts were all performed as previously
described (Yarrow, 1998). The media types used to test for sporulation included: 5 % malt extract agar, cornmeal agar, potassium
acetate agar and synthetic complete media (SDC) lacking phosphate
supplemented with 500 mg ml21 leucine. All assimilation tests were
performed at 30 uC and results were recorded at 3, 5, 7, 14 and
21 days.
In order to obtain genomic DNA, the strains were grown overnight at
30 uC in 20 ml YPD medium to early stationary phase before cells
were harvested by centrifugation. Total genomic DNA was subsequently extracted using the MasterPure Yeast DNA purification kit
(cat no. MPY80200) according to the manufacturer’s instructions.
The variable domain D1/D2 of the 26S rRNA gene was amplified from
the type strain LL11_022T as well as the three other representatives of
this novel lineage. The sequence was obtained using the primers NL-1
(59-GCATATCAATAAGCGGAGGAAAAG-39) and NL-4 (59-GTCCGTGTTTCAAGACGG-39) as previously described (O’Donnell, 1993).
The ITS sequence was obtained with the primers ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC)
as previously described (White et al., 1990). The sequences were
visually inspected and truncated using Mesquite (Maddison & Maddison, 2015), and aligned using Muscle (Edgar, 2004) implemented in
3394
Mesquite for identification of nucleotide changes compared to the
most closely related species, L. thermotolerans (Maddison & Maddison, 2015).
Comparisons to sequences available in the GenBank database were
completed with BLASTN (Altschul et al., 1997); representative
sequences from all currently formally described species of the genus
Lachancea were included in the phylogenetic analyses. Additionally,
three sequences from thus far uncharacterized Lachancea lineages
were also included. These sequences labelled ‘Lachancea sp.’ in the
phylogeny, are identified by their respective strain IDs and GenBank
accession numbers, and were previously included in a summary of the
diversity in the genus Lachancea (Lachance & Kurtzman, 2011). The
curated alignments of sequences from the novel species using 546 bp
for the variable D1/D2 region of the 26S rRNA, was then used to
reconstruct a phylogenetic tree using the neighbour-joining (Saitou &
Nei, 1987) as well as maximum-likelihood methods (based on 1000
bootstrap iterations in both instances) with MEGA 6 software (Tamura
et al., 2013). The tree is drawn to scale, with branch lengths proportional to the number of substitutions per site.
RESULTS AND DISCUSSION
It has been previously demonstrated that species of the
genus Lachancea have eight chromosomes and each harbours specific patterns of highly conserved PFGE karyotypes (Naumova et al., 2007). We performed PFGE with
the four L. quebecensis sp. nov., isolates described here
(LL11_022T, LL12_068, LL12_073 and LL12_078) (Fig. 1).
We found that all of the karyotypes were composed of six
bands, with one of particularly high intensity, most likely
representing the presence of multiple chromosomes of a
similar length. This unique karyotype, which is shared
among strains of L. quebecensis sp. nov., was distinct compared to the pattern observed for L. thermotolerans, the
most closely related species of the genus Lachancea. However, this karyotype is similar to that previously described
for the divergent population of L. thermotolerans isolates
(Naumova et al., 2007). These data support the conclusion
that the four strains reported here, are related to four previously reported strains: two from Canada, isolated from
Prunus serotina in St. Anicet, Québec (UWOPS 79-139)
and Drosophila in Pinery Provincial Park, Ontario
(UWOPS 82-231) as well as two from Japan, isolated
from deciduous leaves (NBRC 10066) and flowers (NBRC
10067). Prior studies stated that these four strains likely represent an undescribed species (Naumova et al., 2005, 2007;
Lachance & Kurtzman, 2011). Indeed, our data indicate that
we have identified additional members of this lineage, and
demonstrate that the PFGE profile is a relatively quick
and affordable method to distinguish this species.
A comparison of the growth characteristics of L. quebecensis
sp. nov., to the closely related L. thermotolerans, revealed
that they display similar morphological and physiological
characteristics (Table 2). After growth on solid YM media,
YPD media, and 5 % malt extract at 30 uC for 3 days, colonies are cream with circular edges and a smooth shiny surface. Under light microscope examination, cells are
spherical and grow via multilateral budding (Fig. 2a).
No ascospores were observed on potassium acetate agar,
5 % malt extract agar, cornmeal agar, V8 agar or SCD
Downloaded from www.microbiologyresearch.org by
International Journal of Systematic and Evolutionary Microbiology 65
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:07:46
Lachancea quebecensis sp. nov.
L. quebecensis sp. nov.
L. thermotolerans
LL11_022T LL12_031 LL12_036
1
2
3
L. quebecensis sp. nov.
L. thermotolerans
LL12_040 LL12_041 LL12_056 LL12_068 LL12_073 LL12_078
4
5
6
7
8
9
Fig. 1. Electrophoretic karyotypes of L. quebecensis sp. nov. and the most closely related species, L. thermotolerans. Lanes
1, 7, 8 and 9 correspond to isolates of L. quebecensis sp. nov. (LL11_022T, LL12_068, LL12_073 and LL12_078). Lanes 2,
3, 4, 5 and 6 represent strains of L. thermotolerans.
agar supplemented with 500 mg ml21 D -leucine after 3, 7 or
10 days of growth at 30 uC. The lack of sporulation could be
due to the fact that cells were grown at 30 uC, which was
potentially too warm for ascospore formation. Isolates
UWOPS 79-131 and UWOPS 82-231 sporulated abundantly after 2 days of growth at 25 uC and one day of
growth at 15 uC on Klein’s acetate agar, producing 1–2
ascospores mostly after isogamous conjugation (M.A.
Lachance, personal communication) (Fig. 2b). In L. thermotolerans, sporulation reportedly occurs after 2–5 days of
growth at 17–25 uC on YM, malt extract or McClary’s acetate agar (Lachance & Kurtzman, 2011). The strains of
L. quebecensis sp. nov. tested in this study all displayed
very similar physiological and morphological characteristics. No differences were observed among isolates in the
assimilation tests or when plated on media with cycloheximide, sodium chloride or 50 % glycerol. No pseudohyphae
were detected using a Dalmau plate and Lugol’s iodine test
was negative for starch production. Additionally, acid
production was not observed using chalk agar, urease
hydrolysis activity was not detected and the diazonium
http://ijs.microbiologyresearch.org
blue B reaction was negative. Interestingly, as was established previously, for isolates from this population (Sidenberg & Lachance, 1986; Naumova et al., 2005, 2007;
Lachance & Kurtzman, 2011), the four strains reported
here are able to utilize melibiose, a characteristic distinguishing this species from L. thermotolerans.
All strains of L. quebecensis sp. nov. exhibited optimum
growth at similar temperatures as L. thermotolerans, ranging from 20–30 uC. However, the four strains of
L. quebecensis sp. nov. demonstrated slow growth at 4 uC.
Interestingly, the type strain LL11_022T clearly grew
better at lower temperatures when compared to three isolates of L. thermotolerans, including the type strain CBS
6340T. This characteristic might be the result of adaptation
to the generally low average temperatures found throughout the year in Québec and the surrounding region.
Indeed, differences in temperature preference have been
implicated in divergent evolution of sympatric species
(Gonçalves et al., 2011; Leducq et al., 2014) and possibly
play a role in driving ecological speciation.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:07:46
3395
K. C. Freel and others
Table 2. Comparison of phenotypic properties of Lachancea quebecensis sp. nov. and other currently recognized species of the
genus Lachancea
Species: 1, L. quebecensis sp. nov. (data from this study); 2, L. dasiensis (Lee et al., 2009); 3, L. waltii (Lachance & Kurtzman, 2011); 4, L. meyersii
(Lachance & Kurtzman, 2011); 5, L. cidri (Lachance & Kurtzman, 2011); 6, L. fermentati (Lachance & Kurtzman, 2011); 7, L. kluyveri (Lachance &
Kurtzman, 2011); 8, L. thermotolerans (Lachance & Kurtzman, 2011); 9, L. lanzarotensis (González et al., 2013); 10, L. nothofagi (Mestre et al., 2010);
11, L. mirantina (Pereira et al., 2011).+, Positive; 2, negative; W , weak; V , variable; D , delayed; S , slow; NA , data not available.
Characteristic
Assimilation of:
D -Galactose
L -Sorbose
Maltose
a,a-Trehalose
Melibiose
Melezitose
Inulin
Glycerol
2-Keto-D -gluconate
DL -Lactate
Succinate
Ethanol
Growth on:
0.01 % Cycloheximide
10 % NaCl
50 % Glucose
1
2
3
+
+
+
2
+
V
W
+
+
+
+
+
+
2
2
2
2
2
2
2
+
2
2
2
2
2
2
2
2
2
+
+
2
+
+
2
+
V
V
+
NA
S
2
S
+
4
W
W /2
+
+
2
+
V
S
V
2
2
6
7
V
+
V
V
+
+
+/W
+/W
2
+
V
V
+
+
V
2
+
2
V
S
+
+
2
+
+
+
V
V
A previous study by Naumova and colleagues was the first
to state that four unique isolates (NBRC 10066, NBRC
10067, UWOPS 79-139, and UWOPS 82-231) represented
a distinct population closely related to L. thermotolerans
(a)
5
V
V
+
2
2
V
V
8
V
+
+
+
2
+
V
+
9
+/W
2
+
+
2
+
2
V
10
D
S
2
+
+
2
+
2
+
2
V
V
V
NA
V
+/W
V
2
V
V
V
+/S
+
V
2
2
+/W
2
2
2
+
+/S
+
2
2
2
2
+
2
+
+
2
V
11
V
V
S
S
2
2
S
+
2
S
2
2
2
2
2
(Naumova et al., 2005). They found that the restriction
pattern of the intergenic spacer regions of these
strains was different in comparison to those from
L. thermotolerans (Naumova et al., 2005). The clearest
(b)
Fig. 2. Ascospore formation and morphology of isolates of L. quebecensis sp. nov. as demonstrated with light microscopy.
(a) Budding cells of L. quebecensis sp. nov. strain LL11_022T after growth for 1 day at 30 8C on YPD agar; image taken at
6100 magnification. (b) Ascospore formation and isogamous conjugation in strain UWOPS 82-231, grown on Klein’s acetate agar, incubated at 25 8C for 2 days and 1 day at 15 8C. Bars, 10 mm.
3396
Downloaded from www.microbiologyresearch.org by
International Journal of Systematic and Evolutionary Microbiology 65
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:07:46
Lachancea quebecensis sp. nov.
manner in which L. quebecensis sp. nov. is distinguished
from other species of the genus Lachancea is according to
phylogenetic analyses. A phylogeny was reconstructed
using 546 bp of the variable D1/D2 region of the 26S
rRNA (Fig. 3). Among the four recently obtained isolates
discussed in this study, all harbour identical D1/D2 and
ITS sequences, which also match those of the previously
reported population of isolates closely related to
L. thermotolerans (Naumova et al., 2007). The D1/D2
sequences all differ from the type strain of
L. thermotolerans (CBS 6340T) by two base pair substitutions and it was previously suggested that this group warrants description as a novel species of the genus Lachancea
(Lachance & Kurtzman, 2011).
Québec and one from Ontario. Two isolates, also representatives of this species, have been reported from Japan (Naumova et al., 2005). Based on phenotypic and phylogenetic
analysis, strains LL11_022T, LL12_068, LL12_073,
LL12_078, UWOPS 79-139, UWOPS 82-231, NBRC
10066 and NBRC 10067 represent a novel species of the
genus Lachancea, for which the name Lachancea quebecensis
sp. nov., is proposed.
Description of Lachancea quebecensis sp. nov.
Lachancea quebecensis (que.bec.en9sis. N.L. fem. adj.
quebecensis of or belonging to Québec, Canada).
After growth for 7 days on YPD agar, colonies are creamy,
circular and glistening. After growth in liquid YPD media
for 3 days at 30 uC, cells are spherical and occur singly.
Vegetative reproduction is by multilateral budding and
no sediment is observed. No pseudomycelium or true
mycelium is formed after growth on Dalmau plates of
cornmeal agar after 10 days at 30 uC. No sporulation is
observed on McClary’s acetate agar, V8 agar, YM agar,
malt agar or cornmeal agar after incubation at 30 uC for
up to 21 days. All strains assimilate D -galactose, maltose,
melibiose, melezitose, glycerol, inulin, and DL -lactate.
Assimilation of L -sorbose, a,a-trehalose and 2-keto-D -gluconate is variable, as is growth on 10 % NaCl plus 5 % glucose. Slow growth is observed on ethanol, and no growth is
evident on 0.01 % cycloheximide. However all strains
The two species L. quebecensis sp. nov. and L. thermotolerans, are very closely related, forming a tight cluster, with
the next most closely associated species being Lachancea
waltii. The identification of this novel species adds to the
interesting evolutionary range in diversity found in the
genus Lachancea. This cluster of species presents an ideal
model system to analyse the divergence between lineages
across multiple distances, and the addition of
L. quebecensis sp. nov. will allow for future studies to
assess changes in genomic evolution between two very closely related species.
Thus far, six isolates of L. quebecensis sp. nov. have been
found in Canada, of which five are from the province of
94*
79*
0.01
75
Lachancea quebecensis LL11_ 022T (KP793239)
Lachancea thermotolerans NRRL Y-8284T (U69581)
Lachancea waltii NRRL Y-8285T (KWU69582)
Lachancea dasiensis CBS 10888T (EU523636)
82*
Lachancea nothofagi NRRL Y-48670T (GQ411403 )
97*
85*
67*
Lachancea sp. strain CBS 6924 (EF463105)
Lachancea lanzarotensis L2C-15T (JX515589)
92*
Lachancea sp. strain IFO 11064 (AB087397)
Lachancea sp. strain IFO 11063 (AB087396)
91
65* Lachancea meyersii NRRL Y-27269T (AY645656)
95*
Lachancea kluyveri NRRL Y-12651T (SKU68552)
Lachancea cidri NRRL Y-12634T (ZCU84236)
99*
Lachancea fermentati NRRL Y-1559T (ZFU84239)
Lachancea mirantina CBS 11717T (FJ666084)
Kluyveromyces marxianus NRRL Y-8281T (KMU94924)
Fig. 3. Phylogenetic relationships of the currently described species of the genus Lachancea based on 546 bp of the D1/D2
domain of the 26S rRNA. The phylogeny was reconstructed using the neighbour-joining method implemented with MEGA 6
software. Asterisks indicate nodes for which both maximum-likelihood and neighbour-joining methods provided over 50 %
bootstrap support. Only the type strain of L. quebecensis sp. nov. (LL11_022T) was included since the D1/D2 sequences
available for the other isolates of this species are identical. A very close relationship to L. thermotolerans is apparent.
Additionally, three sequences representing additional diversity within the genus Lachancea (GenBank accession numbers:
EF463105, AB087396 and AB087397) were included. Bar, 0.01 sequence divergence.
http://ijs.microbiologyresearch.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:07:46
3397
K. C. Freel and others
demonstrate growth on 50 % glucose. Acetate, fructose,
mannose, ribose, sucrose and xylose are assimilated.
Growth on 60 % glucose is delayed but positive. Growth
is apparent but weak at 4 uC and 37 uC, robust at 20, 25
and 30 uC, while no growth is observed at 40 uC.
No starch-like substance is produced and acid production
on chalk agar is negative as are the tests for urease hydrolysis and the diazonium blue B reaction. All four isolates of
the species are identical according to the sequences
obtained for both the ITS and D1/D2 variable region of
the 26S rRNA. The sequence of the D1/D2 and ITS regions
amplified from the type strain LL11_022T are available
under the GenBank accession numbers KP793239 and
KP793243, respectively, and distinguish this species from
the most closely related Lachancea lineage, L. thermotolerans.
T
The type strain, LL11_022 was deposited in the culture
collection of the Centraalbureau voor Schimmelcultures,
Utrecht, the Netherlands, under number CBS 14138T
(5CLIB 1763T5UCDFST 15-106T). It was isolated from
maple tree bark collected in the Canadian province of
Québec in 2011. The name was registered in MycoBank
under the number MB811749.
Friedrich, A., Jung, P., Reisser, C., Fischer, G. & Schacherer, J. (2015).
Population genomics reveals chromosome-scale heterogeneous
evolution in a protoploid yeast. Mol Biol Evol 32, 184–192.
Gonçalves, P., Valério, E., Correia, C., de Almeida, J. M. G. C. F. &
Sampaio, J. P. (2011). Evidence for divergent evolution of growth
temperature preference in sympatric Saccharomyces species. PLoS
One 6, e20739.
González, S. S., Alcoba-Flórez, J. & Laich, F. (2013). Lachancea
lanzarotensis sp. nov., an ascomycetous yeast isolated from grapes
and wine fermentation in Lanzarote, Canary Islands. Int J Syst Evol
Microbiol 63, 358–363.
Jung, P. P., Friedrich, A., Reisser, C., Hou, J. & Schacherer, J. (2012).
Mitochondrial genome evolution in a single protoploid yeast species.
G3 (Bethesda) 2, 1103–1111.
Kurtzman, C. P. (2003). Phylogenetic circumscription of Saccharomyces,
Kluyveromyces and other members of the Saccharomycetaceae, and the
proposal of the new genera Lachancea, Nakaseomyces, Naumovia,
Vanderwaltozyma and Zygotorulaspora. FEMS Yeast Res 4, 233–245.
Lachance, M. A. & Kurtzman, C. P. (2011). Lachancea Kurtzman
(2003). In The Yeasts, a Taxonomic Study, 5th edn., pp. 511–519.
Edited by C. P. Kurtzman, J. W. Fell & T. Boekhout. Amsterdam: Elsevier.
Leducq, J. B., Charron, G., Samani, P., Dubé, A. K., Sylvester, K.,
James, B., Almeida, P., Sampaio, J. P., Hittinger, C. T. & other
authors (2014). Local climatic adaptation in a widespread
microorganism. Proc Biol Sci 281, 20132472.
ACKNOWLEDGEMENTS
Lee, C. F., Yao, C. H., Liu, Y. R., Hsieh, C. W. & Young, S. S. (2009).
This work was supported by an Agence Nationale de la Recherche
(ANR) grant (2010-BLAN-1606-05) and ANR Young Investigator
grant (2011-JSV6-004-01) (J. S.). We gratefully thank Professor
Marc-André Lachance for his valuable advice and for providing light
microscopy images of ascospore formation in L. quebecensis sp. nov.
We also thank the Université de Strasbourg (IdEx 2012 Attractivité)
for their financial support. C. R. L.’s research is supported by a
NSERC Discovery grant. J. B. L. was supported by a FRQS postdoctoral fellowship and G. C. by a PROTEO graduate scholarship.
Lachancea dasiensis sp. nov., an ascosporogenous yeast isolated
from soil and leaves in Taiwan. Int J Syst Evol Microbiol 59,
1818–1822.
Maddison, W. P. & Maddison, D. R. (2015). Mesquite: a modular system
for evolutionary analysis., Version 3.02 http://mesquiteproject.org.
Mestre, M. C., Ulloa, J. R., Rosa, C. A., Lachance, M. A. & Fontenla, S.
(2010). Lachancea nothofagi sp. nov., a yeast associated with
Nothofagus species in Patagonia, Argentina. Int J Syst Evol Microbiol
60, 2247–2250.
Naumova, E. S., Serpova, E. V. & Naumov, G. I. (2005). Speciation in
REFERENCES
the yeast Lachancea thermotolerans: molecular genetic evidence. Dokl
Biol Sci 405, 469–471.
Altschul, SF., Madden, TL., Schaffer, S., Zhang J., Zhang, Z, Miller, W. &
Lipman, DJ (1997). Gapped BLAST and PSI-BLAST: a new generation of
Naumova, E. S., Serpova, E. V. & Naumov, G. I. (2007).
protein database search programs. Nucleic Acids Research 25, 3389–3402.
Charron, G., Leducq, J. B., Bertin, C., Dubé, A. K. & Landry, C. R.
(2014). Exploring the northern limit of the distribution of
Saccharomyces cerevisiae and Saccharomyces paradoxus in North
America. FEMS Yeast Res 14, 281–288.
Edgar, R. C. (2004). muscle: multiple sequence alignment with
improved accuracy and speed. Proceedings of the IEEE Computational Systems Bioinformatics Conference 728-729|xix+756.
Fell, J. W., Statzell-Tallman, A. & Kurtzman, C. P. (2004). Lachancea
Molecular systematics of Lachancea yeasts. Biochemistry (Mosc) 72,
1356–1362.
O’Donnell, K. (1993). The Fungal Holomorph: Mitotic, Meiotic and
Pleomorphic Speciation in Fungal Systematics. Wallingford, UK: CAB
International.
Pereira, L. F., Costa, C. R., Jr, Brasileiro, B. T. & de Morais, M. A., Jr. (2011).
Lachancea mirantina sp. nov., an ascomycetous yeast isolated from the
cachaca fermentation process. Int J Syst Evol Microbiol 61, 989–992.
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new
meyersii sp. nov., an ascosporogenous yeast from mangrove regions
in the Bahama Islands. Stud Mycol 50, 359–363.
method for reconstructing phylogenetic trees. Mol Biol Evol 4,
406–425.
Freel, K. C., Friedrich, A., Hou, J. & Schacherer, J. (2014). Population
Schacherer, J., Shapiro, J. A., Ruderfer, D. M. & Kruglyak, L. (2009).
genomic analysis reveals highly conserved mitochondrial genomes in
the yeast species Lachancea thermotolerans. Genome Biol Evol 6,
2586–2594.
Comprehensive polymorphism survey elucidates population structure
of Saccharomyces cerevisiae. Nature 458, 342–345.
Friedrich, A., Jung, P. P., Hou, J., Neuvéglise, C. & Schacherer, J.
(2012). Comparative mitochondrial genomics within and among
isoenzyme variation in Kluyveromyces populations and revision of
Kluyveromyces marxianus (Hansen) van der Walt. Int J Syst Bacteriol
36, 94–102.
yeast species of the Lachancea genus. PLoS One 7, e47834.
3398
Sidenberg, D. G. & Lachance, M. A. (1986). Electrophoretic
Downloaded from www.microbiologyresearch.org by
International Journal of Systematic and Evolutionary Microbiology 65
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:07:46
Lachancea quebecensis sp. nov.
Sniegowski, P. D., Dombrowski, P. G. & Fingerman, E. (2002).
Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013).
Saccharomyces cerevisiae and Saccharomyces paradoxus coexist in a
natural woodland site in North America and display different levels
of reproductive isolation from European conspecifics. FEMS Yeast
Res 1, 299–306.
MEGA 6:
Souciet, J. L., Dujon, B., Gaillardin, C., Johnston, M., Baret, P. V., Cliften,
P., Sherman, D. J., Weissenbach, J., Westhof, E. & other authors
(2009). Comparative genomics of protoploid Saccharomycetaceae.
Genome Res 19, 1696–1709.
http://ijs.microbiologyresearch.org
molecular evolutionary genetics analysis version 6.0. Mol Biol
Evol 30, 2725–2729.
White, T. J., Bruns, T., Lee, S. & Taylor, J. W. (1990). Amplification and
Direct Sequencing of Fungal Ribosomal RNA genes for Phylogenetics.
New York: Academic Press.
Yarrow, D. (1998). Methods for the isolation, maintenance and
identification of yeasts. In The Yeasts, a Taxonomic Study, 4th edn.
pp. 77–102. Edited by C. P. Kurtzman & J. W. Fell. Amsterdam: Elsevier.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:07:46
3399