54, 424 – 430 (2000)
Copyright © 2000 by the Society of Toxicology
TOXICOLOGICAL SCIENCES
In Utero and Lactational Exposure to 2,3,7,8-Tetrachlorodibenzo-pdioxin Alters Postnatal Development of Seminal Vesicle Epithelium
J. T. Hamm,* ,† ,1 B. R. Sparrow, ‡ D. Wolf,† and L. S. Birnbaum†
*Curriculum in Toxicology, University of North Carolina, Chapel Hill, North Carolina 27599; †National Health and Environmental Effects
Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, North Carolina 27711; and ‡National Research Council,
U.S. Environmental Protection Agency, Research Triangle Park, North Carolina 27711
Received September 13, 1999; accepted December 3, 1999
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) has been shown to
alter male reproductive development of laboratory animals
through in utero and lactational exposure. As a result of exposure,
the accessory glands of the male reproductive tract, including the
seminal vesicle, are decreased in size as determined by total weight
of the tissue. Analysis of seminal vesicle weights over time suggests
that the changes may be transient. Administration of 1.0 ␮g/kg
TCDD during gestation caused a significant decrease in seminal
vesicle weights of offspring 8 –11 months of age. We examined the
effects of TCDD on seminal vesicles from rats exposed in utero
and lactationally. Pregnant Long Evans rats were gavaged on
gestation day 15 with 1.0 ␮g/kg TCDD in corn oil. Male pups were
euthanized and necropsied on postnatal days (PND) 15, 25, 32, 49,
63, and 120. Seminal vesicles were weighed and then fixed in 10%
neutral buffered formalin and processed for microscopic examination. Seminal vesicle weights were not significantly decreased
until PND 32. Androgen receptor mRNA expression in PND 25
seminal vesicles was not different from control. In the present
study, TCDD exposure decreased seminal vesicle epithelial
branching and differentiation. Control epithelial cells had tall
columnar morphology with relatively abundant cytoplasm,
whereas TCDD-treated cells had rounded nuclei and less cytoplasm. In addition, immunolocalization of proliferating nuclear
antigen was confined to undifferentiated basal epithelial cells of
controls but was found in both basal and luminal cells of the
treated seminal vesicle. Results indicate that the TCDD-induced
impaired growth of the rat seminal vesicles is associated with a
dramatic decrease in the development of the epithelium.
Key Words: TCDD; epithelial differentiation; seminal vesicles.
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is the most
toxic member of a class of persistent compounds, the polyhalogenated aromatic hydrocarbons (Safe, 1986). As a result of
The manuscript has been reviewed in accordance with U.S. Environmental
Protection Agency policy and approved for publication. Mention of trade
names or commercial products does not constitute endorsement or recommendation for use.
1
To whom correspondence should be addressed at: U.S. EPA, NHEERL
(MD-74), Research Triangle Park, NC 27711. Fax: (919) 541-5394. E-mail:
[email protected].
combustion and chlorine bleaching processes, TCDD is found
as an environmental contaminant and bioaccumulates through
the food chain, increasing the possibility of toxic effects.
Exposures to laboratory animals and reports of human exposure after industrial accidents have shown that TCDD can
cause a variety of effects including chloracne, a wasting syndrome, induction of xenobiotic-metabolizing enzymes, and
adverse reproductive development (for a review see Birnbaum,
1994a, and Pohjanvirta and Tuomisto, 1994).
Exposure to TCDD during gestation has been shown to
perturb the development of the male sex accessory glands in
the rat (Gray et al., 1995; Mably et al., 1992). Roman et al.
(1998) reported that in utero and lactational exposure to TCDD
altered budding of the fetal prostate as well as postnatal epithelial differentiation and smooth muscle thickness. Observations made on tissue weights demonstrate an apparent alteration in the growth of the seminal vesicles from treated pups as
evidenced by decreased weight of the tissue in PND 32 rats
(Roman et al., 1995). This point of development corresponds
to peak androgen levels within the seminal vesicles (Roman et
al., 1995) and to a period of rapid proliferation and differentiation within the seminal vesicle epithelium (Fawell and Higgins, 1986).
The objectives of the present study were to establish the time
course for TCDD-induced changes in seminal vesicle weights
and to define associated microscopic alterations in the Long
Evans rat. These data will help to elucidate the mechanism of
TCDD-induced effects in the developing seminal vesicle.
MATERIALS AND METHODS
Chemicals. TCDD (⬎ 98% purity) in acetone (1 mg/10 ml) was obtained
from Radian Corp. (Austin, TX). For the preparation of dosing solution, a
volume of stock TCDD was added to corn oil and the acetone removed by
evaporation using a Savant SpeedVac (Savant Instruments Inc., Farmingdale,
NY). Following evaporation, additional corn oil was added to achieve the
desired TCDD concentration. All other chemicals were from commercial
sources and were of the highest purity available.
Animals. Time-pregnant Long Evans rats [gestational day (GD) 9; (day
after mating ⫽ GD 0)] were obtained from Charles River Breeding Laboratories (Raleigh, NC). Females were housed in plastic cages containing heat-
424
425
TCDD ALTERS SEMINAL VESICLE EPITHELIUM
treated pine shavings (Beta Chips, North Eastern Products Inc., Warrensburg,
NY) and given food (Purina 5001 Rodent Chow, Ralston Purina Co., St. Louis,
MO) and water ad libitum.
Dosing. Two groups of 14 pregnant dams were treated by oral gavage on
GD 15 with 1.0 ␮g/kg TCDD in corn oil or corn oil only for controls in a
dosing volume of 5 ml/kg. Litters were culled to five males and three females
on postnatal day (PND) 4. At weaning (PND 25), animals were housed as
above in unisexual groups of two to three rats per cage.
Tissue weight analysis. Male pups (n ⫽ 9 –10, with 1 per litter per time
point), were euthanized and necropsied on PND 15, 25, 32, 49, 63, or 120, and
body and organ weights recorded. For seminal vesicle weights, the paired
organ was clamped at the base and excised, the clamp was subsequently
removed, and the fluid contents expressed into a pre-tared weigh boat. The
weight of the remaining tissue, paired seminal vesicles, and attached coagulating glands, was determined and referred to as seminal vesicle tissue weight.
Following weighing, seminal vesicles were fixed in 10% neutral-buffered
formalin on PND 32.
Histologic analysis. Formalin-fixed seminal vesicles from PND 32 animals were processed by routine methods for paraffin, sectioned at 5 ␮M,
stained with hematoxylin and eosin, and examined microscopically. Additional
sections were stained with trichrome stain to identify collagen. Finally, proliferating cell nuclear antigen (PCNA) was immunolocalized using anti-PCNA
antibodies, and sections were counterstained with hematoxylin and examined
microscopically. PCNA immunostaining was produced according to the manufacturer instructions (Santa Cruz Biotechnology, Santa Cruz, CA).
Competitive RT-PCR for determination of seminal vesicle androgen receptor mRNA expression. Seminal vesicles (n ⫽ 4) were removed from
PND 25 animals, snap frozen, and stored at – 80°C. Individual tissues were
removed from the freezer and homogenized in Trizol reagent (GibcoBRL,
Grand Island, NY). RNA was precipitated from the aqueous fraction and
re-extracted with acid phenol:chloroform. The aqueous layer was removed,
and RNA was precipitated and resuspended in DEPC-treated water. Samples
were quantified and purity was checked using A260/280 ratios.
Construction of internal competitor RNA. Total RNA isolated from adult
Long Evans rat testis was used to generate cDNA as outlined in the random
hexamer protocol from a Life Technologies SuperScript™ Preamplification
System for a First Stand cDNA Synthesis kit. A 412 base-pair fragment of the
androgen receptor message was amplified by PCR from the cDNA with
primers ANDRCP5-1 (GAGAACTACTCCGGACCTTA) and ANDRCPR3-1
(CAATGTGTGATACAGTCATC). These primers were designed from the rat
epididymal androgen receptor sequence submitted to Genbank by Tan et al.
(1988). A 165 base-pair deletion of the PCR product was constructed using
restriction endonuclease and T4 ligation techniques. PCR products were digested with SacI restriction endonuclease followed by electrophoretic separation and purification of the 5⬘ and 3⬘ digestion fragments from a low-melt
agarose gel. The 5⬘ and 3⬘ fragments were ligated with T4 ligase and the
resultant 247 base-pair fragment inserted into a pCR-Script™ Amp SK(⫹)
cloning vector (Stratagene, La Jolla, CA). The recombinant vector, labeled
pCR-AR412⌬165, was used to transform Epicurian Coli™ XL1-Blue’ Kan
supercompetent cells (Stratagene, La Jolla, CA). The transformed cells were
plated on LB-ampicillin-5-bromo-4-chloro-3-indoyl-␤-D-galactopyranoside
(X-gal) and isopropyl-1-thio-␤-D-galactopyranoside (IPTG) agarose plates.
Selected white colonies were screened for recombinant plasmids and midiplasmid preps performed with a Qiagen (Chatsworth, CA) Qiafilter Plasmid
Midi Kit. Recombinant plasmids containing the truncated androgen receptor
sequence were linearized with PVU II restriction endonuclease, thereby enabling transcription of the androgen receptor sequence using an Epicentre
Technologies (Madison, WI) AmpliScribe™ T7 transcription kit. Transcription reactions were extracted twice with acid phenol:chloroform followed by a
single extraction with chloroform, then precipitated with 1/10 volume 8-M
LiCl (Sigma, St. Louis, MO) and 2.5 volumes absolute ethanol. The precipitated RNA was suspended in Ambion (Austin, TX) RNA storage solution;
concentration and purity were estimated spectrophotometrically. A portion of
the internal competitor RNA was diluted in Ambion RNA storage solution to
1 ⫻ 10 9 molecules/2.5 ␮l and stored as single-use aliquots at – 80°C.
RT-PCR. Total RNA (100 ng) from seminal vesicle was combined with
specified amounts of internal standard androgen receptor RNA diluted in
nuclease free water (Promega, Madison, WI) from the 1 ⫻ 10 9 molecules/2.5
␮l single-use aliquots, and subjected to reverse transcription (RT) reactions as
detailed in an Ambion (Austin, TX) RETROscript™ first strand synthesis kit
for RT-PCR. A fraction of the RT reaction (5 ␮l) was PCR amplified in 50-␮l
PCR reaction mixes following protocols by Life Technologies for Platinum
Taq polymerase and using primers ANDRCP5-1 and ANDRCPR3-1. PCR
cycling parameters were as follows: denature 94°C, 4:00; denature 94°C, 0:45;
anneal 57°C, 1:20; extend 72°C, 2:30, for a total of 32 cycles; extend 72°C,
5:00. A fraction of the PCR reaction (5 ␮l) was subjected to electrophoretic
separation in 3% FMC (Rockland, ME) NuSeive威 3:1 agarose gels containing
FMC (Rockland, ME) Gel Star威 nucleic acid stain. Electrophoresed PCR
products were visualized over UV light; band intensity was quantified densitometrically using an Alpha Inotech (San Leandro, CA) CCD video camera
and image analysis software. The log ratio of androgen receptor RNA internal
competitor to sample androgen receptor mRNA versus the log of androgen
receptor RNA internal competitor were plotted to determine amplification
efficiencies and estimate molecules of experimental androgen receptor mRNA
per 100 ng total RNA.
Statistics. Using StatView 4.5 (Abacus Concepts, Inc., Berkeley, CA),
data was evaluated for statistical significance using one-way analyses of
variance (ANOVA) followed by Fisher’s PLSD test as a post hoc test. A p ⬍
0.05 defined statistically significant differences.
RESULTS
Organ Weights
Seminal vesicles from control rats showed little weight
change from PND 15 to PND 25. However, the gland began to
grow more rapidly between PND 25 and PND 32 (Table 1).
Similarly, no difference between control and treated seminal
vesicle weights was recorded for PND 15 or PND 25. However, by PND 32, control seminal vesicles were significantly
larger (Fig. 1). By PND 49, the gland had undergone extensive
growth and it was possible to begin collecting fluid secretions.
Control glands produced significantly more fluid; however, at
later time points, TCDD exposure did not affect fluid production. In contrast, the weight of the seminal vesicles measured
without fluid content remained significantly decreased at PND
120.
Seminal Vesicle Histology
Because PND 32 was the earliest point at which seminal
vesicles from treated pups had a significantly decreased
weight, these tissues were examined for microscopic alterations. Histologic examination of control rat seminal vesicles
revealed extensive branching of the epithelium of the gland. In
comparison, the seminal vesicle from TCDD-treated rats had
substantially less epithelium with little branching (Fig. 2).
Although it was not possible to collect fluid secretions at PND
32, protein is visible in the lumen of the seminal vesicle (Fig.
2). At higher magnification, the seminal vesicle from control
rats is characterized by tall columnar epithelial cells flattened
along their lumenal surface. In addition, seminal vesicle epi-
426
HAMM ET AL.
TABLE 1
Effect of in Utero and Lactational TCDD Exposure on Body
Weight and Seminal Vesicle Weight of Male Rat Offspring 15 to
120 Days of Age
PND
Control
15
25
32
49
63
120
TCDD treated
15
25
32
49
63
120
Body (g)
Seminal vesicle Seminal vesicle
tissue (mg)
fluid (mg)
Total SV
(mg)
31 ⫾ 1
75 ⫾ 2
123 ⫾ 3
279 ⫾ 6
346 ⫾ 7
678 ⫾ 17
NA
NA
NA
324 ⫾ 18
531 ⫾ 22
992 ⫾ 60
NA
NA
NA
142 ⫾ 13
345 ⫾ 17
651 ⫾ 35
10 ⫾ 1
16 ⫾ 1
60 ⫾ 3
465 ⫾ 27
875 ⫾ 34
1642 ⫾ 79
31 ⫾ 1
69 ⫾ 3
117 ⫾ 3
257 ⫾ 11 a
316 ⫾ 7 a
563 ⫾ 14 a
NA
NA
NA
224 ⫾ 24 b,c
399 ⫾ 13 b,c
744 ⫾ 35 b,c
NA
NA
NA
81 ⫾ 19 b,c
313 ⫾ 18
564 ⫾ 37
10 ⫾ 1
17 ⫾ 1
37 ⫾ 3 b,c
304 ⫾ 28 b,c
712 ⫾ 21 b,c
1309 ⫾ 63 b
Note. Values are means ⫾ SE (n ⫽ 9 –10 males per time point, with 1 male
per litter). NA, not applicable. Seminal vesicle tissue represents the weight of
the paired seminal vesicles and the attached coagulating glands following
expression of the fluid contents. Total SV represents the combined weight of
the seminal vesicles and their fluid contents.
a
Significant difference in the body weight of exposed offspring.
b
Significant difference (p ⬍ 0.05) from control in the tissue weight.
c
Significant difference (p ⬍ 0.05) from control in the tissue weight to body
weight ratio.
thelial cells from control rats contain abundant cytoplasmic
material. The seminal vesicle epithelium from TCDD-exposed
pups is composed of short columnar cells containing relatively
limited cytoplasm (Fig. 3).
Proliferating cells were identified by proliferating cell nuclear antigen (PCNA) immunoreactivity. Most PCNA reactivity in seminal vesicles from control rats was found in the
undifferentiated epithelial cells at the basal portions of the
glands, with little staining of the differentiated tall columnar
luminal epithelial cells (Fig. 4). In contrast, the undifferentiated epithelial cells bordering the lumen from TCDD-exposed
rats are actively undergoing proliferation. A subepithelial layer
of collagen was markedly increased in thickness in seminal
vesicles from TCDD-streated rats (Fig. 5).
Androgen Receptor mRNA Expression
Measurement of seminal vesicle weights demonstrated decreased growth of TCDD-exposed tissue between PND 25 and
FIG. 1. Whole-mount image of control (left) and TCDD-exposed seminal
vesicles at PND32. Note the decreased size of the exposed tissue.
PND 32. From previous reports, levels of androgen were
shown to rapidly increase within the seminal vesicles during
this same time period (Roman et al., 1995). Therefore, PND 25
seminal vesicles were isolated to look for differences in androgen receptor mRNA expression that might account for the
decreased growth by PND 32. However, androgen receptor
mRNA expression was not different between treated and control rats at PND 25. Quantification of expression revealed
1.2 ⫻ 10 6 molecules of androgen receptor mRNA per 100 ␮g
total RNA (Figs. 6A and 6B).
DISCUSSION
Analysis of seminal vesicle weights demonstrated that beginning between PND 25 and PND 32, TCDD exposure decreased seminal vesicle growth in Long Evans rats. The time
course for the observed changes in weight was similar to that
reported in the Holtzman rat (Roman et al., 1995). In addition,
there was a TCDD-induced decrease in fluid production that
may also have contributed to the decreased organ weight. The
seminal vesicle epithelium of control animals exhibited extensive branching by PND 32. In contrast, the epithelium from
treated animals had fewer and shortened epithelial branches. At
higher magnification, control epithelium was characterized by
tightly packed tall columnar cells, whereas treated seminal
vesicles showed a lower degree of evagination and the epithelium had predominately smaller cells with a lower cytoplasm to
nuclear relative volume.
FIGS. 2, 3, 4, and 5. Seminal vesicles from control (A) and TCDD-exposed (B) rats. In Figure 2, first row, control rats have extensive branching of the
seminal vesicle gland. The epithelium from the exposed pup has markedly less branching. In Figure 3, second row, lumenal epithelial cells in the control tissue
are columnar, with abundant cytoplasm along the lumenal surface. In contrast, the epithelium from TCDD-exposed offspring consists of rounded nuclei with
limited cytoplasm along the lumenal surface. The lumen (L) is denoted in Figure 3A. Figure 4 (third row) demonstrates immunoreactivity to PCNA. Control rats
have actively proliferating epithelium along the basal portions of the gland (arrows) and less immunoreactivity closer to the lumen (arrowheads). In contrast, the
lumenal and basal epithelial cells from TCDD-exposed rats are actively undergoing proliferation; PCNA immunostaining, hematoxylin, bar ⫽ 75 ␮M. In Figure
5, fourth row, there is markedly increased subepithelial collagen in the TCDD-treated animals (arrows); trichrome, bar ⫽ 75 ␮M.
TCDD ALTERS SEMINAL VESICLE EPITHELIUM
427
428
HAMM ET AL.
The postnatal period examined in our study corresponds to a
period of rapid proliferation and differentiation within the rat
seminal vesicle epithelium (Fawell and Higgins, 1986). The
presence of numerous cells in the seminal vesicles from control
rats with substantial immunoreactivity for proliferating cell
nuclear antigen (PCNA) confirmed this. Localization of PCNA
immunoreactivity in seminal vesicles from control animals was
primarily in undifferentiated basal cells but not in the terminally differentiated luminal epithelium. In contrast, in the undifferentiated TCDD-exposed seminal vesicles, PCNA immunoreactivity was at both the basal and luminal surfaces of
poorly branched glands, indicative of the delayed development
of the TCDD-treated organ. The present study is consistent
with the altered epithelial proliferation following in utero and
lactational exposure to TCDD reported for other organs. Roman et al. (1998) demonstrated that TCDD alters prostatic
epithelial budding. Similarly, Furth et al. (1999) reported
TCDD-induced decreases in the epithelial branching of the
mammary glands of female rat pups. TCDD has also been
reported to alter epithelial development of mouse ureters (Abbott et al., 1987) and palate, both in vivo (Abbott and Birnbaum, 1989) and in vitro (Abbott et al., 1989; Abbott and
Birnbaum, 1991).
In the present study, TCDD also caused increased subepithelial collagen. This observation was analogous to what was
reported by Chang et al. (1999) in the rat prostate after estradiol exposure during the early postnatal period altered the
expression of laminin and collagen IV protein in the basement
membrane and caused a thickened layer of fibroblasts. These
authors hypothesized that this layer of cells caused the lack of
responsiveness of the prostate epithelium to androgens during
early adulthood (Chang et al., 1999). In the seminal vesicles
from TCDD-treated rats, it is unclear whether the increase in
collagen is due to altered expression or simply a lack of
distribution of the collagen due to the inhibition of epithelial
branching. However, TCDD has been reported to decrease the
expression of laminin and fibronectin proteins in fetal mouse
kidney following gestational exposure (Abbott et al., 1987). It
may be that TCDD-induced changes in extracellular matrix
inhibited epithelial development in the seminal vesicles.
Branching of the seminal vesicles, as well as the maintenance of the organ, are dependent upon androgens (Higgins et
al., 1976; Tsuji et al., 1991), and TCDD-induced changes in
androgen status could alter reproductive development. However, although Roman et al. (1995) demonstrated that androgen
levels peak in seminal vesicles at PND 32, in utero and
lactational exposure to 1.0 ␮g/kg TCDD did not alter androgen
mRNA levels. In addition, others have shown that this exposure regime does not alter serum levels of testosterone during
this period of development (Gray et al., 1997; Roman et al.,
1995). Furthermore, Gray et al. (1995) reported that TCDD did
not alter androgen receptor levels in the epididymis of offspring 8 –11 months of age. In our study we found that andro-
gen receptor mRNA was not changed by TCDD treatment in
PND 25 seminal vesicles (Fig. 6B). The lack of effect on either
circulating androgen levels or receptor expression is in agreement with the observation that androgen receptor expression is
highly regulated by circulating levels of androgens (Bentvelsen
et al., 1995). These findings demonstrate that the decreased
growth in TCDD-treated tissue does not result from decreased
androgens or receptor content.
Growth factors have been shown to be important modulators
of the androgen-dependent development of the seminal vesicles (Alarid et al., 1994; Tanji et al., 1994). In addition, growth
factors and their signaling pathways have been shown to affect
transcriptional activity of the androgen receptor (Culig et al.,
1995; Reinikainen et al., 1996), estrogen receptor (Ignar-Trowbridge, 1995), and glucocorticoid receptor (Krstic, 1997). Numerous studies have shown that TCDD is capable of altering
the expression of numerous growth factors in a variety of
tissues (for a review see Birnbaum, 1995). Given the importance of growth factors in the development of the seminal
vesicles and the ability of TCDD to alter the expression of
multiple growth factors in a variety of systems, it is plausible
that TCDD-induced changes in growth factor expression disrupt seminal vesicle development.
TCDD-induced changes are mediated through the AhR
(Birnbaum, 1994b). Hushka et al. (1998) reported that the AhR
agonist 2,3,7,8-tetrachlorodibenzofuran decreases mammary
gland proliferation in vitro and analysis of AhR ⫺/⫺ mice also
reveals decreased mammary gland development. In a similar
fashion to the seminal vesicles, the mammary gland appears to
exhibit altered epithelial development following in utero and
lactational TCDD exposure (unpublished results from this laboratory; Furth et al., 1999)
TCDD is known to alter the expression of AhR in male
reproductive tract tissues (Sommer et al., 1999). Bryant et al.
(1997) reported that gestational exposure to TCDD decreased
the expression of ARNT in the mouse kidney tubule. In addition to possible changes in the level of expression, exposure
leads to the formation of AhR-ARNT complexes and should
alter the endogenous protein–protein interactions of ARNT.
CBP/p300, a transcriptional coregulator, has been shown to be
a coactivator of ARNT (Kobayashi et al., 1997) and the androgen receptor (Fronsdal et al., 1998). Transcriptional coregulators modify levels of transcription between diverse pathways,
and the interplay between pathways is crucial in development
(Mannervik et al., 1999). Furthermore, Jana et al. (1999)
demonstrated reciprocal inhibition of transcriptional pathways
between TCDD and testosterone in prostate cancer cells.
In conclusion, in utero and lactational exposure to 1.0 ␮g/kg
TCDD inhibits the proliferation and differentiation of the seminal
vesicle epithelium. However, Mably et al. (1992) reported that
with added development, effects on the seminal vesicle weight
decreased. We see a similar trend, although the weight of the
seminal vesicle tissue remains significantly lower at PND 120. It
429
TCDD ALTERS SEMINAL VESICLE EPITHELIUM
FIG. 6. (A) Expression of androgen receptor mRNA in PND32 seminal vesicles. The upper band is amplified seminal vesicle mRNA,
whereas the lower band is the competitor. Lane 1 ⫽ 156,250 molecules
of internal competitor. Lane 2 ⫽
312,500 molecules of internal competitor. Lane 3 ⫽ 1,250,000 molecules of internal competitor. Lane
4 ⫽ 2,500,000 molecules of internal
competitor. Lane 5 ⫽ 5,000,000 molecules of internal competitor. RNA
was amplified by reverse transcription PCR using primers and conditions detailed in the Materials and
Methods section. (B) Mean level
(n ⫽ 4 ⫾ SD) of AR mRNA expression in PND32 seminal vesicles. No
significant difference was observed
between control and treated tissue.
was not determined in the present study if the histologic changes
reflect a delay in development or a permanent alteration. Therefore, future efforts will examine the seminal vesicle epithelium
throughout development and maturation to see if the epithelial
changes persist and to identify alterations that may precede the
decreases in seminal vesicle weight. These observations should
help in interpreting the mechanism of TCDD-induced alterations
within the epithelium.
ACKNOWLEDGMENTS
The authors thank Vicki Richardson, David Ross, and Dr. Brian Slezak for
their help with necropsies. We would also like to thank Keith Tarpley for his
help in creating the figures. Financial support for this work was provided by the
U.S. Environmental Protection Agency Cooperative Training Agreement
(# CT902908) with the University of North Carolina, Chapel Hill, NC 27599 –
7270. Additional funding was supplied by the National Research Council
(# CR824072).
REFERENCES
Abbott, B. D., and Birnbaum, L. S. (1989). TCDD alters medial epithelial cell
differentiation during palatogenesis. Toxicol. Appl. Pharmacol. 99, 276 –
286.
Abbott, B. D., and Birnbaum, L. S. (1991). TCDD exposure of human
embryonic palatal shelves in organ culture alters the differentiation of
medial epithelial cells. Teratology 43, 119 –132.
Abbott, B. D., Birnbaum, L. S., and Pratt, R. M. (1987). TCDD-induced
hyperplasia of the ureteral epithelium produces hydronephrosis in murine
fetuses. Teratology 35, 329 –334.
Abbott, B. D., Diliberto, J. J., and Birnbaum, L. S. (1989). 2,3,7,8-Tetrachlorodibenzo-p-dioxin alters embryonic palatal medial epithelial cell differentiation in vitro. Toxicol. Appl. Pharmacol. 100, 119 –131.
Alarid, E. T., Rubin, J. S., Young, P., Chedid, M., Ron, D., Aaronson, S. A.,
and Cunha, G. R. (1994). Keratinocyte growth factor functions in epithelial
induction during seminal vesicle development. Proc. Natl. Acad. Sci. U S A
91, 1074 –1078.
430
HAMM ET AL.
Bentvelsen, F. M., Brinkmann, A. O., van der Schoot, P., van der Linden, J. E.,
van der Kwast, T. H., Boersma, W. J., Schroder, F. H., and Nijman, J. M.
(1995). Developmental pattern and regulation by androgens of androgen
receptor expression in the urogenital tract of the rat. Mol. Cell. Endocrinol.
113, 245–253.
Birnbaum, L. S. (1994a). Endocrine effects of prenatal exposure to PCBs,
dioxins, and other xenobiotics: implications for policy and future research.
Environ. Health Perspect. 102, 676 – 679.
Birnbaum, L. S. (1994b). The mechanism of dioxin toxicity: relationship to
risk assessment. Environ. Health Perspect. 102(suppl. 9), 157–167.
Birnbaum, L. S. (1995). Developmental effects of dioxins and related endocrine disrupting chemicals. Toxicol. Lett. 103(suppl 7), 743–750.
Bryant, P. L., Clark, G. C., Probst, M. R., and Abbott, B. D. (1997). Effects of
TCDD on Ah receptor, ARNT, EGF, and TGF-␣ expression in embryonic
mouse urinary tract. Teratology 55, 326 –337.
Chang, W. Y., Wilson, M. J., Birch, L., and Prins, G. S. (1999). Neonatal
estrogen stimulates proliferation of periductal fibroblasts and alters the
extracellular matrix composition in the rat prostate. Endocrinology 140,
405– 415.
Culig, Z., Hobisch, A., Cronauer, M. V., Radmayr, C., Trapman, J., Hittmair,
A., Bartsch, G., and Klocker, H. (1995). Androgen receptor activation in
prostatic tumor cell lines by insulin-like growth factor-I, keratinocyte
growth factor and epidermal growth factor. Eur. Urol. 27(suppl. 2), 45– 47.
Fawell, S. E., and Higgins, S. J. (1986). Tissue distribution, developmental
profile and hormonal regulation of androgen-responsive secretory proteins
of rat seminal vesicles studied by immunocytochemistry. Mol. Cell. Endocrinol. 48, 39 – 49.
Fronsdal, K., Engedal, N., Slagsvold, T., and Saatcioglu, F. (1998). CREB
binding protein is a coactivator for the androgen receptor and mediates
cross-talk with AP-1. J. Biol. Chem. 273, 31853–31859.
Furth, P. A., Lewis, B., Lewis, A., Sommer, R., Peterson, R. E., and Flaws, J.
(1999). In utero and lactational TCDD exposure alters estrogen induced
mammary gland growth in the rat. Toxicologist 48, 215.
Gray, L. E., Jr., Kelce, W. R., Monosson, E., Ostby, J. S., and Birnbaum, L. S.
(1995). Exposure to TCDD during development permanently alters reproductive function in male Long Evans rats and hamsters: reduced ejaculated
and epididymal sperm numbers and sex accessory gland weights in offspring
with normal androgenic status. Toxicol. Appl. Pharmacol. 131, 108 –118.
Gray, L. E., Ostby, J. S., and Kelce, W. R. (1997). A dose-response analysis
of the reproductive effects of a single gestational dose of 2,3,7,8-tetrachlorodibenzo-p-dioxin in male Long Evans hooded rat offspring. Toxicol. Appl.
Pharmacol. 146, 11–20.
Higgins, S. J., Burchell, J. M., and Mainwaring, W. I. P. (1976). Testosterone
control of nucleic acid content and proliferation of epithelium and stroma in
rat seminal vesicles. Biochem J. 160, 43– 48.
Hushka, L. J., Williams, J. S., and Greenlee, W. F. (1998). Characterization of
2,3,7,8-tetrachlorodibenzofuran-dependent suppression and Ah receptor
pathway gene expression in the developing mouse mammary gland. Toxicol.
Appl. Pharmacol. 152, 200 –210.
Ignar-Trowbridge, D. M., Pimentel M., Teng C. T., Korach K. S., and
McLachlan, J. A. (1995). Cross talk between peptide growth factor and
estrogen receptor signaling systems. Environ. Health Perspect. 103(suppl
7), 35–38.
Jana, N. R., Sarkar, S., Ishizuka, M., Yonemoto, J., Tohyama, C., and Sone, H.
(1999). Cross-talk between 2,3,7,8-tetrachlorodibenzo-p-dioxin and testosterone signal transduction pathways in LNCaP prostate cancer cells. Biochem. Biophys. Res. Commun. 256, 462– 468.
Kobayashi, A., Numayama-Tsuruta, K., Sogawa, K., and Fujii-Kuriyama, Y.
(1997). CBP/p300 functions as a possible transcriptional coactivator of Ah
receptor nuclear translocator (Arnt). J. Biochem. (Tokyo) 122, 703–710.
Krstic, M. D., Rogatsky, I., Yamamoto, K. R., and Garabedian, M. J. (1997).
Mitogen-activated and cyclin-dependent protein kinases selectively and
differentially modulate transcriptional enhancement by the glucocorticoid
receptor. Mol. Cell. Biol. 17, 3947–3954.
Mably, T. A., Moore, R. W., and Peterson, R. E. (1992). In utero and
lactational exposure of male rats to 2,3,7,8-tetrachlorodibenzo-p-dioxin. 1.
Effects on androgenic status. Toxicol. Appl. Pharmacol. 114, 97–107.
Mannervik, M., Nibu, Y., Zhang, H., and Levine, M. (1999). Transcriptional
coregulators in development. Science 284, 606 – 609.
Pohjanvirta, R., and Tuomisto, J. (1994). Short-term toxicity of 2,3,7,8tetrachlorodibenzo-p-dioxin in laboratory animals: effects, mechanisms, and
animal models. Pharmacol. Rev. 46, 483–549.
Reinikainen, P., Palvimo, J. J., and Janne, O. A. (1996). Effects of mitogens on
androgen receptor-mediated transactivation. Endocrinology 137, 4351– 4357.
Roman, B. L., Sommer, R. J., Shinomiya, K., and Peterson, R. E. (1995). In
utero and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzop-dioxin: impaired prostate growth and development without inhibited androgen production. Toxicol. Appl. Pharmacol. 134, 241–250.
Roman, B. L., Timms, B. G., Prins, G. S., and Peterson, R. E. (1998). In utero
and lactational exposure of the male rat to 2,3,7,8-tetrachlorodibenzo-pdioxin impairs prostate development. 2. Effects on growth and cytodifferentiation. Toxicol. Appl. Pharmacol. 150, 254 –270.
Safe, S. H. (1986). Comparative toxicology and mechanism of action of
polychlorinated dibenzo-p-dioxins and dibenzofurans. Annu. Rev. Pharmacol. Toxicol. 26, 371–399.
Sommer, R. J., Sojka, K. M., Pollenz, R. S., Cooke, P. S., and Peterson, R. E.
(1999). Ah receptor and ARNT protein and mRNA concentrations in rat
prostate: effects of stage of development and 2,3,7,8-tetrachlorodibenzo-pdioxin treatment. Toxicol. Appl. Pharmacol. 155, 177–189.
Tan, J., Joseph, D. R., Quarmby, V. E., Lubahn, D. B., Sar, M., French, F. S.,
and Wilson, E. M. (1988). The rat androgen receptor: primary structure,
autoregulation of its messenger ribonucleic acid, and immunocytochemical
localization of the receptor protein. Mol. Endocrinol. 2, 1276 –1285.
Tanji, N., Tsuji, M., Terada, N., Takeuchi, M., and Cunha, G. R. (1994).
Inhibitory effects of transforming growth factor-beta 1 on androgen-induced
development of neonatal mouse seminal vesicles in vitro. Endocrinology
134, 1155–1162.
Tsuji, M., Shima, H. and Cunha, G. R. (1991). Morphogenetic and proliferative
effects of testosterone and insulin on the neonatal mouse seminal vesicle in
vitro. Endocrinology 129, 2289 –2297.