Leukemia (1999) 13, 699–703
 1999 Stockton Press All rights reserved 0887-6924/99 $12.00
http://www.stockton-press.co.uk/leu
Expression of inducible nitric oxide synthase (NOS) in bone marrow cells of
myelodysplastic syndromes
M Kitagawa1, M Takahashi2, S Yamaguchi2, M Inoue1, S Ogawa2, K Hirokawa1 and R Kamiyama2
1
Department of Pathology and Immunology, and 2Division of Morphological Technology, Allied Health Sciences, Faculty of Medicine,
Tokyo Medical and Dental University, Tokyo, Japan
Nitric oxide (NO) is a biological mediator which is synthesized
from L-arginine by a family of nitric oxide synthases (NOS). We
have studied the expression of the inducible NOS (iNOS) by
bone marrow cells from the patients with myelodysplastic syndromes (MDS) at the mRNA level by RT-PCR assay and at the
protein level by immunohistochemical staining using a specific
anti-iNOS monoclonal antibody. The iNOS message was
present in 92% of bone marrow tissues from MDS patients (11
out of 12) by an examination using RT-PCR. Basically, iNOS
message was negative or very weak in control (1/9) and AML
(0/7) cases. This was supported by immunohistochemical findings that the iNOS was positive in most of the bone marrow
samples from MDS patients (9 out of 12), while bone marrow
cells of control (0 out of 12) and AML (0 out of 5) cases were
basically negative. Double immunostaining for CD68 antigen,
which is a marker for macrophage lineage cells, and iNOS was
performed on MDS bone marrow sections. iNOS was dominantly localized to bone marrow macrophages, although a part
of myeloid cells were also positively stained with anti-iNOS
antibody in a part of cases. These results indicated that there
is some in vivo induction of iNOS expression for local NO production that might be involved in the dysregulation of hematopoiesis in bone marrow of MDS.
Keywords: myelodysplastic syndromes; iNOS; bone marrow
regulated in the bone marrow cells from patients with MDS.16
In MDS bone marrow, TNF-␣, as well as IFN-␥, was mainly
localized to the stromal cells, such as bone marrow macrophages. Therefore not only the proliferation of MDS clone
cells but also the abnormal function of stromal cells of the
bone marrow may be involved in mechanisms causing cytopenias in MDS through disturbed regulation of the expression
and production of growth factors and cytokines.
Induction of nitric oxide synthase (NOS) and production of
the toxic metabolite nitric oxide (NO) is one of the TNF-␣ and
IFN-␥ regulated effector mechanisms that can lead to
apoptosis of hematopoietic progenitor cells.17 Fas-receptor
(FAS) expression can be stimulated by TNF-␣ and IFN-␥. It has
been shown that transactivation of inducible NOS (iNOS), and
possibly Fas promotors, by interferon regulatory factor-1
expressed in response to IFN-␥ may be a part of the iNOS
transduction pathway. This study therefore attempted to investigate the disturbed regulatory mechanisms of hematopoiesis
in MDS in vivo by defining up-regulation of iNOS production
using RT-PCR and then to immunohistochemically demonstrate the localization of the iNOS producing cells in the
bone marrow.
Introduction
Myelodysplastic syndromes (MDS) are a heterogeneous group
of hematological malignancies affecting mainly the middle
aged and elderly.1–4 The majority of affected patients die
within 1–2 years due to overt leukemic transformation or the
complication of cytopenias. The development of cytopenias
despite the presence of cellular marrow is thought to be due
to ineffective hematopoiesis probably associated with frequent
apoptosis of hematopoietic cells.5,6 The Fas antigen, as well
as Fas-ligand, was over-expressed by bone marrow cells of
MDS patients.6 The expression of Fas antigen by hematopoietic cells would result in the induction of apoptosis of these
cells. In vitro examination revealed that the proliferation, as
well as death, of hematopoietic cells is regulated by various
proteins with stimulatory and inhibitory activities.1 Colony-stimulating factors (CSFs)7–10 and several cytokines8–12 are
known to have proliferative effects on hematopoietic progenitor cells, while several substances such as tumor necrosis factor (TNF)8,9,13–15 and interferons (IFNs)14 were demonstrated
to inhibit hematopoietic cell growth. Although the exact function of these substances in vivo has not yet been elucidated,
overexpression of certain soluble factors by bone marrow cells
may disrupt hematopoiesis by exerting profound inhibitory
effects on hematopoietic progenitor cells. We have previously
demonstrated that the expression of TNF-␣ and IFN-␥ was upCorrespondence: M Kitagawa, Department of Pathology and Immunology, Faculty of Medicine, Tokyo Medical and Dental University,
1-5-45 Yushima, Bunkyo-ku, Tokyo 113, Japan; Fax: 81 3 5803 0123
Received 22 September 1998; accepted 25 January 1999
Materials and methods
Patients
Bone marrow samples of trephin biopsy and partly autopsy
material were taken from 14 patients with MDS; three with
refractory anemia (RA), one with RA with ring sideroblasts
(RARS), four with RA with excess of blasts (RAEB), four with
RAEB in transformation (RAEB-T) and two with chronic myelomonocytic leukemia (CMMoL). The samples were embedded
in OCT compound (purchased from Sakura, Tokyo, Japan),
frozen using liquid nitrogen, cryosectioned and investigated
for the expression of iNOS. A diagnosis of MDS was based
on FAB criteria.1 None of the patients had received specific
therapeutic agents prior to the study. The range of age in MDS
patients was 44–83 (60.8 ± 11.6, mean ± s.d.) and male:female ratio was 10:4. Bone marrow samples from 15 individuals
with no hematological disorders were used as controls (age
range 21–84, mean ± s.d., 62.1 ± 17.1; male:female, 10:5) and
additionally, seven patients with de novo AML (M2 or M4 by
FAB classification, age range 56–76, mean ± s.d., 66.6 ± 7.3;
male:female, 6:1) were also analyzed.
Preparation of RNA samples and amplification
method
RNA was isolated from frozen bone marrow samples by a
guanidium isothiocyanate solubilization/LiCl precipitation
procedure. Tissue RNA (100 ng) was used as a template for
iNOS in MDS bone marrow
M Kitagawa et al
700
the amplification reactions. Oligonucleotides as specific primers and probes for iNOS were synthesized by a commercial
laboratory (Life Technologies Oriental, Tokyo, Japan). As a
control reaction of PCR, ␤-actin was also detected in each
run. The sequences of primers were as follows: iNOS: 5⬘ PCR
primer CGGTGCTGTATTTCCTTACGAGGCGAAGAAGG, 3⬘
PCR primer GGTGCTACTTGTTAGGAGGTCAAGTAAAGGGC; ␤-actin: 5⬘ PCR primer AAGAGAGGCATCCTCACCCT,
3⬘ PCR primer TACATGGCTGGGGTGTTGAA. The expected
sizes of the PCR products were 257 bp for iNOS and 218 bp
for ␤-actin. Complementary (c) DNA was synthesized by using
Rous-associated virus reverse transcriptase (Takara Biomedicals, Kyoto, Japan). The PCR reaction was performed as
described elsewhere.18–20 Briefly, 100 ng of the RNA was used
for RT-PCR. For cDNA synthesis, 100 ng in 4 ␮l of sample
RNA solution was heated at 65°C for 5 min and cooled rapidly. After adding 20 U of ribonuclease inhibitor (Takara), 1 ␮l
of 1.25 mm dNTP (dATP, dCTP, dGTP, dTTP, Pharmacia,
Uppsala, Sweden) and 20 U of Rous-associated virus reverse
transcriptase (Takara), the mixture was incubated at 40°C for
30 min, then heated at 94°C for 5 min and cooled rapidly.
The PCR reaction mixture contained 10 ␮l of cDNA, 10 ␮l of
10 × PCR buffer, 11 ␮l of 20 mm MgCl2, 16 ␮l of 1.25 m
dNTP, 42.5 ␮l of DEPC-water, 100 pm 5⬘- and 3⬘-primer, and
2.5 U of thermostable Taq polymerase (Perkin Elmer Cetus,
Norwalk, CT, USA). The amplification was achieved with a
DNA thermal cycler (Perkin Elmer Cetus). After denaturing at
94°C for 10 min, the amplification was conducted for 35
cycles at 94°C for 30 s, 55°C for 30 s and 72°C for 60 s. This
was followed by re-extension for 10 min at 72°C. Ten-␮l aliquots of the product samples were analyzed by electrophoresis on a 1.8% agarose gel and visualized by UV fluorescence after staining with ethidium bromide. ␸X174/HaeIIIcut DNA was run in parallel as a molecular weight marker.
Then the density of bands was measured by scanning imager,
Image Quant (Molecular Dynamics, Sunnyvale, CA, USA).
Results
Immunohistochemistry
Cases
To examine the distribution of iNOS-producing cells in the
bone marrow, polyclonal rabbit antibodies against iNOS
(Santa Cruz Biotechnology, Santa Cruz, CA, USA) were
applied on frozen sections. Sections were then incubated with
fluorescein isothiocyanate (FITC)-conjugated anti-rabbit IgG
antibody (DAKO, Glostrup, Denmark). On the same sections,
the distribution of bone marrow macrophages was determined
by double immunostaining with anti-CD68 antibody (KP-1,
DAKO). This was followed by incubation with tetramethyl
rhodamine isothiocyanate (TRITC)-conjugated anti-mouse IgG
(DAKO). Control procedures included the substitution of equivalent concentrations of heavy chain-matched monoclonal
antibody of irrelevant specificity and the staining of bone marrow sections from control as well as AML and CML cases.
Expression of mRNA for iNOS in the bone marrow
So as to examine very low levels of iNOS mRNA expression
in bone marrow cells, RT-PCR was performed using RNA from
frozen bone marrow tissues. This method revealed the
expression of iNOS mRNA, as defined by a 257 bp PCR product, in the bone marrow from patients with MDS. Control
cases as well as AML and CML cases showed no expression
or very weak expression of iNOS (Figure 1). The frequency
of up-regulation of iNOS mRNA in bone marrow samples is
summarized in Table 1. Most of the MDS cases expressed
iNOS mRNA (11/12, 92%), while the majority of control (8/9)
and all of the AML (7/7) samples did not show signal. Only
one control case showed a very weak band indicating a low
level of iNOS expression. Differences in the frequency of
iNOS expression were statistically significant between MDS
and control cases (Fisher’s exact test, P ⬍ 0.001). However,
because very weak bands were observed in part of the control
cases, we measured the density of bands for iNOS as well as
␤-actin and calculated the ratio of the density iNOS/␤-actin.
In control cases, the ratio was 0.09 ± 0.03 (mean ± s.e.m.),
while the ratio was 10.3 ± 7.4 in MDS cases. Difference was
significant by Student’s t-test (P ⬍ 0.01).
Localization of iNOS in the bone marrow of MDS
patients
As the mRNA of iNOS was overexpressed in the bone marrow
of MDS patients, distribution of iNOS producing cells was
examined by immunohistochemical method. As shown in Fig-
Table 1
IMH)
Expression of iNOS in the bone marrow (RT-PCR and
No. of positive/total cases
RT-PCR
IMH
MDS
RA
RARS
RAEB
RAEB-T
CMMoL
11/12
3/3
ND
3/3
3/4
2/2
9/12
2/3
1/1
2/3
3/4
1/1
Control
AML
1a/9
0/7
0/12
0/5
IMH, immunohistochemistry; ND, not determined because the sample was too small to get mRNA for RT-PCR.
a
Very weak band was observed in the bone marrow samples from
one control case.
Figure 1
Detection of mRNAs for iNOS and ␤-actin by RT-PCR. Positive bands for iNOS (257 bp) were observed in MDS cases (lanes 1–
5) in contrast to negative signals in control cases (lanes 6–11). An RT-PCR reaction for ␤-actin (218 bp) was performed as an internal control,
and positive signals were observed in all the samples examined.
iNOS in MDS bone marrow
M Kitagawa et al
ure 2a, iNOS in MDS bone marrow was localized in scattered
cells with irregular shaped cytoplasm. The frequency of
expression of iNOS in bone marrow samples is summarized
in Table 1. As expected from the result of RT-PCR, iNOS was
expressed only in MDS cases (9/12) and not in control (0/12)
as well as AML (0/5) cases. From their shape, iNOS-positive
cells in MDS bone marrow resembled bone marrow stromal
cells and not hematopoietic cells. Thus, double immunostaining for iNOS and CD68 antigen, a marker for macrophagelineage cells, was performed on the frozen bone marrow sections. The staining clarified that the iNOS producing cells
were basically CD68-positive suggesting that these cells were
mainly of bone marrow macrophage lineage (Figure 2b and c).
The majority of iNOS strongly positive cells were also CD68positive as indicated by yellow arrowheads in Figure 2c. However, not all of the CD68-positive cells were positive with antiiNOS immunostaining. The CD68 single positive cells were
indicated by red arrowheads in Figure 2c. In some cases,
iNOS was also positively stained in medium-sized round cells
suggesting that part of the myeloid cells were also producing iNOS.
negative feedback mechanisms mediated by multiple soluble
factors including CFSs7–10 and cytokines such as IL-1,8,10,25 IL3,12 IL-4,11 IL-6,10,26 TNF-␣8,9,13,27 and IFN-␥.14 Recently, an
increased frequency of apoptosis was observed in bone marrow cells of MDS patients. To clarify the mechanism of
apoptosis induced in MDS, several in vivo studies were performed to elucidate the influence of several of the growth factors.
They have indicated that TNF-␣ and IFN-␥ would be the
major cytokines that evoke apoptosis of hematopoietic cells
probably via the Fas/Fas-ligand pathway.6,28,29 TNF-␣ and IFN␥ suppress hematopoietic progenitor cell proliferation30–32 and
have been implicated in the mechanism of bone marrow failure.33–35 For example in aplastic anemia, aberrant production
of IFN-␥ and upregulation of TNF in bone marrow likely
induce apoptosis of hematopoietic stem cells and progenitor
cells.33,34 TNF-␣ and IFN-␥ are known to suppress both early
and late stages of hematopoiesis and induce programmed cell
death.17 However, factors linking abnormal cytokine production of MDS bone marrow and an event of cell death have
been still unclear.
Nitric oxide has recently gained attention as a new class
of molecule that serves as a variety of functions in different
tissues.36–38 Nitric oxide is synthesized by the oxidation of larginine by a family of NO synthases (NOSs). When normal
bone marrow or CD34+ cells were exposed to NO, inhibition
of colony formation was dose-dependent and direct.39 Macrophages express iNOS in response to inflammatory stimuli such
as TNF-␣, IFN-␥ or endotoxin.40 Involvement of TNF-␣ and
IFN-␥ in the regulation of NO production suggested that NO
Discussion
Bone marrow cells from MDS patients are known to have
unbalanced growth characteristics21–24 but the underlying
mechanisms causing them are still unclear. Generally, hematopoiesis is controlled by a complex interplay of positive and
a
b
c
Figure 2
Immunohistochemical staining of MDS bone marrow with anti-iNOS and anti-CD68 antibodies on frozen bone marrow tissue
sections. (a) The iNOS was positive (FITC, green) in irregular shaped cells (RAEB, original magnification ×200). (b) Localization of CD68-positive
cells was also examined by immunohistochemical staining (RITC, red). (c) Double immunostaining clarified that the majority of iNOS-positive
cells were CD68-positive bone marrow macrophages, although a part of the medium-sized round cells were also positively stained with antiiNOS antibody and indicated as green cells. The iNOS/CD68 double-positive cells were indicated as yellow cells (yellow arrowheads). The
CD68-positive but iNOS negative cells were indicated as red cells (red arrowheads).
701
iNOS in MDS bone marrow
M Kitagawa et al
702
may influence the function of bone marrow cells and may be
relevant for understanding the pathophysiology of hematologic diseases. The present study showed that bone marrow
cells expressed iNOS in MDS patients. Our previous data have
shown that TNF-␣, IFN-␥, Fas antigen and Fas-ligand were
over-expressed in the bone marrow of MDS patients. Together
with these findings we can speculate that disturbance in regulation of hematopoiesis including excess of apoptosis in the
bone marrow cells of MDS may result from upregulation of
TNF-␣ and IFN-␥ expression followed by iNOS production
and then, by strong expression of Fas antigen in hematopoietic cells.
As to the localization of iNOS in the bone marrow cells of
MDS, we could demonstrate that the major source of iNOS
production may be macrophage lineage cells. Other than
macrophages, iNOS have also been demonstrated in CD34+
cells, myeloid cells and megakaryocytes in the bone marrow.39,41 However, expression of iNOS has been well documented in macrophages when the cells were stimulated with
cytokines such as TNF and IFNs.42–44 The enhanced
expression of NO production may be toxic to the surrounding
cells or autotoxic. In the bone marrow of MDS patients, stromal cells could release NO in a paracrine fashion causing
apoptosis of surrounding hematopoietic cells. Thus, induction
of NO release by bone marrow stromal cells in vivo may have
pathophysiologic implications on the regulation of bone marrow function such as apoptosis of hematopoietic cells of
MDS cases.
References
1 Delacretaz F, Schmidt P-M, Piguet D, Bachmann F, Costa J. The
FAB classification (proposals) applied to bone marrow biopsy. Am
J Clin Pathol 1987; 87: 180–186.
2 Jacobs A. Myelodysplastic syndromes: pathogenesis, functional
abnormalities, and clinical implications. J Clin Pathol 1985; 38:
1201–1217.
3 Kitagawa M, Kamiyama R, Takemura T, Kasuga T. Bone marrow
analysis of the myelodysplastic syndromes: histological and immunohistochemical features related to the evolution of overt leukemia. Virchows Arch B 1989; 57: 47–53.
4 Kitagawa M, Kamiyama R, Kasuga T. Expression of the proliferating cell nuclear antigen in bone marrow cells from patients with
myelodysplastic syndromes and aplastic anemia. Hum Pathol
1993; 24: 359–363.
5 Raza A, Mundle S, Shetty V, Alvi S, Chopra H, Span L, Parcharidou
A, Dar S, Venugopal P, Borok R, Gezer S, Showel J, Loew J, Robin
E, Rifkin S, Alston D, Hernandez B, Shar R, Kaizer H, Gregory
S. Novel insights into the biology of myelodysplastic syndromes:
excessive apoptosis and the role of cytokines. Int J Hematol 1996;
63: 265–278.
6 Kitagawa M, Yamaguchi S, Takahashi M, Tanizawa T, Hirokawa
K, Kamiyama R. Localization of Fas and Fas ligand in bone marrow
cells demonstrating myelodysplasia. Leukemia 1998; 12: 486–
492.
7 Metcalf D. The molecular biology and functions of the granulocyte–macrophage colony-stimulating factor. Blood 1986; 67:
257–267.
8 Bot FJ, Schipper P, Broeders L, Delwel R, Kaushansky K, Loewenberg B. Interleukin-1␣ also induces granulocyte–macrophage colony-stimulating factor in immature normal bone marrow cells.
Blood 1990; 76: 307–311.
9 Ulich TR, del Castillo J, Guo K, Souza L. The hematologic effects
of chronic administration of the monokines, tumor necrosis factor,
interleukin-1, and granulocyte colony-stimulating factor on bone
marrow and circulation. Am J Pathol 1989; 134: 149–159.
10 Slack JL, Nemunaitis J, Andrews DF, Singer JW. Regulation of cytokine and growth factor gene expression in human bone marrow
stromal cells transformed with simian virus 40. Blood 1990; 75:
2319–2327.
11 Peschel C, Green I, Paul WE. Interleukin-4 induces a substance
in bone marrow stromal cells that reversely inhibits factor-dependent and factor-independent cell proliferation. Blood 1989; 73:
1130–1141.
12 Caux C, Sealand S, Farve C, Duvert V, Mannoni P, Banchereau J.
Tumor necrosis factor-alpha strongly potentiates interleukin-3 and
granulocyte–macrophage colony-stimulating factor-induced proliferation of human CD34+ hematopoietic progenitor cells. Blood
1990; 75: 2292–2298.
13 Murase T, Hotta T, Saito H, Ohno R. Effect of recombinant tumor
necrosis factor on the colony growth of human leukemia progenitor cells and hematopoietic progenitor cells. Blood 1987; 69:
467–472.
14 Young MRI, Young ME, Wright MA. Myelopoiesis-associated suppressor-cell activity in mice with Lewis lung carcinoma tumors:
interferon-␥ plus tumor necrosis factor-␣ synergistically reduce
suppressor cell activity. Int J Cancer 1990; 46: 245–250.
15 Slordal L, Warren DJ, Moore MAS. Protective effects of tumor
necrosis factor on murine hematopoiesis during cycle-specific
cytotoxic chemotherapy. Cancer Res 1990; 50: 4216–4220.
16 Kitagawa M, Saito I, Kuwata T, Yoshida S, Yamaguchi S, Takahashi
M, Tanizawa T, Kamiyama R, Hirokawa K. Overexpression of
tumor necrosis factor (TNF)-␣ and interferon (IFN)-␥ by bone marrow cells from patients with myelodysplastic syndromes. Leukemia 1997; 11: 2049–2054.
17 Selleri C, Sato T, Raiola AM, Rotoli B, Young NS, Maciejewski JP.
Induction of nitric oxide synthase is involved in the mechanism
of Fas-mediated apoptosis in haematopoietic cells. Br J Haematol
1997; 99: 481–489.
18 Rappolee DA, Mark D, Banda MJ, Werb Z. Wound macrophages
express TNF-␣ and other growth factors in vivo; analysis by mRNA
phenotyping. Science 1988; 241: 708–712.
19 Kawasaki ES, Clark SS, Coyne MY, Smith SD, Champlin R, Witte
ON, McCormick FP. Diagnosis of chronic myeloid and acute lymphatic leukemias by detection of leukemia-specific mRNA
sequences amplified in vitro. Proc Natl Acad Sci USA 1988; 85:
5698–5702.
20 Saito I, Servenius B, Compton T, Fox RI. Detection of Epstein–
Barr virus DNA by polymerase chain reaction in blood and tissue
biopsies from patients with Sjögren’s syndrome. J Exp Med 1989;
169: 2191–2198.
21 Faille A, Prosch C. Prognostic value of in vitro bone marrow culture in refractory anemia with excess of myeloblasts. Scand J
Haematol 1987; 20: 286–288.
22 Francis GE, Wing MA, Miller EJ, Berney JJ, Wonke B, Hoffbrand
AV. Use of bone marrow culture in prediction of acute leukaemic
transformation in preleukaemia. Lancet 1983; i: 1409–1412.
23 Oloffson T, Olsson I. Biochemical characterization of a leukemiaassociated inhibitor (I.AI) suppressing normal granulopoiesis in
vitro. Blood 1980; 55: 983–991.
24 Cukrova V, Neuwitova R, Vermak J, Neuwirt J. Inhibitor of normal
granulopoiesis produced by cells of MDS patients. Neoplasia
1989; 36: 83–89.
25 Crown J, Jakubowski A, Gabrilove J. Interleukin-1: biological
effects in human hematopoiesis. Leuk Lymphoma 1993; 9: 433–
440.
26 Wang S-Y, Ho C-K, Chen L-Y, Wang R-C, Huang M-H, CastroMalaspina H, Moore MAS. Down-regulation of myelopoiesis by
mediators inhibiting the production of macrophage-derived granulomonopoietic enhancing activity (GM-EA). Blood 1988; 72:
2001–2006.
27 Lindemann A, Ludwig W-D, Oster W, Mertelsmann R, Herrmann
F. High-level secretion of tumor necrosis factor-␣ contributes to
hematopoietic failure in hairy cell leukemia. Blood 1989; 73:
880–884.
28 Raza A, Gezer S, Mundle S, Gao X-Z, Alvi S, Borok R, Rifkin S,
Iftikhar A, Shetty V, Parcharidou A, Loew J, Marcus B, Khan Z,
Chaney C, Showel J, Gregory S, Preisler H. Apoptosis in bone
marrow biopsy samples involving stromal and hematopoietic cells
in 50 patients with myelodysplastic syndromes. Blood 1995; 86:
268–276.
29 Bouscary D, Vos JD, Guesnu M, Jondeau K, Viguier F, Melle J,
Picard F, Dreyfus F, Fontenay-Roupie M. Fas/Apo-1 (CD95)
expression and apoptosis in patients with myelodysplastic syndromes. Leukemia 1997; 11: 839–845.
iNOS in MDS bone marrow
M Kitagawa et al
30 Raefsky EL, Platanias LC, Zoumbos NC, Young NS. Studies of
interferon as a regulator of hematopoietic cell proliferation. J
Immunol 1985; 135: 2507–2512.
31 Roodman GD, Bird A, Hutzler D, Montgomery W. Tumor necrosis
factor-alpha and hematopoietic progenitors: effects of tumor
necrosis factor on the growth of erythroid progenitors CFU-E and
BFU-E and the hematopoietic cell lines K562, HL60, and HEL
cells. Exp Hematol 1987; 15: 928–935.
32 Broxmeyer HE, Williams DE, Lu L, Cooper S, Anderson SL, Beyer
GS, Hoffman R, Rubin BY. The suppressive influences of human
tumor necrosis factors on bone marrow hematopoietic progenitor
cells from normal donors and patients with leukemia: synergism
of tumor necrosis factor and interferon-␥. J Immunol 1986; 136:
4487–4495.
33 Nakao S, Yamaguchi M, Shiobara S, Yokoi T, Miyawaki T, Taniguchi T, Matsuda T. Interferon-␥ gene expression in unstimulated
bone marrow mononuclear cells predicts a good response to
cyclosporine therapy in aplastic anemia. Blood 1992; 79: 2532–
2535.
34 Nitico A, Young NS. Gamma-interferon gene expression in the
bone marrow of patients with aplastic anemia. Ann Intern Med
1994; 120: 463–469.
35 Rosselli F, Sanceau J, Gluckman E, Wietzerbin J, Moustacchi E.
Abnormal lymphokine production: a novel feature of the genetic
disease Fanconi anemia. II. In vitro and in vivo spontaneous overproduction of tumor necrosis factor ␣. Blood 1994; 83: 1216–
1225.
36 Moncada S, Higgs A. The l-arginine-nitric oxide pathway. New
Engl J Med 1993; 329: 2002–2012.
37 Moncada S, Palmer RMJ, Higgs EA. Biosynthesis of nitric oxide
from l-arginine: a pathway for the regulation of cell function and
communication. Biochem Pharmacol 1989; 38: 1709–1715.
38 Nathan C. Nitric oxide as a secretory product of mammalian cells.
FASEB J 1992; 6: 3051–3064.
39 Maciejewski JP, Selleri C, Sato T, Cho HJ, Keefer LK, Nathan CF.
Nitric oxide suppression of human hematopoiesis in vitro: contribution to inhibitory action of interferon-␥ and tumor necrosis factor-␣. J Clin Invest 1995; 96: 1085–1092.
40 Lu L, Bonham CA, Chambers FG, Watkins SC, Hoffman RA, Simmons RL, Thomson AW. Induction of nitric oxide synthase in
mouse dendritic cells by IFN-gamma, endotoxin, and interaction
with allogeneic T cells: nitric oxide production is associated with
dendritic cell apoptosis. J Immunol 1996; 157: 3577–3586.
41 Wallerath T, Gath I, Aulitzky WE, Pollock JS, Kleinert H, Forstermann U. Identification of the NO synthase isoforms expressed in
human neutrophil granulocytes, megakaryocytes and platelets.
Thromb Haemost 1997; 77: 163–167.
42 Wang W, Keller K, Chadee K. Entamoeba histolytica modulates
the nitric oxide synthase gene and nitric oxide production by
macrophages for cytotoxicity against amoebae and tumour cells.
Immunology 1994; 83: 601–610.
43 Kiemer AK, Vollmar AM. Autocrine regulation of inducible nitricoxide synthase in macrophage by atrial natriuretic peptide. J Biol
Chem 1998; 273: 13444–13451.
44 Drapier J-C, Wietzerbin J, Hibbs Jr JB. Interferon-␥ and tumor
necrosis factor induce the l-arginine-dependent cytotoxic effector
mechanism in murine macrophages. Eur J Immunol 1988; 18:
1587–1592.
703