JOURNAL OF VIROLOGY, Jan. 2009, p. 1071–1082
0022-538X/09/$08.00⫹0 doi:10.1128/JVI.01501-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.
Vol. 83, No. 2
Genetic History of Hepatitis C Virus in East Asia䌤
Oliver G. Pybus,1*† Eleanor Barnes,2† Rachel Taggart,2 Philippe Lemey,1 Peter V. Markov,1
Bouachan Rasachak,3 Bounkong Syhavong,3 Rattanaphone Phetsouvanah,3,5 Isabelle Sheridan,2
Isla S. Humphreys,2 Ling Lu,4 Paul N. Newton,3,5 and Paul Klenerman2
Department of Zoology, University of Oxford, South Parks Road, Oxford OX1 3PS, United Kingdom1; The Peter Medawar Building for
Pathogen Research, University of Oxford, South Parks Road, Oxford OX1 3SY, United Kingdom2; Wellcome Trust-Mahosot HospitalOxford University Tropical Medicine Research Collaboration, Microbiology Laboratory, Mahosot Hospital, Vientiane, Laos3;
Division of Gastroenterology-Hepatology and Nutrition, University of Utah, Salt Lake City, Utah4; and Centre for
Tropical Medicine, Nuffield Department of Clinical Medicine, Churchill Hospital, University of Oxford,
Oxford OX3 7LJ, United Kingdom5
Received 17 July 2008/Accepted 20 October 2008
The hepatitis C virus (HCV), which currently infects an estimated 3% of people worldwide, has been present
in some human populations for several centuries, notably HCV genotypes 1 and 2 in West Africa and genotype
6 in Southeast Asia. Here we use newly developed methods of sequence analysis to conduct the first comprehensive investigation of the epidemic and evolutionary history of HCV in Asia. Our analysis includes new HCV
core (n ⴝ 16) and NS5B (n ⴝ 14) gene sequences, obtained from serum samples of jaundiced patients from
Laos. These exceptionally diverse isolates were analyzed in conjunction with all available reference strains
using phylogenetic and Bayesian coalescent methods. We performed statistical tests of phylogeographic
structure and applied a recently developed “relaxed molecular clock” approach to HCV for the first time, which
indicated an unexpectedly high degree of rate variation. Our results reveal a >1,000-year-long development of
genotype 6 in Asia, characterized by substantial phylogeographic structure and two distinct phases of epidemic
history, before and during the 20th century. We conclude that HCV lineages representing preexisting and
spatially restricted strains were involved in multiple, independent local epidemics during the 20th century. Our
analysis explains the generation and maintenance of HCV diversity in Asia and could provide a template for
further investigations of HCV spread in other regions.
distributed but genetically conserved, notably subtypes 1a,
1b, 2a, 2b, and 3a. Evolutionary molecular clock methods
suggest that these so-called epidemic subtypes originated
around 100 years ago (43, 45, 54, 59). These probably spread
due to their association with new and efficient routes of viral
transmission that arose during the 20th century, notably
blood transfusion, hemodialysis, use of blood products, injection drug use, and nonsterile medical injections (e.g., see
references 13, 15, and 45). Much research attention has
focused on these strains, not least because they account for
most HCV infections in Europe, North America, Japan, and
Australasia. However, an understanding of the evolution
and genetic diversity of all genotypes is necessary for the
development of successful drug and vaccine treatments. For
example, genotype 1 infections respond more poorly than
genotypes 2 and 3 to antiviral drugs (11, 30), and the efficacies of cellular immune responses may also vary among
strains.
In contrast to the epidemic scenario described above, HCV
lineages in areas of endemicity are highly divergent and are
typically isolated from residents or emigrants of restricted (and
sometimes remote) geographic regions, suggesting a long duration of continuous infection in these areas. Endemic strains
belonging to genotypes 1 and 2 are found in West Africa (2, 20,
47, 66). Similar regional patterns of endemic diversity have
been found for genotype 3 in South Asia, for genotype 4 in
Central Africa and the Middle East, and for genotype 6 in East
Asia (28, 32, 36). However, no region has yet been found to
contain high levels of HCV genotype 5 genetic diversity (64).
Hepatitis C virus (HCV) is a prevalent and globally distributed human pathogen that currently infects an estimated 120
to 180 million people, or 2 to 3% of the world’s population (4,
39). Chronic HCV infection significantly increases the risk of
liver cirrhosis and hepatocellular carcinoma (18), causing substantial morbidity and mortality worldwide. HCV is the most
common chronic blood-borne infection in the United States,
causing an estimated 8,000 to 10,000 deaths per year, and this
figure is expected to increase substantially over the next 20
years (67).
HCV is a positive-sense RNA virus belonging to the genus
Hepacivirus in the family Flaviviridae that, at present, has not
been found to naturally infect any species other than humans.
The virus exhibits a very high degree of genetic diversity that is
classified by phylogenetic analysis into six genotypes, denoted 1
to 6, each of which contains numerous subtypes, denoted 1a,
2c, 3d, 6f, etc. (50, 51). The recent discovery of a putative
seventh genotype (33) suggests that further HCV diversity
remains to be characterized.
The various genotypes and subtypes of HCV have been
associated with different epidemiological and geographical
patterns (31, 51, 54). For example, a high proportion of
infections are caused by just a few strains that are globally
* Corresponding author. Mailing address: Department of Zoology,
University of Oxford, South Parks Road, Oxford OX1 3PS, United
Kingdom. Phone: 44 1865 271274. Fax: 44 1865 271249. E-mail: oliver
[email protected].
† O.G.P. and E.B. contributed equally.
䌤
Published ahead of print on 29 October 2008.
1071
1072
PYBUS ET AL.
Laos
(n=15)
[6b-related,
unclassified]
J. VIROL.
China
(n=19)
[6a]
Hong Kong
(n=25)
[6a]
Vietnam
(n=67)
[6a, 6d/e]
Cambodia
(n=6)
[6q]
Thailand
(n=40)
[6f,6i/j,
6m,6n]
Myanmar
(Burma)
(n=24)
[6n, 6m]
Indonesia
(n=3)
[6g]
FIG. 1. A map of East Asia illustrating the geographic distribution
of the NS5B gene data set (see also Fig. 3). Arrows indicate the
countries of origin of the sequences and values in parentheses indicate
the number of sequences from each country. Common subtypes
present in each country (⬎20% of sequences) are shown in brackets.
Note that the subtype distribution of NS5B sequences does not necessarily reflect the relative prevalence of infection by each subtype.
Twelve isolates were sampled outside of Asia; available information
indicates that at least seven of these were obtained from individuals of
Asian origin.
Molecular clock analyses suggest that these strains have been
present in their respective geographical regions for at least
several centuries (43, 54).
Genotype 6 provides a striking example of HCV diversity in
endemic areas. Indeed, the first HCV isolates from East Asia
were so divergent that they were initially classified as separate
genotypes, designated 7, 8, 9, and 11 (1, 50, 61, 62, 63). These
strains have since been reclassified as individual subtypes
within genotype 6 (52). Genotype 6 infections are also of considerable epidemiological importance: there are an estimated
62 million HCV-infected people in the WHO-defined Western
Pacific region (68), which represents approximately one-third
of all infections worldwide. As illustrated in Fig. 1, genotype 6
isolates have been obtained from residents or emigrants of
Thailand, India, Cambodia, Laos, Myanmar (Burma),Vietnam, China, Hong Kong, and Indonesia (25, 46). The prevalence of HCV in the general population is variable among East
Asian countries, ranging from about 0.5% in Singapore and
Hong Kong, to around 6% in Vietnam and Thailand (69), and
exceeding 10% in Myanmar (29). The reported prevalence in
China is approximately 2 to 3%, which amounts to approximately 30 million people (22, 70). Of course, not all HCV
infections in East Asia are caused by genotype 6, and the
genotype distribution of HCV infection is variable among and
within different East Asian countries. For example, genotype 6
appears to be the most frequent genotype in Myanmar (49% of
infections) (29) and Vietnam (52% of infections) (37), but not
in Thailand, where the globally distributed subtype 3a, which is
associated with injection drug use, is twice as common as
genotype 6 (23). The most common strain in China is the
global subtype 1b (5), although subtype 6 is found at higher
frequencies in southern China (27) and Hong Kong (42, 71).
Despite the recent completion of full genome sequences for
several HCV genotype 6 subtypes (28), our understanding of
the evolutionary and epidemic history of genotype 6 is still
deficient, for several reasons. First, genotype 6 diversity is well
characterized for some East Asian countries (e.g., Vietnam
and Thailand) but is poorly sampled or absent for other countries (Fig. 1). In this paper we improve this situation by reporting the isolation and sequencing of a panel of highly divergent
genotype 6 strains from Laos. This is the first time the genetic
diversity of HCV in Laos has been characterized. Second,
phylogenetic analyses have been typically small in scale and
performed on ad hoc bases, whereas in this paper we use all
previously published core and NS5B gene sequences to investigate the epidemic history of genotype 6. Third, there has been
little consideration of the spatial structure of past HCV infection in Asia. The phylogenetic distribution of strains from
different locations—viral phylogeography—contains information about the historical movement of viral lineages (16, 35),
which in turn sheds lights on contemporary patterns of transmission. To rectify this we used newly developed statistical
tests (38) to investigate the geographic structure of genotype 6
diversity. Fourth, previous estimates of the time scale of HCV
infection in Asia (43, 54) used limited data sets and potentially
unrealistic assumptions during the analyses. Most importantly,
earlier analyses relied on the assumption of a constant rate of
HCV evolution (a strict molecular clock). We show here that
the strict clock hypothesis is inappropriate for HCV and we
instead have employed recently developed relaxed clock evolutionary models that incorporate variation in evolutionary
rates (8). In addition, previous estimates of genotype 6 history
were based on single reconstructed phylogenies (43, 54) and
therefore underestimated the statistical error that may arise
from phylogenetic reconstruction. We address this situation
here by using more advanced Bayesian inference methods that
explicitly incorporate phylogenetic uncertainty (8).
We have investigated the transmission history of HCV in
Asia by conducting a comprehensive evolutionary analysis of
available HCV genotype 6 gene sequences. By combining sophisticated molecular clock, coalescent, and geographical analyses, we show that genotype 6 in Asia is structured by both
geography and by an explosion of local epidemics that occurred during the 20th century. The genetic diversity of our
new Lao isolates indicates a pattern of past HCV transmission
distinct from that found elsewhere in Southeast Asia.
MATERIALS AND METHODS
Sampling, isolation, and sequencing of Lao HCV infections. Serum samples
were obtained from 31 patients admitted to Mahosot Hospital, Vientiane, Laos,
and were stored at ⫺80°C. The patients presented with jaundice or elevated liver
transaminases (⬎3 times the upper normal limit) and were positive for HCV
antibodies (Serodia HCV antibody microtiter particle agglutination kit; Fujirebio
Inc). Informed consent was obtained from each patient, and ethical approval was
granted by the Ethical Review Committee of the Faculty of Medical Sciences,
National University of Laos, Vientiane. Viral RNA was extracted from 140 ␮l of
serum, using the QIAmp viral RNA extraction kit (Qiagen) according to the
manufacturer’s protocol.
Viral RNA was reverse transcribed using the SuperScript II reverse transcriptase protocol (Invitrogen). In brief, 10 ␮l viral RNA, 0.5 ␮l of deoxynucleoside
triphosphates (25 mM each), 0.5 ␮l random primers (500 ␮g/ml), and 1 ␮l sterile
VOL. 83, 2009
GENETIC HISTORY OF HCV IN EAST ASIA
1073
TABLE 1. Details of HCV primers for each subgenomic region
Viral region
5⬘UTR
PCR round
First
Second
CORE
First
a
5⬘UTR
5⬘UTR
5⬘UTR
5⬘UTR
ExF 1
ExR 2
InF 3
InR 4
Primer sequence
CCCTGTGAGGAACTWCTGTCTTCACGC
GGTGCACGGTCTACGAGACCT
TCTAGCCATGGCGTTAGTRYGAG
CACTCGCAAGCACCCTATCAGGCAGT
GEN6_EXF
GEN6_EXR2
GEN6_INTF
GEN6_INTR
ATCACTCCCCTGTGAGGAACTACTGT
CCCTGTTGCATA(AG)TT(AG)ATCCCGTC
ACTGCCTGATAGGGTGCTTGCG
ATGTACCCCATGAGGTCGG
First
ENO2_NS5BF1
Second
ENO4_NS5BR1
NS5S3_NS5BF2
NS5A5_NS5BR2
TGGG(GC)TT(CT)(GT)C(GC)TATGA(CT)AC(CT)CG(AC)T
G(CT)TTTGA
A(AG)TACCT(AG)GTCATAGCCTCCGTGAA
TATGATACCCGCTGCTTTGACTCCAC
GTCATAGCCTCCGTGAAGGCTC
Second
NS5Ba
Primer name
As previously described by Lu et al. (27).
water were heated to 65°C for 5 min and then quick-chilled on ice. Four ␮l of 5⫻
first-strand buffer, 2 ␮l dithiothreitol (0.1 M), and 1 ␮l RNasin were added and
incubated at room temperature for 2 min, followed by addition of 1 ␮l SuperScript II reverse transcriptase. The mixture was incubated at 42°C for 50 min and
then at 70°C for 15 min. cDNA was amplified by nested PCR, using the HighFidelity Expand PCR system (Roche). Serum samples from healthy individuals
were used as negative controls.
Table 1 provides full details of the primers used during each round of amplification for each subgenomic region. Amplification of the 5⬘ untranslated region
(UTR; 236 bp) was used to define HCV RNA positivity; 5⬘UTR PCR conditions
for both rounds were 94°C for 2 min, 30 cycles of 94°C for 25 s, 55°C for 25 s, and
72°C for 25 s, and then 72°C for 2 min. HCV core gene (464 bp) amplification was
performed; PCR conditions for both rounds were 94°C for 2 min, 35 cycles of
94°C for 30 s, 55°C for 30 s, and 72°C for 60 s, and then 72°C for 7 min. HCV
NS5B gene (377 bp) amplification was performed; PCR conditions for both
rounds were 94°C for 2 min, 28 rounds of 94°C for 15 s, 60°C for 30 s, and 72°C
for 45 s, and then 72°C for 7 min. Amplicons were run on 1% agarose gels stained
with ethidium bromide, and DNA was purified using the Qiagen gel extraction
kit. Purified DNA was sequenced in both forward and reverse directions using
the ABI Prism Big Dye Terminator cycle sequencing kit (Perkin-Elmer Applied
Biosciences).
Phylogenetic analysis of the core and NS5B data sets. All available genotype
6 sequences were downloaded from the Los Alamos HCV database (25). Database sequences were retained if they spanned either the core or NS5B subgenomic regions obtained for the Lao isolates (see above). Only one sequence
from each infected individual was retained, and sequences from experimental
chimpanzee infections were excluded. Database reference sequences were then
cropped, collated with the newly generated Lao sequences, and aligned by hand
in Se-Al (available from http://tree.bio.ed.ac.uk). The resulting core alignment
was 399 nt long and contained 230 sequences, and the NS5B alignment was 378
nt long and contained 211 sequences. A third alignment was constructed by
concatenating the core and NS5B sequences of all isolates that had been sequenced in both genome regions. This concatenated alignment was 777 nt long
and contained 127 sequences.
Maximum likelihood phylogenies were estimated for the core and NS5B data
sets using PAUP (58). The most appropriate nucleotide substitution model for
phylogenetic analysis was determined using the model selection procedure implemented in the program MODELTEST; for both data sets the best-fitting
model was GTR⫹⌫⫹I (41). Under this model, phylogenies were heuristically
searched using the SPR (subtree pruning and regrafting) and NNI (nearest
neighbor interchange) perturbation algorithms. The statistical robustness levels
of phylogenetic groupings were subsequently assessed using bootstrap analyses
(500 replicates). Phylogeographic structure was then identified using FigTree
(available from http://tree.bio.ed.ac.uk), and clades and lineages were colored
according to their location of sampling.
Estimation of evolutionary time scale. We used an evolutionary molecular
clock to estimate the time scale of HCV epidemic history in East Asia. Previous
evolutionary analyses of HCV have employed the simplest strict clock model,
which assumes that all phylogeny branches evolve at exactly the same rate. This
potentially unrealistic assumption can be avoided by using a relaxed clock, which
allows evolutionary rates to vary among lineages according to some probability
distribution (8).
Because there was insufficient temporal structure in the study sequences to
directly estimate rates of molecular evolution, we used the external rate calibration approach previously employed by Pybus et al. (44) and Hue et al. (19). First,
we obtained an external estimate of the evolutionary rate of our 399-nt core gene
fragment from an independent, previously published HCV data set (59) that
does contain significant temporal structure. Posterior distributions of this rate
were estimated under three clock models using the Bayesian MCMC approach
implemented in the program BEAST: (i) strict clock, (ii) relaxed clock with an
uncorrelated log normal rate distribution, and (iii) relaxed clock with an uncorrelated gamma rate distribution (8, 9). The exponential relaxed clock model is a
special case of the gamma relaxed clock model. Second, these external rates were
subsequently used to define normally distributed priors for the core gene evolutionary rate during our strict and relaxed clock analyses of the concatenated
data set. Third, evolutionary rates for the NS5B gene region were estimated
using a relative rate approach. Briefly, once we have specified a rate for the core
region, we can use the relative diversity of the core and NS5B regions to estimate
an NS5B rate, because the time scales for both regions are identical. Additionally, the core and NS5B gene regions were given independent among-site ⌫ rate
distributions. In summary, the sequence evolution model used incorporated
multiple levels of rate heterogeneity: among nucleotide sites, among genes, and
among lineages.
Evolutionary analysis of the concatenated data set. To estimate the epidemic
history of HCV genotype 6, we analyzed the concatenated core and NS5B
alignment using the Bayesian Skyline plot (BSP) approach, as implemented in
the program BEAST (for details, see Pybus et al. [44] and Drummond et al. [8]).
To test the robustness of our results to model specification, we estimated epidemic history under a number of different model combinations and then used
Bayes factors to choose the statistically most appropriate model (57). Marginal
posterior distributions were estimated for each model parameter using Bayesian
MCMC inference. All MCMC analyses were run for at least 50 million states.
MCMC chain convergence, effective sample sizes, and Bayes factors were computed and investigated using the program Tracer v1.4 (9). In addition, an independent maximum likelihood relative rates analysis was performed using
HYPHYv0.99 (40), which confirmed that relative rates were sampled appropriately in the Bayesian MCMC analyses.
A Bayesian estimate of phylogeny was obtained from the posterior distribution
of trees arising from the best-fitting BEAST analysis (see above). First, the
program TreeAnnotator (9) was used to calculate the Bayesian posterior probabilities of each internal node. Second, these probabilities were multiplied for
each phylogeny sampled during the MCMC analyses. Third, the phylogeny with
the highest total was located. This phylogeny best summarizes the set of credible
trees and is called the maximum clade support phylogeny. Because a relaxed
clock was used in the Bayesian MCMC analysis, the branch lengths and node
heights of the maximum clade support phylogeny are in units of years. See
Drummond et al. (8) for further details.
Lastly, the program BaTS (38) was used to test for the presence of statistically
significant phylogeographic structure. BaTS tests the null hypothesis of panmixis
(i.e., no correlation between phylogeny and taxa location) by performing ran-
6a_CN_HCV7_DQ859932
6a_CN_ HCV70_ DQ859956
6a_ CN_ HCV15_ DQ859938
6a_ CN_ HCV43_ DQ859946
6a_ CN_HCVF4_DQ859963
6a_ CN_ HCV40_ DQ859944
6a_ CN_ HCV61_ DQ859952
6a_ CN_ HCV46_ DQ859949
6a_ CN_ fs1_AY835322
6a_ CN_HCV64_DQ859953
6a_ CN_sz593_AY835323
6a_ CN_ gb26_AY835320
6a_CN_sz826_AY835321
6a_ CN_ gb9_AY835331
6a_ CN_HCV14_DQ859937
6a_VN_ D52_ DQ155474
6a_ CN_ HCV36_ DQ859942
6a_ HK_EUHK2_Y12083
6a_ VN_VT699_AB162868
6a_ CN_ gb14_AY835318
6a_CN_fs12_AY835319
6a_ HK_ HK2_U10198
6a_CN_ HCV5_DQ859930
6a_CN_HCV6_DQ859931
6a_ CN_ HCV48_ DQ859950
6a_CN_HCV45_ DQ859948
6a_ VN_ VT657_AB162866
6a_ CN_ HCV65_ DQ859954
6a_ CN_ HCV25_ DQ859940
6a_CN_HCV71_DQ859955
6a_ CN_ HCV72_ DQ859957
6a_ CN_ fs14_AY835324
6a_ CN_ fs6_ AY835325
6a_ CN_ HCV34_ DQ859941
6a_CN_ gz1_AY835326
6a_ CN_ gz8_AY835327
6a_ CN_ fs3_ AY835328
6a_ CN_fs13_AY835329
6a_CN_ gb28_AY835330
6a_ VN_D2_ DQ155445
6a_ VN_ D45_ DQ155469
6a_ VN_ D1_ DQ155444
6a_VN_ VN569_D88475
6a_VN_ VN11_ L38339
6a_ VN_ VT903_AB162869
6a_VN_ D9_ DQ155450
6a_VN_ D31_ DQ155461
6a_ VN_D17_DQ155453
6a_ VN_VT689_ AB162867
6a_ VN_D23_DQ155457
6a_ HK_ 6a33_AY859526
6a_ VN_VT315_ AB162864
6a_VN_ D22_ DQ155456
6a_ VN_ VT349_ AB162865
6a_VN_ D75_ DQ155487
6a_ VN_VN571_ D88476
6a_ VN_ VN538_ D88473
6a_ VN_ D12_DQ155451
6a_ VN_ VN506_D88469
6a_VN_ D78_ DQ155490
6a_VN_ D36_ DQ155465
6a_VN_ D16_ DQ155452
6a_CA_ QC26_U33435
6b_ TH_EUTHD31_ L50544
6b_ TH_EUTHD37_ L50545
6b_ TH_TH580_ D37841
0.05 subs. / site
95
subtype 6a
100
subtype 6b
6_LA_Laos373
6_LA_Laos394
6_LA_Laos259
6_LA_Laos23
6_LA_Laos347
6_LA_Laos384
75
6_TH_ Th31_DQ640344
6n_ TH_ BB144006A_ AF484977
6n_ TH_ EUTHD12_L50542
6n_ TH_ EUTH19_ U31258
6_ TH_ Th32_DQ640345
6n_ TH_217776A_ AF528326
6_ TH_ Th23_DQ640339
6n_ TH_104426A_ AY089759
6_ TH_ Th27_DQ640342
6n_ TH_BB694656A_AF484976
6_TH_ Th22_DQ640338
6n_ TH_ 706466A_ AY089755
6_ TH_ Th40_DQ640361
6n_ TH_22346A_ AY089754
6n_IN_2KD616_ AY887974
6_TH_ Th33_DQ640346
6n_ TH_ 148506A_ AF528325
6_ CN_km42_ AY835334
6n_ TH_ 748226A_ AY089763
6n_ CN_NK36_ DQ777799
6_ TH_ Th28_DQ640343
6n_ TH_ 054586A_ AY089757
6n_ TH_D9793_ D63946
6n_ TH_ EUTHD114_L50556
6n_ TH_EUTH86_ U31259
6n_ TH_EUTH49_ U31264
6_TH_D86
6n_ CN_NK43_ DQ777798
6n_ CN_NK32_ DQ777797
subtype 6n
6i_ TH_TH3_D28834
6i_ TH_TH9_D28835
6i_ TH_ TH602_ D37850
6i_ TH_TH555_ D37849
6_ TH_ Th25_DQ640340
6i_ TH_ 087956A_AY089758
6_ TH_ Th26_DQ640341
6i_TH_ 928556A_AY089756
6i_ TH_BB118856A_AF484979
6i_ TH_ EUTHD8_ L50541
6i_ TH_ EUTHD60_ L50548
6i_ TH_EUTH21_L49474
6i_ TH_EUTH22_L49475
6i_ TH_ EUTH39_L49476
6_TH_C159
6i_ TH_ EUTHD100_L50554
6_LA_Laos250
6_TH_C667
6j_ TH_ TH33_ D28842
6j_TH_ TH553_D37848
6h_VN_D54_DQ155566
6h_VN_D54_DQ155476
6h_VN_VN004_D88465
6h_VN_VN085_ D88466
6h_ FR_FR1_ L38331
6_LA_Laos382
6_LA_Laos176
6_ U S _537796 (Asia)
6l_ VN_ VN531_ D88472
6l_VN_VN507_ D88470
6l_ VN_ VN530_ D88471
6l_VN_ VT681_ AB162876
6k_ VN_ D33_DQ155463
6_LA_Laos349
6k_CN_NK01_ DQ777779
6k_CN_NK06_DQ777780
6k_VN_ VN405_ D88468
6k_ CN_KM45_AY878650
6_CN_km41_AY835332
6m_ TH_B492_ D63943
6m_ MM_ EUBUR1_L49480
6_TH_C208
6_TH_C185
6_TH_C192
subtype 6i
82
subtype 6j
98
subtype 6h
81
95
71
subtypes 6k & 6l
99
subtype 6m
6_ US_IG57272_ AY734479
6_IN_N103_AY921163
6f_TH_ EUTHD64_L50549
6f_ TH_EUTH13_L49479
6f_ TH_EUTH5230_L49477
6f_TH_ EUTH7_ L49478
77
94
6f_ TH_ EUTHD1_L50540
6f_ TH_ EUTHD47_ L50547
6f_TH_ EUTHD65_L50550
6f_ TH_ EUTH61_U31262
6f_TH_EUTHD69_L50551
6f_ TH_EUTH80_U31260
6f_ TH_ EUTH36_U31261
C_044
6f_ TH_EUTH89_U31265
6_ TH_ Th52_DQ640360
6f_ TH_ BB87566A_ AF484980
6f_ TH_ EUTH28_U31263
6f_ TH_ TH571_D38078
6f_ TH_ TH15_D28838
6f_ TH_ TH552_ D37845
6f_ TH_ EUTHD41_ L50546
6f_ TH_ TH18_D28839
6f_ TH_TH35_D28843
6f_TH_EUTHD74_L50552
6f_TH_TH271_ D37844
6f_ TH_ TH976_ D37846
6f_TH_TH13_D28837
6f_TH_TH22_D28840
6f_TH_ TH26_D28841
6_TH_C046
subtype 6f
6_CA_C216 (Asia)
6p_VN_ VN12_L38340
6_ VN_VT887_AB162873
6_CA_C81 (Asia)
6_LA_Laos310
6_LA_Laos132
6d_VN_ VN235_D88467
6_CN_HK6554
6g_ID_JK148_ D49758
6g_ID_ JK046_ D63822
6g_ID_ JK065_D49751
6_ CA_ QC66_AY434111
100
85
subtype 6g
6c_TH_ TH846_ D37843
6q_CA_C99 (Cambodia)
6_CA_C197 (Asia)
6_LA_Laos390
6_CA_C150 (Asia)
6_LA_Laos344
97
6_CA_C227
6o_VN_VN4_ L38341
6o_VN_VT316_AB162871
6o_CA_QC30_U52811 (Vietnam)
6_ VN_D85_DQ155496
6_LA_Laos248
6e_VN_VT886_AB162872
6e_VN_VT204_ AB162870
6e_VN_ VT898_ AB162875
6e_VN_ VN998_ D31971
6d_ VN_ D41_ DQ155467
6d_ VN_ D88_ DQ155499
6_ VN_ VT897_AB162874
6d_ VN_ D53_DQ155475
6_CN_GX004
6e_VN_ VN843_ D88478
6d_ VN_ D42_DQ155468
6d_VN_ D60_DQ155479
6e_VN_ VN13_ L38354
6e_VN_ VN540_D88474
6d_ VN_ D65_DQ155483
6e_VN_ VN787_ D88477
6e_VN_ D82_ DQ155493
6d_VN_ D26_ DQ155459
6d_ VN_D79_ DQ155491
6d_ VN_ D67_ DQ155484
subtypes 6d & 6e
6d_ VN_ D94_DQ155501
6d_ VN_ D83_DQ155494
6_CA_C269 (Asia)
6_VN_D49_DQ155472
6_ IN_ North5_ AY190347
6_IN_2KD886_AY887980
6_ CN_ gz52557_AY835335
6_LA_Laos350
1074
subtype 6o
VOL. 83, 2009
GENETIC HISTORY OF HCV IN EAST ASIA
domization tests on two tree-shaped statistics: the parsimony score (PS) (53) and
the association index (AI) (65). The randomizations are performed across a
credible set of trees; hence, BaTS correctly incorporates phylogenetic uncertainty when testing for phylogeographic structure. For our BaTS analyses we
used the posterior distribution of trees arising from the best-fitting BEAST
analysis of the concatenated data set (see above). Further methodological details
have been provided by Parker et al. (38).
Nucleotide sequence accession numbers. The GenBank accession numbers of
the new HCV sequences from Laos are EU420957 to EU420986.
RESULTS
Detection of HCV RNA in Laos samples. HCV RNA was
detected by amplification of the 5⬘UTR in 18 out of 31 patients
with jaundice and detectable anti-HCV antibodies. As this
assay is highly sensitive for the detection of HCV RNA across
all genotypes, it is most likely that the HCV RNA-negative
patients had spontaneously controlled HCV replication, either
at the time of presentation (if they were acutely infected) or at
some time in the past (if patients presented with jaundice due
to other causes). Our spontaneous resolution rate of 42% is in
line with previous reports of acute HCV infection in jaundiced
patients (12). Of the 18 patients with detectable viremia, the
core and NS5B regions were amplified in 16 and 14 patients,
respectively. Our failure to amplify these regions in a few
instances reflects the genotype 6-specific primers used and the
higher variability of these regions compared to the 5⬘UTR.
Phylogenetic analysis of the core and NS5B data sets. Figures 2 and 3 show the maximum likelihood phylogenies estimated from the core and NS5B alignments, respectively. As
expected, the NS5B gene phylogeny is deeper and has a greater
number of well-supported clades, reflecting the greater genetic
variation of this region. In most cases sequences correctly
group into their respective subtypes, although in both phylogenies strains belonging to subtypes 6d and 6e are mixed; we
suggest this could be due to database annotation errors. In the
core phylogeny, subtype 6o is incorrectly placed as a monophyletic ingroup of subtypes 6d and 6e; this is a phylogenetic
estimation error most likely arising from limited sequence diversity.
As previously suggested by Mellor et al. (32), HCV genotype
6 phylogenies show phylogeographic structure, that is, sequences tend to group together according to their location of
sampling. In one instance, spatial structure can even be seen
within a single subtype; subtype 6a strains from China and
Vietnam are phylogenetically distinct in both trees. Subtype 6b
and related strains are from Thailand and Laos. Subtype 6m
and 6n strains are mostly from Thailand and Myanmar, and
occasionally from China. Subtypes 6f, 6i, and 6j are dominated
by Thai isolates, whereas subtypes 6d, 6e, 6o, 6p, and 6h are
mostly from Vietnam. Subtype 6q and closely related sequences are from Cambodia and Laos, whereas subtype 6g
1075
strains are from Indonesia. Subtypes 6k and 6l are frequently
from Vietnam but are also found in China and Laos. Several
strains were sampled from patients residing outside Asia;
whenever information on these individuals was available, it
always indicated an Asian ethic origin or background.
Our new isolates from Laos are genetically diverse and are
interspersed among many different genotype 6 lineages. There
is only one well-supported cluster of Lao sequences (strains
Laos373, Laos394, Laos259, Laos23, Laos347, and Laos38),
which is most closely related to subtype 6b. The locations of
the remaining Lao strains are as follows: Laos250 falls between
subtypes 6i and 6j; Laos382 groups most closely with subtype
6 h; Laos349 clusters near subtype 6l; Laos248 belongs to
subtype 6o; Laos132 groups with the divergent Vietnamese
strain VN235; Laos310 clusters with strain C81 sampled in
Canada from an Asian immigrant; Laos390 is similar to the
Laos strain IG93335 and groups with subtype 6q sequences
from Cambodia. Laos344, Laos350, and Laos176 are highly
divergent and do not closely group with any other strains.
Estimation of evolutionary time scale. We estimated a time
scale for the evolution of HCV genotype 6 from an independent, previously published set of HCV sequences sampled at
different times (59). Under the strict clock model, the estimated rate for our 399-nt core gene region was 1.78 ⫻ 10⫺4
substitutions/site/year (95% credible region, 1.11 ⫻ 10⫺4 to
2.6 ⫻ 10⫺4). A very similar estimate was obtained under the
relaxed clock models, 1.72⫻10⫺4 substitutions/site/year (95%
credible region, 0.91 ⫻ 10⫺4 to 2.7⫻10⫺4). These rate estimates were subsequently used as prior distributions in all subsequent BEAST analyses (see Materials and Methods for
details).
Evolutionary analysis of the concatenated data set. Evolutionary analysis of the concatenated core plus NS5B data set
was performed in BEAST under a range of molecular clock
and coalescent model combinations. Simple coalescent models
(i.e., constant size, exponential growth) consistently performed
very poorly in comparison to the Bayesian Skyline plot (log10
Bayes factors, ⬎25) and are therefore not reported here (results available on request). Six remaining models were wellsupported: (i) a strict clock with BSP of 5 steps, (ii) a strict
clock with BSP of 10 steps, (iii) a log normal relaxed clock with
BSP of 5 steps, (iv) a log normal relaxed clock with BSP of 10
steps, (v) a gamma relaxed clock with BSP of 5 steps, and (vi)
a gamma relaxed clock with BSP of 10 steps.
As shown in Fig. 4, all six model combinations gave similar
median estimates for the age of HCV genotype 6, which was
dated to ⬃1,100 to 1,350 years ago. However, the 95% credible
intervals for these estimates are large, ranging from ⬃600 years
ago to nearly 3,000 years ago, with the lower interval being less
variable among models than the higher interval. However,
FIG. 2. Estimated maximum likelihood phylogeny for the core gene alignment. Bootstrap scores of ⬎70% are shown next to well-supported
nodes, and the phylogeny is midpoint rooted. Sequence names are given in the Los Alamos HCV Database format, as follows: subtype/country
code/strain name/accession number. Where available, information is given in parentheses about the country of origin of emigrants from Southeast
Asia to other countries. Gray bars indicate major subtypes of HCV genotype 6. Phylogeny branches and sequence names are colored according
to the country of origin of the sampled individual. Country codes and colors for Asian strains are as follows: CN, China (red); VN, Vietnam (dark
blue); HK, Hong Kong (red); TH, Thailand (green); IN, India (light blue); MM, Myanmar (gray); ID, Indonesia (brown); KH, Cambodia (orange);
LA, Laos (magenta). Strains sampled outside of Asia are colored black (CA, Canada; FR, France; US, United States).
0.09 subs. / site
6a_ VN_ VN538_ D87360
6a_ VN_ D12_ DQ155509
6a_ VN_ VN865_ D17492
6a_ VN_ D23_ DQ155515
6a_ VN_ D75_ DQ155545
6a_ VN_ D16_ DQ155510
6a_ VN_ VN746_ D17484
6a_ VN_ VN853_ D17490
6a_ VN_ D22_ DQ155514
6a_ VN_ VN710_ D17482
6a_ VN_ VN824_ D17487
6a_ VN_ VN826_ D17488
6a_ VN_ VN11_L38379
6a_ VN_ VN541_ D17474
6a_ VN_ VN555_ D17475
6a_ VN_ VN753_ D17485
6a_ VN_ VN930_ D17493
6a_ VN_ VN571_ D87363
6a_ VN_ D17_ DQ155511
6a_ VN_ D9_DQ155508
6a_ VN_ D36_ DQ155523
6a_ VN_ VN569_D87362
6a_ VN_ VN689_ D17480
6a_ VN_ VN506_ D87356
6a_ VN_ D78_ DQ155548
6a_ VN_ D1_DQ155502
6a_ VN_ VN693_ D17481
6a_ VN_ D2_ DQ155503
6a_ VN_ D45_ DQ155527
6a_ HK_ HKGS2_ AB204690
6a_ HK_ EUHK2_ Y12083
6a_ HK_ HKGS10_ AB204686
6a_ HK_6a33_AY859526
6a_ HK_ HKGS30_ AB204705
6a_ VN_ D31_ DQ155519
6a_ VN_ D52_ DQ155532
subtype 6a
6a_ HK_ HKGS23_ AB204696
6a_ HK_HKG16P503_AB204693
6a_ HK_HKGS17_ AB204694
6a_ HK_ HKG12P403_AB204700
6a_ HK_ HKGS14_ AB204702
6a_ HK_ HKGS1_AB204697
6a_ HK_ HKG22P704_AB204701
6a_ HK_HKGS21_AB204692
6a_ HK_ HKG9P304_ AB204688
6a_ HK_ HKGS24_ AB204707
6a_ HK_ HKGS27_ AB204699
6a_ HK_ HKGS5_ AB204689
6a_ HK_ HKGS25_ AB204695
6a_ HK_HKGS15_ AB204706
6a_ HK_ HKG3P104_ AB204698
6a_ HK_ HKGS31_ AB204703
6a_ HK_ HKG14P804_AB204704
6a_ HK_HKGS29_ AB204687
6a_ HK_ HKG19P604_ AB204708
6a_ CN_ fs14_AY834942
6a_ CN_ fs6_ AY834943
6a_ CN_ fs13_AY834940
6a_ CN_ fs3_ AY834941
6a_ CN_ gz1_AY834944
6a_ HK_ HKG4P299_ AB204691
6a_ CN_gz8_AY834945
6a_ CN_gb28_AY834946
6a_ CN_gb26_AY834949
6a_ CN_ sz826_ AY834950
6a_ CN_gb14_AY834951
6a_ CN_fs12_AY834952
6a_ CN_sz593_ AY834947
6a_ CN_fs1_AY834948
6a_ CN_gb9_AY834953
6_LA_Laos23
6_LA_Laos347
6b_ TH_ TH580_ D37855 subtype 6b
6_LA_Laos384
6_LA_Laos373
6_ TH_ CMBDN14_ DQ179117
6_ MM_ MY3E_ 3_ AB103143
6i_ TH_ TH602_ D37864
6i_ TH_TH555_ AB027609
6_TH_C159
6i_ TH_EUTHD100_ L50535
subtype 6i
6i_ TH_EUTHD60_L50536
6_ TH_ Th25_DQ640366
6_ TH_ Th26_DQ640367
6h_ VN_ VN004_ D87352
6h_ VN_ VN085_ D87353
subtype
6_LA_Laos382
6h_ FR_FR1_ L38369
6_LA_Laos176
6j_ TH_TH553_ AB027608
6j_ TH_THN104B_ D14193
subtype 6j
6j_ TH_ EUTH1_ L49481
6_LA_Laos250
6_ U S _ 537796 (Asia)
6k_ VN_ D33_DQ155521
6l_ VN_ VN530_ D87358
6l_ VN_ VN655_ D17479
6l_ VN_ VN507_ D87357
6l_ VN_ VN531_ D87359
subtypes 6k & 6l
6l_ VN_ VN606_ D17478
6_LA_Laos349
6k_ CN_KM45_ AY878650
6k_CN_km41_ AY834937
6k_ VN_VN405_ D87355
6m_ MM_MY6H_ 1_ AB103151
6m_ MM_MY54_ 1_AB103147
6m_ MM_ MY48_ 1_AB103157
6_TH_C208
6m_ MM_ MY34_ 1_ AB103142
6m_ MM_ MY100_ 1_ AB103135
6m_ MM_MY65_ 1_AB103149
6m_ MM_MY77_ 1_AB103153
subtype 6m
6m_ TH_B492_D28543
6_TH_C185
6_TH_C192
6m_ MM_ MY9H_ 1_ AB103156
6m_ MM_MY1H_ 1_ AB103138
6m_ MM_ MY8H_ 1_ AB103155
6m_ MM_ EUBUR1_ L49484
6m_ MM_ MY2B_ 1_ AB103139
6n_MM_ MY1F_ 2_ AB103137
6n_ MM_MY8D_ 2_ AB103154
6n_ MM_ MY46_2_AB103144
6n_ MM_ MY101_ 2_ AB103136
6n_ MM_ MY6J_ 2_ AB103152
6n_TH_ BB9_D28542
6n_TH_D8693_ D28545
6_ TH_ Th32_DQ640371
6n_ MM_ MY2I_2_AB103141
6n_ MM_ MY4F_ 2_ AB103145
6_ CN_km42_ AY834939
6n_ MM_ MY2D_ 2_ AB103140
subtype 6n
6n_ MM_ MY6B_ 2_ AB103150
6n_ MM_ MY4J_2_ AB103146
6n_ MM_MY5D_ 2_AB103148
6_ TH_ Th27_DQ640368
6_ TH_ Th22_DQ640364
6_ TH_ Th31_DQ640370
6_ TH_ Th28_DQ640369
6_TH_Th33_DQ640372
6_ TH_ Th23_DQ640365
6n_ TH_BB1_U13010
6n_ TH_ EUTH86_ U31275
6n_ TH_ THNIMA_ D14180
6_ CA_QC66_AY434110
6_ US_IG57272_ AY734481
6g_ID_JK046_D63822
6g_ID_ JK065_ D49766 subtype 6g
6g_ID_JK148_ D49779
6g_CN_gz52557_ AY834954
6f_ TH_ THN104A_ D14194
6f_ TH_ TH552_ D37859
6_TH_ Th52_DQ640386
6f_ TH_ EUTHD65_ L50538
6f_ TH_ TH976_D37860
6f_TH_ EUTH7_L49482
subtype 6f
6f_ TH_ TH571_D37869
6_TH_C046
6f_ TH_ EUTH13_ L49483
6f_ TH_ EUTH36_ U31276
6f_ TH_ TH271_ D37858
6_CA_C81 (Asia)
6_LA_Laos310
6_LA_Laos344
6_LA_Laos350
6q_ LA_IG93335_ AY735101
6_ CA_ QC197_ AY754630 (Asia)
6_LA_Laos390
6_CA_ QC150_ AY754612 (Asia)
6q_ KH_ IG93336_ AY735102
6q_ CA_ QC176_AY754618 (Cambodia)
6q_ CA_ QC99_ AY754637 (Cambodia)
subtype 6q
6q_ CA_ QC57_ AY754633 (Cambodia)
6_ CA_ QC164_ AY754615 (Cambodia)
6q_ CA_ QC189_AY754627 (Cambodia)
6_LA_Laos248
6_ VN_ D85_DQ155554
6o_CA_ QC33_ AY894535 (Asia)
subtype 6o
6o_ CA_ QC227_ AY894547
6o_ VN_ VN4_ L38382
6o_ CA_ QC30_ AY894524
6p_ CA_ QC123_ AY894532 (Asia)
6p_ CA_ QC190_AY894541 (Asia) subtype 6p
6p_ CA_ QC216_AY894544
6p_ VN_ VN12_L38380
6d_ VN_ D60_ DQ155537
6e_VN_ VN13_ L38381
6e_VN_ VN968_ D17494
6d_ VN_ D26_ DQ155517
6d_ VN_ D79_ DQ155549
6d_ VN_ D65_ DQ155541
6e_VN_ VN540_ D87361
6d_ VN_ D94_ DQ155559
6e_VN_ VN787_ D87364
6e_VN_ D82_ DQ155551
subtypes 6d & 6e
6e_VN_ VN843_ D87365
6d_ VN_ D67_ DQ155542
6d_ VN_ D42_ DQ155526
6d_ VN_ D53_ DQ155533
6_CN_GX004
6e_VN_ VN998_ D30797
6e_VN_ VN862_ D17491
6d_ VN_ D41_ DQ155525
6d_ VN_ D88_ DQ155557
6e_VN_ VN711_ D17483
6d_VN_ D83_ DQ155552
6_CA_C269 (Asia)
6_VN_D49_DQ155530
6c_ TH_TH846_ AB027610
6_LA_Laos132
6d_VN_VN235_D87354
100
76
80
99
87
6h
94
76
95
88
96
84
100
100
99
100
100
99
82
85
79
FIG. 3. The estimated maximum likelihood phylogeny for the NS5B gene alignment. Bootstrap scores of ⬎70% are shown next to wellsupported nodes, and the phylogeny is midpoint rooted. See Fig. 2 for sequence naming details and the coloring scheme.
1076
VOL. 83, 2009
GENETIC HISTORY OF HCV IN EAST ASIA
1077
FIG. 4. Estimated dates of origin of genotype 6, as obtained under model combinations A to F (see text for details). The composition and
marginal posterior log likelihood of each model combination are provided. The error bars are the 95% highest posterior density credible intervals
for each estimate.
these limits more accurately portray the true extent of statistical error than those reported in previous analyses (43, 54),
which failed to use realistic models of sequence evolution or to
incorporate uncertainty arising from phylogeny estimation.
Our estimate of the date of the most recent common ancestor
of genotype 6 is 400 years older than that reported by Pybus
et al. (43), which likely reflects the much greater diversity of
isolates considered here. Figure 4 also gives the estimated marginal likelihood of each model, calculated using Tracer v1.4,
which represent the probability of each model combination given
the data. Models C and E had substantially higher marginal likelihoods than the other models (log10 Bayes factors of ⬎3.5).
Model E has a slightly greater marginal likelihood than model C,
but this difference is not considered significant (log10 Bayes factor,
⬃0.5). For each clock model, the BSP with 5 steps was statistically
favored over the BSP with 10 steps (Fig. 4).
Figure 5 shows the maximum clade support phylogeny for
the concatenated core plus NS5B data set, reconstructed from
the phylogenies sampled under the best-supported model (i.e.,
combination E). Concatenation of the two genome regions
leads to high posterior probabilities (P ⬎ 0.9) for many internal
nodes. There is strong evidence (P ⫽ 0.96) that the Chinese
subtype 6a sequences are monophyletic, but there is no such
evidence for the Vietnamese subtype 6a strains (P ⫽ 0.5).
Therefore, full-length sequences will be required to determine
if subtype 6a originated in China/Hong Kong and then spread
to Vietnam, or vice versa. Many lineages show rapid diversification during the 20th century (Fig. 5), giving rise to clusters of
related sequences that are typically from the same location
(Fig. 5). These clusters mostly correspond to the current subtype definitions. Subtypes such as 6q, 6 h, and 6k, which are
poorly represented in the concatenated tree but well-represented in the core and NS5B trees, exhibit similar levels of
genetic diversity and will therefore also have a 20th century
origin. In contrast, many other genotype 6 lineages (e.g.,
Laos350, TH846, or QC66) show no such evidence of diversification during the 20th century.
We also obtained estimates of the molecular clock model
parameters under the best-fitting model (combination E). The
evolutionary rate of the core gene (1.8 ⫻ 10⫺4; 95% credible
region, 0.9 ⫻ 10⫺4 to 2.9 ⫻ 10⫺4) is roughly two-thirds that of
the NS5B gene (3.3 ⫻ 10⫺4; 95% credible region, 1.6 to ⫻ 10⫺4
to 5.1 ⫻ 10⫺4), in line with previous estimates (48). Rate
heterogeneity among sites is slightly higher for the core region
(␣ ⫽ 0.22) than for NS5B (␣ ⫽ 0.32). Rate heterogeneity
among lineages is represented by the relaxed clock coefficient
of variation (COV) parameter. Smaller COV values represent
less rate variation among lineages and more clock-like evolution, hence the credible region of COV should abut zero if
evolution follows a strict molecular clock. Our COV estimate
is 0.37 (95% credible region, 0.28 to 0.45), which represents
significant among-lineage rate variation and is similar to recently reported values for Dengue virus, human influenza A
virus, and human immunodeficiency virus type 1 (8, 26). However, we might have expected to obtain lower COV values for
HCV, because some previous studies reported that the hypothesis of a strict molecular clock is not always rejected (43). We
therefore suggest that the failure of previous analyses to reject
the strict clock was due to the comparatively small sample sizes
used. In order to ensure accuracy, future evolutionary analyses
of HCV data sets of sufficient size should incorporate rate
variation among lineages. The relaxed clock covariance parameter is 0.02 (95% credible region, ⫺0.11 to 0.14). This parameter measures the degree to which among-lineage rate variation is randomly distributed across the phylogeny, as opposed
to being localized to specific clades. Our data suggest the
1
0.96
subtype 6a
1
6a_ CN_ gz8
6a_ CN_ fs3
6a_ CN_ fs13
6a_ CN_ gz1
6a_ CN_ fs14
6a_ CN_ fs6
6a_ CN_ gb28
6a_ CN_ fs12
6a_ CN_ gb9
6a_ HK_ EUHK2
6a_ CN_ gb14
6a_ CN_ fs1
6a_ CN_ sz593
6a_ CN_ sz826
6a_ CN_ gb26
6a_ VN_ D1
6a_ VN_ VN569
6a_ VN_ VN11
6a_ VN_ D45
6a_ VN_ D2
6a_ VN_ D52
6a_ VN_ D31
6a_ VN_ D16
6a_ VN_ VN538
6a_ VN_ D12
6a_ VN_ D22
6a_ VN_ D17
6a_ VN_ D75
6a_ VN_ D23
6a_ VN_ D78
6a_ VN_ D9
6a_ VN_ D36
6a_ VN_ VN506
6a_ VN_ VN571
6_LA_LAOS373
6b_ TH_ TH580
6_LA_LAOS23
6_LA_LAOS347
6_LA_LAOS384
6_ US_ IG57272
6_ TH_ Th32
6_ TH_ Th27
6_ TH_ Th23
6n_ TH_ EUTH86
6_ TH_ Th31
6_ CN_ km42
6_ TH_ Th33
6_ TH_ Th28
6_ TH_ Th22
6_TH_D86
6_TH_C185
6_TH_C192
6m_ MM_ EUBUR1
6m_ TH_ B492
6_TH_C208
6k_ VN_ VN405
6_ CN_ km41
6k_ CN_km45
6_LA_LAOS349
6l_ VN_ VN531
6_US_537796 (Asia)
6k_ VN_ D33
6l_ VN_ VN530
6l_ VN_ VN507
6_LA_LAOS382
6h_ VN_ VN085
6h_ VN_ VN004
6h_ FR_FR1
6j_ TH_ TH553
6_LA_LAOS250
6i_ TH_ EUTHD100
6i_ TH_ EUTHD60
6_TH_C159
6i_ TH_ TH555
6i_ TH_ TH602
6_ TH_ Th25
6_ TH_ Th26
6_LA_LAOS176
6_CN_GX004
6e_VN_ VN998
6d_ VN_ D53
6d_ VN_ D41
6d_ VN_ D88
6d_ VN_ D65
6d_ VN_ D94
6e_VN_ VN787
6d_ VN_ D26
6d_ VN_ D79
6d_ VN_ D60
6e_VN_ D82
6d_ VN_ D42
6e_VN_ VN843
6d_ VN_ D67
6_ VN_ D83
6_ VN_ D49
6_CA_C269 (Asia)
6_LA_LAOS350
6_ VN_ D85
6_LA_LAOS248
6_CA_QC227
6o_ VN_ VN4
6o_ CA_ QC30
6p_ VN_ VN12
6p_CA_QC216
6f_ TH_ EUTHD65
6f_ TH_ TH552
6_ TH_ Th52
6_TH_C046
6f_ TH_ TH976
6f_ TH_ EUTH36
6f_ TH_ TH571
6f_ TH_ EUTH7
6f_ TH_ EUTH13
6f_ TH_ TH271
6_LA_LAOS310
6_CA_C81 (Asia)
6q_CA_C99 (Cambodia)
6_CA_C197 (Asia)
6_LA_LAOS390
6_CA_C150 (Asia)
6_LA_LAOS344
6d_ VN_ VN235
6_LA_LAOS132
6c_ TH_ TH846
6g_ID_ JK046
6g_ID_ JK148
6_ CA_ QC66
1
0.99
subtype 6n
1
1
1
0.9
1
6k
1
1
1
6l
1
1
6h
1
I
1
1
1
0.9
1
1
0.99
subtype 6f
1
0.98
subtype 6o
1
1
subtypes 6d & 6e
1
subtype 6i
1
1
6g
1000 CE
1250 CE
1750 CE
1078
2000 CE
VOL. 83, 2009
GENETIC HISTORY OF HCV IN EAST ASIA
1079
125000
75000
50000
25000
1000
1100
1200
1300
1400 1500
Year (CE)
1600
1700
1800
1900
Effective population size × generation time
100000
2000
FIG. 6. Bayesian skyline plot, showing the epidemic history of genotype 6 estimated from the concatenated (core plus NS5B) data set (see text
for details). The thick black line represents the estimated effective population size through time. The gray area represents the 95% highest posterior
density confidence intervals for this estimate.
former is true for HCV, because the estimated covariance is
not significantly different from zero. Very similar COV and
covariance values were obtained under the other relaxed clock
models (combinations C, D, and F).
Figure 6 shows the BSP estimated from the concatenated
data set. The BSP is a flexible, nonparametric estimate of past
changes in effective population size (7). It is based on the
coalescent process, a population genetic model that describes
the relationship between the demographic history of a population and the ancestral relationships of sequences sampled
from it (explained further in reference 6). The most notable
feature of Fig. 6 is the change at the onset of the 20th century,
from a low and relatively constant effective population size to
rapid, epidemic growth. This change coincides with the onset
of rapid diversification in the lineages highlighted in Fig. 3. The
rate of growth appears to slow from the 1980s to the present,
matching the change in HCV transmission that followed the
virus’ isolation in 1989, although this recent decrease is not
statistically significant given the large confidence intervals.
However, BSPs should be interpreted carefully when, as in this
case, sequences have been sampled from a geographically
structured population (3). Specifically, the 20th century growth
phase shown in Fig. 5 was estimated from a heterogenous
collection of lineages, some of which show diversification during the 20th century and others which do not (Fig. 3). Consequently, the exponential growth rate during this recent phase
(i.e., between 1900 and 1980) (Fig. 6) is ⬃0.035 year⫺1, considerably lower than equivalent rates previously estimated for
more specific populations, such as genotype 4 in Egypt (⬃0.25
year⫺1 [44]), subtype 1b in China (⬃0.3 year⫺1 [34]), and
subtypes 1a and 3a in the United Kingdom and United States
(0.1 to 0.2 year⫺1 [45, 60]). The growth rate we have estimated
is therefore likely to reflect an average rate for the whole of
genotype 6 and should not be extrapolated to individual epidemic
subtypes, which will have spread comparatively faster. For example, the exponential growth rate of subtype 6a in Hong Kong has
been estimated at ⬃0.17 year⫺1 (60), in agreement with the population-specific and subtype-specific rates listed above.
Lastly, we undertook statistical tests for the presence of
phylogeographic structure, using the PS and AI statistics, as
implemented in the program BaTS (38). When all sequences
were labeled according to their country of origin, both statistics
strongly rejected the null hypothesis of panmixis (observed AI
of 3.9, expected AI of 11.04 [P ⬍ 0.0001]; observed PS of 31.6,
expected PS of 69.3 [P ⬍ 0.0001]). We also tested whether
isolates from the same country were clustered together on the
tree. Isolates from Vietnam, Thailand, and China showed
very strong phylogenetic clustering (AI statistic P ⬍ 0.0001;
PS statistic P ⬍ 0.0001). Isolates from Laos were also clustered but less significantly (AI, P ⫽ 0.01; PS, P ⫽ 0.04),
while isolates from Canada, which represent emigrants from
various Asian countries, were not significantly clustered (AI,
P ⬎ 0.5; PS, P ⬎ 0.5).
DISCUSSION
Taken together, our phylogenetic, geographic, and coalescent analyses provide a coherent picture of the epidemic history of hepatitis C virus in East Asia, which can be split into
two distinct phases, pre- and post-1900. It is currently thought
that HCV spread rapidly worldwide during the 20th century via
multiple transmission routes, including blood transfusion,
FIG. 5. The maximum clade support phylogeny of the concatenated (core plus NS5B) data set, obtained under the best-fitting model
(combination E). Branch lengths represent time (see time scale at the bottom of the figure). Posterior probability scores (⬎0.9) are shown next
to well-supported nodes. The shaded area corresponds to the 20th century, during which the lineages denoted by white circles showed rapid
diversification. See Fig. 2 for sequence naming details.
1080
PYBUS ET AL.
blood products, injection drug use, and unsafe medical injections (15). Our results demonstrate that the effect on genotype
6 of this explosion in transmission was to rapidly increase the
prevalence of some, but not all, preexisting lineages in areas of
endemicity, giving rise to many distinct clusters of sequences
(Fig. 5) that largely equate to the current HCV subtype definitions. As Fig. 2 and 3 show, these clusters are typically dominated by sequences from a single country (e.g., subtype 6d
from Vietnam or subtype 6q from Cambodia) or less often,
from two neighboring countries (e.g., subtype 6a from China/
Vietnam or subtype 6n from Thailand/Myanmar). Thus, both
the distinctive shape and the spatial structuring of the genotype
6 tree are products of the same underlying epidemiological
process.
The genotype 6 clusters highlighted in Fig. 2 can be described as “local epidemic” strains, which transmitted rapidly
during the 20th century in specific locations but did not spread
internationally in the manner of the “global epidemic” subtypes 1a, 1b, and 3a (56). It is therefore probable that local
epidemic lineages are characterized by transmission routes
that are different and more varied than the routes associated
with global epidemic subtypes. Local epidemic strains have
previously been noted in Africa, particularly subtype 4a in
Egypt, which has been associated with large-scale injectable
antischistosomiasis treatment campaigns (10, 44). Our results
indicate that local epidemic subtypes are also common to Asia.
Since it is reasonable to assume that similar epidemiological
factors have affected other HCV genotypes, we further argue
that all common HCV subtypes are the result of selective
amplification of endemic lineages, either locally or globally,
during the 20th century. This hypothesis can explain why HCV
subtypes contain unusually similar levels of genetic diversity
and why they are highly phylogenetically distinct.
In the context of the scenario described above, the pattern of
HCV genetic diversity in Laos is unusual, since there are no
discernible “20th century” clusters of Lao sequences (Fig. 4).
This is unlikely to be a sample size artifact, since smaller or
equivalent-sized samples from other countries are sufficient to
identify tight sequence clusters. Our phylogeographic analysis
indicates that the Lao strains are clustered, but less strongly
than strains from Vietnam, Thailand, or China. Five Lao isolates group together with the subtype 6b isolate TH580, but the
branching events in this cluster substantially predate the 20th
century (Fig. 4). Therefore, HCV in Laos appears to have been
less involved with whatever events amplified endemic genotype
6 lineages elsewhere in Asia; the low prevalence of HCV in
Laos (⬃1%) compared to nearby countries also supports this
notion (21, 69). Although we can only speculate on the reasons
for this, differences in health care infrastructure among countries may be important, particularly if iatrogenic and nosocomial transmission has contributed to Asian HCV spread. We
have been unable to find formal comparisons of investment in
public health campaigns (such as vaccinations and mass treatment with injectable drugs) during the first half of the 20th
century. However, the information available suggests that the
French colonial authorities in Laos invested less in such public
health campaigns than other mainland Southeast Asian countries (24, 55). In the second half of the 20th century Laos
suffered civil war, extraordinarily destructive aerial bombing by
the United States, and economic hardship in the wake of the
J. VIROL.
war and the 1975 revolution, resulting in relatively low investment in public health intervention until the mid-1990s. Furthermore, before the 1990s the country had few reliable transport links (49). Hence, it is possible that the Lao population
has experienced comparatively lower levels of mass exposure
to blood-borne viruses such as HCV.
Our analyses show that genotype 6 infections worldwide are
descended from a common ancestor that existed around 1,100
to 1,350 years earlier (95% credible region, 600 to ⬎2,500
years ago) (Fig. 4). This long time scale is based on extrapolation of HCV evolution observed over a much shorter time
span of about 25 years. Although there is no obvious reason
why HCV rates should significantly vary through time—and
our relaxed clock results suggest that they do not—we note
that such estimates should be interpreted cautiously and are
more likely to underestimate clade age than to overestimate it
(17).
Prior to the 20th century, HCV transmission in Asia appears
to have been characterized by long-term low-level infection in
areas of endemicity (Fig. 6). We currently have almost no
understanding of how stable, endemic transmission of HCV
can be maintained for many centuries (46) and no idea how the
virus spread across Asia from a common ancestor. Our results
do indicate that endemic genotype 6 lineages were historically
associated with different locations (e.g., subtype 6f in Thailand,
6g in Indonesia, 6d in Vietnam, and 6q in Cambodia), with
multiple genotype 6 lineages being present in modern-day
Vietnam, Thailand, and Laos (Fig. 5). In addition, the presence of old phylogenetic nodes that connect different countryspecific lineages (Fig. 2, 3, and 5) suggests that at least some
historical gene flow occurred. However, the significant spatial
structure we observed demonstrates that genotype 6 gene flow
is restricted. Furthermore, it appears to be limited by distance,
as sequences from pairs of nearby nonadjacent countries
(Thailand-Vietnam, Myanmar-Vietnam, Myanmar-Cambodia,
China-Cambodia, or China-Thailand) do not tend to cluster
with each other (Fig. 2 and 3). In contrast, isolates from Laos
group with strains from several neighboring countries, as expected given Laos’ geographically central position in mainland
Southeast Asia. Similarly, strains from Myanmar are often
found intermingled with those from neighboring Thailand. Of
course, historical patterns of movement may not be well represented by classifications based on current political borders.
The evolutionary models employed in our analyses included
a relaxed molecular clock that estimated the degree to which
the rate of molecular evolution varies across a phylogenetic
tree (8). The analyses indicated a larger-than-expected amount
of rate variation for HCV. Incorporating this rate heterogeneity increases the accuracy of our estimates (8) and the realism
of our analysis, and therefore we recommend that future phylogenetic analyses of HCV gene sequences use this, or a similar, approach. However, such methods cannot be reliably applied to small data sets or short sequences. It is common for
HCV molecular epidemiological surveys to produce short subgenomic fragments around 300 nt long, which by themselves
are insufficient to reliably estimate phylogenetic groupings (34,
52). The compromise solution used here was to increase statistical power by concatenating multiple subgenomic sequences, but at the expense of a reduction in the number of
available reference strains for comparison. Since viral se-
VOL. 83, 2009
GENETIC HISTORY OF HCV IN EAST ASIA
quences in databases can prove useful for many years after
their initial investigation, we encourage the standardization of
the subgenomic regions used and the production of longer
gene fragments per isolate.
21.
22.
ACKNOWLEDGMENTS
This research was directly supported by a 2006 Royal Society Research Grant to O.G.P. and P.K. E.B. is supported by the Medical
Research Council (United Kingdom), P.K., R.P., and P.N.N. are supported by The Wellcome Trust, and P.L. is supported by a Marie Curie
IEF fellowship. P.K. was funded by the NIHR Biomedical Research
Centre Programme and the James Martin School for the 21st Century.
The research in the Lao PDR was part of the Wellcome Trust-Mahosot Hospital-Oxford Tropical Medicine Research Collaboration,
funded by The Wellcome Trust.
We are very grateful to the participating patients, and to the doctors,
nurses, and technical staff of Mahosot Hospital: Vimone Soukkhaserm, Mayfong Mayxay, Nicholas J. White, Amphay Phyaluanglath, Somphone Phannouvong, Pathila Inthepphavong, and Martin
Stuart-Fox.
23.
24.
25.
26.
27.
28.
REFERENCES
1. Bukh, J., R. H. Purcell, and R. H. Miller. 1993. At least 12 genotypes of
hepatitis C virus predicted by sequence analysis of the putative E1 gene of
isolates collected worldwide. Proc. Natl. Acad. Sci. USA 90:8234–8238.
2. Candotti, D., J. Temple, F. Sarkodie, and J. Allain. 2003. Frequent recovery
and broad genotype 2 diversity characterize hepatitis C virus infection in
Ghana, West Africa. J. Virol. 77:7914–7923.
3. Carrington, C. V., J. E. Foster, O. G. Pybus, S. N. Bennett, and E. C. Holmes.
2005. Invasion and maintenance of dengue virus type 2 and type 4 in the
Americas. J. Virol. 79:14680–14687.
4. Centers for Disease Control and Prevention. 1998. Recommendations for
prevention and control of hepatitic C virus (HCV) infection and HCVrelated chronic disease. MMWR Recomm. Rep. 47(RR-19):1–39.
5. Chen, Y. D., M. Y. Liu, W. L. Yu, J. Q. Li, M. Peng, Q. Dai, X. Liu, and Z. Q.
Zhou. 2002. Hepatitis C virus infections and genotypes in China. Hepatobiliary Pancreat. Dis. Int. 1:194–201.
6. Drummond, A. J., O. G. Pybus, A. Rambaut, R. Forsberg, and A. G. Rodrigo.
2003. Measurably evolving populations. Trends Ecol. Evol. 18:481–488.
7. Drummond, A. J., A. Rambaut, B. Shapiro, and O. G. Pybus. 2005. Bayesian
coalescent inference of past population dynamics from molecular sequences.
Mol. Biol. Evol. 22:1185–1192.
8. Drummond, A. J., S. Y. Ho, M. J. Phillips, and A. Rambaut. 2006. Relaxed
phylogenetics and dating with confidence. PLoS Biol. 4:e88.
9. Drummond, A. J., and A. Rambaut. 2007. BEAST: Bayesian evolutionary
analysis by sampling trees. BMC Evol. Biol. 7:214.
10. Frank, C., M. K. Mohamed, G. T. Strickland, D. Lavanchy, R. R. Arthur,
L. S. Magder, T. El Khoby, Y. Abdel-Wahab, E. S. Aly Ohn, W. Anwar, and
I. Sallam. 2000. The role of parenteral antischistosomal therapy in the
spread of hepatitis C virus in Egypt. Lancet 355:887–891.
11. Fried, M. W., M. L. Shiffman, K. R. Reddy, C. Smith, G. Marinos, F. L.
Goncales, Jr., D. Haussinger, M. Diago, G. Carosi, D. Dhumeaux, A. Craxi,
A. Lin, J. Hoffman, and J. Lu. 2002. Peginterferon alfa-2a plus ribavirin for
chronic hepatitis C virus infection. N. Engl. J. Med. 347:975–982.
12. Gerlach, J. T., H. M. Diepolder, R. Zachoval, N. H. Gruener, M. C. Jung, A.
Ulsenheimer, W. W. Schraut, C. A. Schirren, M. Waechtler, M. Backmund,
and G. R. Pape. 2003. Acute hepatitis C: high rate of both spontaneous and
treatment-induced viral clearance. Gastroenterology 125:80–88.
13. Goedert, J. J., B. E. Chen, L. Preiss, L. M. Aledort, and P. S. Rosenberg.
2007. Reconstruction of the hepatitis C virus epidemic in the US hemophilia
population, 1940-1990. Am. J. Epidemiol. 165:1443–1453.
14. Reference deleted.
15. Hauri, A. M., G. L. Armstrong, and Y. J. Hutin. 2004. The global burden of
disease attributable to contaminated injections given in health care settings.
Int. J. STD AIDS 15:7–16.
16. Holmes, E. C. 2004. The phylogeography of human viruses. Mol. Ecol.
4:745–756.
17. Holmes, E. C. 2003. Molecular clocks and the puzzle of RNA virus origins.
J. Virol. 77:3893–3897.
18. Hoofnagle, J. H. 2002. Course and outcome of hepatitis C. Hepatology
36:S21–S29.
19. Hué, S., D. Pillay, J. P. Clewley, and O. G. Pybus. 2005. Genetic analysis
reveals the complex structure of HIV-1 transmission within defined risk
groups. Proc. Natl. Acad. Sci. USA 102:4425–4429.
20. Jeannel, D., C. Fretz, Y. Traore, N. Kohdjo, A. Bigot, E. P. Gamy, G.
Jourdan, K. Kourouma, G. Maertens, F. Fumoux, J. J. Fournel, and L.
Stuyver. 1998. Evidence for high genetic diversity and long-term endemicity
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
1081
of hepatitis C virus genotypes 1 and 2 in West Africa. J. Med. Virol. 55:
92⫺97.
Jutavijittum, P., A. Yousukh, B. Samountry, K. Samountry, A. Ounavong, T.
Thammavong, J. Keokhamphue, and K. Toriyama. 2007. Seroprevalence of
hepatitis B and hepatitis C virus infections among Lao blood donors. Southeast Asian J. Trop. Med. Public Health 38:674–679.
Kang, L. Y., Y. D. Sun, L. J. Hao, X. Y. Cao, and Q. C. Pan. 1997. Studies on
epidemiology of the population with HCV and HEV infections and their
epidemic factors in china. Chin. J. Infect. Dis. 15:71⫺75. [In Chinese.]
Kanistanon, D., M. Neelamek, T. Dharakul, and S. Songsivilai. 1997. Genotypic distribution of hepatitis C virus in different regions of Thailand.
J. Clin. Microbiol. 35:1772–1776.
Klauss, R. 1997. Laos: the case of a transitioning civil service system in a
transitional economy. Civil Service Systems in Comparative Perspective,
School of Public and Environmental Affairs, Indiana University, 5 to 8 April
1997. http://www.indiana.edu/⬃csrc/klauss1.html.
Kuiken, C., K. Yusim, L. Boykin, and R. Richardson. 2005. The Los Alamos
hepatitis C sequence database. Bioinformatics 21:379–384.
Lemey, P., A. Rambaut, and O. G. Pybus. 2006. HIV evolutionary dynamics
within and among hosts. AIDS Rev. 8:125–140.
Lu, L., T. Nakano, Y. He, Y. Fu, C. H. Hagedorn, and B. H. Robertson. 2005.
Hepatitis C virus genotype distribution in China: predominance of closely
related subtype 1b isolates and existence of new genotype 6 variants. J. Med.
Virol. 75:538–549.
Lu, L., C. Li, Y. Fu, F. Gao, O. G. Pybus, K. Abe, H. Okamoto, C. H.
Hagedorn, and D. Murphy. 2007. Complete genomes of hepatitis C virus
(HCV) subtypes 6c, 6l, 6o, 6p and 6q: completion of a full panel of genomes
for HCV genotype 6. J. Gen. Virol. 88:1519–1525.
Lwin, A. A., T. Shinji, M. Khin, N. Win, M. Obika, S. Okada, and N. Koide.
2007. Hepatitis C virus genotype distribution in Myanmar: predominance of
genotype 6 and existence of new genotype 6 subtype. Hepatol. Res. 37:337–
345.
Manns, M. P., J. G. McHutchison, S. C. Gordon, et al. 2001. Peginterferon
alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for
initial treatment of chronic hepatitis C: a randomised trial. Lancet 358:958–
965.
McOmish, F., P. Yap, B. Dow, E. Follett, C. Seed, A. Keller, T. Cobain, T.
Krusius, E. Kolho, and R. Naukkarinen. 1994. Geographical distribution of
hepatitis C virus genotypes in blood donors: an international collaborative
survey. J. Clin. Microbiol. 32:884–892.
Mellor, J., E. C. Holmes, L. M. Jarvis, P. L. Yap, and P. Simmonds. 1995.
Investigation of the pattern of hepatitis C virus sequence diversity in different geographical regions: implications for virus classification. J. Gen. Virol.
76:2493–2507.
Murphy, D. G., B. Willems, M. Deschenes, N. Hilzenrat, R. Mousseau, and
S. Sabbah. 2007. Use of sequence analysis of the NS5B region for routine
genotyping of hepatitis C virus with reference to C/E1 and 5⬘ untranslated
region sequences. J. Clin. Microbiol. 45:1102–1112.
Nakano, T., L. Lu, Y. He, Y. Fu, B. H. Robertson, and O. G. Pybus. 2006.
Population genetic history of hepatitis C virus 1b infection in China. J. Gen.
Virol. 87:73–82.
Nakano, T., L. Lu, P. Liu, and O. G. Pybus. 2004. Viral gene sequences
reveal the variable history of hepatitis C virus infection among countries.
J. Infect. Dis. 190:1098–1108.
Ndjomou, J., O. G. Pybus, and B. Matz. 2003. Phylogenetic analysis of
hepatitis C virus isolates indicates a unique pattern of endemic infection in
Cameroon. J. Gen. Virol. 84:2333–2341.
Noppornpanth, S., T. X. Lien, Y. Poovorawan, S. L. Smits, A. D. Osterhaus,
and B. L. Haagmans. 2006. Identification of a naturally occurring recombinant genotype 2/6 hepatitis C virus. J. Virol. 80:7569–7577.
Parker, J., A. Rambaut, and O. G. Pybus. 2008. Correlating viral phenotypes
with phylogeny: accounting for phylogenetic uncertainty. Infect. Genet. Evol.
8:239–246.
Perz, J. F., L. A. Farrington, C. Pecoraro, Y. J. F. Hutin, and G. L. Armstrong. 2004. Estimated global prevalence of hepatitis C virus infection. 42nd
Annu. Meet. Infect. Dis. Soc. Am., Boston, MA, 30 September to 3 October
2004. Infectious Diseases Society of America, Arlington, VA.
Pond, S. L., S. D. Frost, and S. V. Muse. 2005. HyPhy: hypothesis testing
using phylogenies. Bioinformatics 21:676–679.
Posado, D., and K. Crandall. 1998. MODELTEST: testing the model of
DNA substitution. Bioinformatics 14:817–819.
Prescott, L. E., P. Simmonds, C. L. Lai, N. K. Chan, I. Pike, P. L. Yap, and
C. K. Lin. 1996. Detection and clinical features of hepatitis C virus type 6
infections in blood donors from Hong Kong. J. Med. Virol. 50:168–175.
Pybus, O. G., M. A. Charleston, S. Gupta, A. Rambaut, E. C. Holmes, and
P. H. Harvey. 2001. The epidemic behavior of the hepatitis C virus. Science
292:2323–2325.
Pybus, O. G., A. J. Drummond, T. Nakano, B. H. Robertson, and A. Rambaut. 2003. The epidemiology and iatrogenic transmission of hepatitis C
virus in Egypt: a Bayesian coalescent approach. Mol. Biol. Evol. 20:381–387.
Pybus, O. G., A. Cochrane, E. C. Holmes, and P. Simmonds. 2005. The
1082
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
PYBUS ET AL.
hepatitis C virus epidemic among injecting drug users. Infect. Genet. Evol.
5:131–139.
Pybus, O. G., P. V. Markov, A. Wu, and A. Tatem. 2007. Investigating the
endemic transmission of the hepatitis C virus. Int. J. Parasitol. 37:839–849.
Ruggieri, A., C. Argentini, F. Kouruma, P. Chionne, E. D’Ugo, E. Spada, S.
Dettori, S. Sabbatani, and M. Rapicetta. 1996. Heterogeneity of hepatitis C
virus genotype 2 variants in West Central Africa (Guinea Conakry). J. Gen.
Virol. 77:2073–2076.
Salemi, M., and A. M. Vandamme. 2002. Hepatitis C virus evolutionary
patterns studied through analysis of full-genome sequences. J. Mol. Evol.
54:62⫺70.
Savada, A. M. (ed.). 1995. Laos: a country study, 3rd ed. Federal Research
Division, Library of Congress, U.S. Government Printing Office, Washington, DC.
Simmonds, P., E. C. Holmes, T. A. Cha, S. W. Chan, F. McOmish, B. Irvine,
E. Beall, P. L. Yap, J. Kolberg, and M. S. Urdea. 1993. Classification of
hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J. Gen. Virol. 74:2391⫺2399.
Simmonds, P. 2004. Genetic diversity and evolution of hepatitis C virus—15
years on. J. Gen. Virol. 85:3173–3188.
Simmonds, P., J. Bukh, C. Combet, G. Deleage, N. Enomoto, et al. 2005.
Consensus proposals for a unified system of nomenclature of hepatitis C
virus genotypes. Hepatology 42:962–973.
Slatkin, M., and W. P. Maddison. 1989. A cladistic measure of gene flow
measured from the phylogenies of alleles. Genetics 123:603⫺613.
Smith, D. B., S. Pathirana, F. Davidson, E. Lawlor, J. Power, P. L. Yap, and
P. Simmonds. 1997. The origin of hepatitis C virus genotypes. J. Gen. Virol.
78:321–328.
Stuart-Fox, M. 1997. A history of Laos. Cambridge University Press, Cambridge, United Kingdom
Stumpf, M. P. H., and O. G. Pybus. 2002. Genetic diversity and models of
viral evolution for the hepatitis C virus. FEMS Microbiol. Lett. 214:143–152.
Suchard, M. A., R. E. Weiss, and J. S. Sinsheimer. 2001. Bayesian selection
of continuous-time Markov chain evolutionary models. Mol. Biol. Evol.
18:1001–1013.
Swofford, D. L. 2000. PAUP*: phylogenetic analysis using parsimony (*and
other methods), version 4. Sinauer Associates, Sunderland, MA.
Tanaka, Y., K. Hanada, M. Mizokami, A. E. T. Yeo, J. Shih, T. Gojobori, and
H. J. Alter. 2002. A comparison of the molecular clock of hepatitis C virus in
the United States and Japan predicts that hepatocellular carcinoma incidence in the United States will increase over the next two decades. Proc.
Natl. Acad. Sci. USA 99:15584–15589.
Tanaka, Y., F. Kurbanov, S. Mano, E. Orito, V. Vargas, J. Esteban, M. Yuen,
J. VIROL.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
C. Lai, A. Kramvis, M. Kew, H. Smuts, S. Netesov, H. Alter, and M.
Mizokami. 2006. Molecular tracing of the global hepatitis C virus epidemic
predicts regional patterns of hepatocellular carcinoma mortality. Gastroenterology 13:703–714.
Tokita, H., H. Okamoto, F. Tsuda, P. Song, S. Nakata, T. Chosa, H. Iizuka,
S. Mishiro, Y. Miyakawa, and M. Mayumi. 1994. Hepatitis C virus variants
from Vietnam are classifiable into the seventh, eighth, and ninth major
genetic groups. Proc. Natl. Acad. Sci. USA 91:11022–11026.
Tokita, H., H. Okamoto, P. Luengrojanakul, K. Vareesangthip, T. Chainuvati, H. Iizuka, F. Tsuda, Y. Miyakawa, and M. Mayumi. 1995. Hepatitis C
virus variants from Thailand classifiable into five novel genotypes in the sixth
(6b), seventh (7c, 7d) and ninth (9b, 9c) major genetic groups. J. Gen. Virol.
76:2329–2335.
Tokita, H., H. Okamoto, H. Iizuka, J. Kishimoto, F. Tsuda, L. A. Lesmana,
Y. Miyakawa, and M. Mayumi. 1996. Hepatitis C virus variants from Jakarta,
Indonesia classifiable into novel genotypes in the second (2e and 2f), tenth
(10a) and eleventh (11a) genetic groups. J. Gen. Virol. 77:293–301.
Verbeeck, J., P. Maes, P. Lemey, O. G. Pybus, E. Wollants, E. Song, F.
Nevens, J. Fevery, W. Delport, S. Van der Merwe, and M. Van Ranst. 2006.
Investigating the origin and spread of hepatitis C virus genotype 5a. J. Virol.
80:4220–4226.
Wang, T. H., Y. K. Donaldson, R. P. Brettle, J. E. Bell, and P. Simmonds.
2001. Identification of shared populations of human immunodeficiency virus
type 1 infecting microglia and tissue macrophages outside the central nervous system. J. Virol. 75:11686⫺11699.
Wansbrough-Jones, M., E. Frimpong, B. Cant, K. Harris, M. Evans, and C.
Teo. 1998. Prevalence and genotype of hepatitis C virus infection in pregnant
women and blood donors in Ghana. Trans. R. Soc. Trop. Med. Hyg. 92:496–
499.
Williams, I. 1999. Epidemiology of hepatitis C in the United States. Am. J.
Med. 107(6B):2S–9S.
World Health Organization. 1997. Hepatitis C. Wkly. Epidemiol. Rec. 72:
65–72.
World Health Organization. 1999. Hepatitis C: global prevalence (update).
Wkly. Epidemiol. Rec. 74:425–427.
Xia, G. L., C. B. Liu, H. L. Cao, et al. 1996. Prevalence of hepatitis B and C
virus infections in the general Chinese population: results from a nationwide
cross-sectional seroepidemiologic study of hepatitis A, B, C, D and E virus
infections in China, 1992. Int. Hepatol. Commun. 5:62–73.
Zhou, D. X., J. W. Tang, I. M. Chu, J. L. Cheung, N. L. Tang, J. S. Tam, and
P. K. Chan. 2006. Hepatitis C virus genotype distribution among intravenous
drug user and the general population in Hong Kong. J. Med. Virol. 78:574–
581.