Article
The prevalence of Bartonella, hemoplasma, and Rickettsia felis infections
in domestic cats and in cat fleas in Ontario
Ali Kamrani, Valeria R. Parreira, Janice Greenwood, John F. Prescott
Abstract
The prevalence of persistent bacteremic Bartonella spp. and hemoplasma infections was determined in healthy pet cats in Ontario.
Blood samples from healthy cats sent to a diagnostic laboratory for routine health assessment over the course of 1 y were tested
for Bartonella spp. using both polymerase chain reaction (PCR) and blood culture, and for the presence of hemoplasma by
PCR. The overall prevalence of Bartonella spp. by PCR and by culture combined was 4.3% (28/646) [3.7% (24/646) Bartonella
henselae, 0.6% (4/646) Bartonella clarridgeiae]. The novel B. henselae PCR developed for this study demonstrated nearly twice the
sensitivity of bacterial isolation. The overall prevalence of hemoplasma was 4% (30/742) [3.3% (25/742) Candidatus Mycoplasma
haemominutum, 0.7% (5/742) Mycoplasma haemofelis]. There was no significant difference between the prevalence of infection
by season or by age (# 2 y, . 2 y). Candidatus Mycoplasma turicensis was identified, for the first time in Canada, in 1 cat. The
prevalence of Bartonella (58%) and hemoplasma (47% M. haemofelis, 13% M. haemominutum) in blood from a small sampling
(n = 45) of stray cats was considerably higher than that found in healthy pet cats.
The prevalence of Rickettsia felis in cat fleas was also assessed. A pool of fleas from each of 50 flea-infested cats was analyzed
for the presence of R. felis by PCR. Rickettsia felis was confirmed, for the first time in Canada, in 9 of the 50 samples. Therefore,
the prevalence of Bartonella and hemoplasma infection in healthy pet cats is relatively low. Further, the control of cat fleas is
important because of the public health significance of Bartonella and R. felis infection.
Résumé
La prévalence d’une bactériémie persistante à Bartonella spp. et d’une infection à hémoplasma a été déterminée dans une population de chats
en santé provenant de l’Ontario. Des échantillons sanguins de chat en santé envoyés à un laboratoire de diagnostic pour un bilan de santé de
routine durant une période d’une année ont été éprouvés pour Bartonella spp. par réaction d’amplification en chaîne par la polymérase (PCR)
et par hémoculture, et pour la présence d’hémoplasma par PCR. La prévalence globale de Bartonella spp. par PCR et culture combinés était
de 4,3 % (28/646) [3,7 % (24/646 Bartonella henselae, 0,6 % (4/646) B. clarridgeiae]. L’épreuve PCR développée pour la présente étude
avait une sensibilité presque le double de l’isolement bactérien. La prévalence globale d’hémoplasma était de 4 % (30/742) [3,3 % (25/742)
Candidatus Mycoplasma haemominutum, 0,7 % (5/742) M. haemofelis]. Il n’y avait pas de différence significative entre les prévalences
d’infection selon la saison ou le groupe d’âge (# 2 ans, . 2 ans). Candidatus Mycoplasma turicensis a été identifié chez un chat pour la
première fois au Canada. La prévalence de Bartonella (58 %) et d’hémoplasma (47 % M. haemofelis, 13 % M. haemominutum) dans le
sang d’un échantillonnage restreint (n = 45) de chats errants était considérablement plus élevée que chez des chats en santé.
La prévalence de Rickettsia felis chez des puces de chats a également été évaluée. Un pool de puces provenant de chacun de 50 chats
infestés par des puces a été analysé par PCR pour la présence de R. felis. La présence de R. felis a été confirmée pour la première fois au
Canada dans 9 des 50 échantillons. Ainsi, la prévalence d’infection par Bartonella et hémoplasma chez des chats en santé est relativement
faible. De plus, la maîtrise des puces de chat est importante compte tenu de l’impact sérieux en santé publique des infections par Bartonella
et R. felis.
(Traduit par Docteur Serge Messier)
Introduction
Healthy cats may be subclinical carriers of blood-borne bacterial
infections that are potentially serious zoonotic pathogens and which
may cause severe diseases in other cats. The genus Bartonella is
comprised of fastidious hemotropic bacteria that have been increasingly identified in a wide range of domestic and wild animals (1).
Domestic cats are the primary reservoir of 3 species of Bartonella,
B. henselae, B. clarridgeiae, and B. kohlerae (2–4), all of which may cause
various clinical manifestations in humans (4,5). Bartonella henselae is
the major causative agent of cat scratch disease (CSD) in immunocompetent people and of bacillary angiomatosis and hepatic peliosis
in patients with a defective immune system, especially those infected
with human immunodeficiency virus (HIV) (5,6). As a result of the
development of sensitive molecular techniques for the diagnosis of
Bartonella organisms in human patient tissue samples, and because
Department of Pathobiology, and Centre for Public Health and Zoonoses, University of Guelph, Guelph, Ontario N1G 2W1 (Kamrani, Parreira,
Prescott); Vita-Tech Laboratories, 1345 Denison Street, Markham, Ontario L3R 5V2 (Greenwood).
Address all correspondence to Dr. J.F. Prescott; telephone: (519) 824-4120, ext 54453; fax: (519) 824-5930; e-mail: [email protected]
Received September 6, 2007. Accepted January 8, 2008.
2008;72:411–419
The Canadian Journal of Veterinary Research
411
of the increasing numbers of patients with defective immune systems through HIV infection or the use of immunosuppressive drugs,
Bartonella spp. have emerged as agents of zoonotic infections (7). This
study is the first to use both blood culture and polymerase chain
reaction (PCR) to investigate the prevalence of Bartonella bacteremia
in both pet and stray domestic cats in Ontario.
Feline hemobartonellosis is a bacteremic infection in cats that may
be associated with severe hemolytic anemia. The etiologic agents of
this infection, Mycoplasma haemofelis and Mycoplasma haemominutum,
may cause severe hemolytic anemia, and subtle anemia or subclinical
infection, respectively, in cats (8). Candidatus Mycoplasma turicensis
is a recently recognized hemotropic mycoplasma, first identified
in 2005 in Switzerland in a cat with hemolytic anemia (9). This
study is the first to investigate the prevalence of the hemoplasmas,
including Candidatus Mycoplasma turicensis, in pet and stray cats
in Ontario.
Rickettsia felis is a recently recognized agent of flea-borne spotted
fever in humans (10–12). The cat flea is the major vector of this organism. In endemic areas of the United States, peri-urban opossums are
the major reservoir host of R. felis. The reservoir potential of cats has
yet to be determined, although experimental infection of cats with
R. felis has been demonstrated (13,14). One objective of this study
was to determine if R. felis is present in cat fleas in Canada.
Materials and methods
Blood samples
Blood from healthy domestic cats in southern Ontario was collected in tubes containing ehtylenediamine tetra-acetic acid (EDTA)
anticoagulant, and submitted to a laboratory (Vita-Tech Laboratories,
Markham, Ontario) as part of a routine “wellness” program for
cats. Care was taken to exclude samples from animals that were
either suspect or clinically ill. A convenience sampling method was
used, whereby approximately 45 cats . 2 years old, and 14–45 cats,
# 2 years old, were collected each month. A total of 742 samples
were collected over a period of 12 mo (April 2006 to March 2007).
Blood samples were also collected from 45 stray cats, found within
Wellington County, Ontario. Blood was stored at 270°C prior to
testing.
Cat fleas
Fleas were collected in the summer of 2006 from cats submitted for care to 3 local Humane Societies located in Guelph (n = 4),
Kitchener-Waterloo (n = 7), and Cambridge (n = 3). In addition,
fleas were collected from cats within the Wellington County area
(n = 36), and submitted to the Ontario Veterinary College for
teaching and research purposes. One flea sample consisted of
1–5 fleas pooled from each flea-infested cat. Fleas were identified as Ctenocephalides felis based on current taxonomic keys
(http://www.icb.usp.br/~marcelcp/Ctenocephalidesfelis.htm) and
stored in 70% ethanol prior to testing.
DNA extraction and PCR amplification
The DNA for PCR amplification was extracted from a 200 mL
aliquot of each EDTA-treated blood sample using a commercial
412
The Canadian Journal of Veterinary Research
kit (QIAamp DNA Blood Mini Kit; Qiagen, Mississauga, Ontario).
Purified DNA was eluted in 150 mL elution buffer and stored at
220°C. Pooled flea samples were prepared for DNA extraction by
first rinsing in sterile distilled water for 5 min at room temperature.
Each sample was macerated completely in a 1.5 mL microcentrifuge
tube using a sterile pipette tip. The DNA was extracted, according to
the manufacturer’s instructions, using the QIAamp DNA Blood Mini
Kit (Qiagen), eluted in 100 mL elution buffer and stored at 220°C. To
monitor the extraction process for any foreign DNA contamination,
a negative “DNA extraction” control, consisting of 200 mL sterile
phosphate buffered saline (pH 7.2, PBS), was included in each batch
of samples processed.
Various primer combinations, each targeting the 16S–23S rRNA
intergenic region of the genus Bartonella, were assessed for their
amplification efficiency of plasmid DNA containing the target
gene of B. henselae (ATCC 4988). Oligonucleotide sequences of each
primer are listed in Table I. The following primer combinations
were examined: primer pair JF 311/JR 473, as described by Jensen
et al (15); primer pair MF 321/MR 983, as described by Maggi
and Breitschwerdt (16); and, a novel combination of the primers
MF 321/JR 473. The PCR amplifications were performed in a 25 mL
reaction mix containing a ready-to-use PCR buffer that included a
proof-reading hot start DNA polymerase (Platinum PCR SuperMix
High Fidelity; Invitrogen, Burlington, Ontario), 0.3 pmol/mL of each
primer, and 2 mL DNA template (0.02 ng, plasmid DNA containing
B. henselae target gene). Use of proof-reading DNA polymerase on
Bartonella DNA when samples were extracted from blood, removed
some nonspecific amplification observed with Taq polymerase (data
not shown). Amplification conditions used in this assay consisted of
denaturation at 94°C for 2 min, 45 cycles of 30 s of denaturation at
94°C, 30 s of annealing at 58°C, 30 s of extension at 68°C, followed
by an additional cycle of 7 min extension at 68°C. The predicted size
of the amplicons resulting from this PCR reaction were calculated
to be 152 bp, 136 bp, 233 bp, 242 bp, and 187 bp for B. henselae,
B. clarridgeiae, B. elizabethae, B. vinsonii subsp. berkhoffii, and B. bovis,
respectively. The PCR amplification products were visualized by
ethidium bromide fluorescence after electrophoresis in a 3% agarose
gel. The primer pair MF 321/JR 473 was used in subsequent PCR
amplification of DNA isolated from feline blood and pooled flea
samples.
A single-step PCR assay first described by Jensen et al (17) was
used for the detection of the hemoplasmas. Oligonucleotide primer
sequences are listed in Table I. Since Candidatus M. turicensis has
the same amplicon size as M. haemofelis using this amplification
protocol, Candidatus M. turicensis-specific primers (Table I) were
used in a second PCR protocol on all M. haemofelis PCR-positive
cases identified. This second PCR amplifies a 1317 bp region of the
16S rRNA gene of Candidatus M. turicensis. For both PCR reactions
for hemoplasma detection, 2 mL of DNA template was added to
make a total 25 mL reaction mixture containing 0.8 pmol/mL of each
primer and a ready-to-use PCR mixture containing a proof-reading
hot-start DNA polymerase (Platinum PCR SuperMix High Fidelity,
Invitrogen). A touch-down PCR program was used: 95°C for 5 min,
35 cycles of 95°C for 30 s, 60°C to 50°C for 30 s/cycle (the annealing
temperature is decreased by 1°C every cycle until 50°C, after which
each cycle was for 30 s), 68°C for 2 min, and finally, 68°C for 10 min.
2000;64:0–00
Table I. Sequence of oligonucleotide primers used for PCR assays
Primer
(target gene)
JF 311
(16S–23S rRNA)
Nucleotide sequence 59-39
CCTTCGTTTCTCTTTCTTC
Organism detected
Bartonella spp.
JR 473
(16S–23S rRNA)
AACCAACTGAGCTACAAGCC
Bartonella spp.
(15)
MF 321
(16S–23S rRNA)
AGATGATGATCCCAAGCCTTCTGG
Bartonella spp.
(16)
MR 983
(16S–23S rRNA)
TGTTCTAACAACAATGATGATG
Bartonella spp.
(16)
HF (16S rRNA)
ACGAAAGTCTGATGGAGCAATA
Feline hemoplasma organisms
(17)
HR (16S rRNA)
ACGCCCAATAAATCCGRATAAT
Feline hemoplasma organisms
(17)
MTF
(16S rRNA)
GAACTGTCCAAAAGGCAGTTAGC
M. turicensis
(9)
MTR
(16S rRNA)
AGAAGTTTCATTCTTGACACAATTGAA
M. turicensis
(9)
CSF (gltA)
GGGGGCCTGCTCACGGCGG
Rickettsia spp.
(19)
CSR (gltA)
ATTGCAAAAAGTACAGTGAACA
Rickettsia spp.
(19)
OMF (rOmpB)
CCGCAGGGT TTGTAACTGC
Rickettsia spp.
(19)
OMR (rOmpB)
CCTTTTAGATTACCGCCTAA
Rickettsia spp.
(19)
The PCR amplification products were visualized by ethidium bromide fluorescence following electrophoresis in a 2% agarose gel.
The DNA extracts from pooled fleas and blood from stray cats
were amplified targeting 2 different genes of R. felis in 2 separate
reactions. The first pair of primers amplified a 381 bp sequence of
the citrate synthase (gltA) gene of the genus Rickettsia (Table I). The
second pair of primers amplified a 840 bp sequence of an outer membrane protein B gene (rOmpB) of R. felis (Table I). For both reaction
mixes, 5 mL of DNA template was added to make a total 25 mL volume of PCR reaction mix containing 13 PCR buffer (New England
Biolabs, Pickering, Ontario), 0.2 mM dNTPs (Roche Diagnostics
GmbH, Mannheim, Germany) 2.5 mM Mg21, 1 pmol/mL of each
primer and 1 U of Taq polymerase (New England Biolabs). The
PCR was carried out with an initial denaturation at 94°C for 3 min
followed by 40 cycles of denaturation at 94°C for 30 s, annealing at
50°C for 30 s, and elongation at 72°C for 30 s. The amplification was
completed with an additional elongation at 72°C for 7 min. The PCR
products were electrophoresed through 2% agarose gel and visualized, after ethidium bromide labelling, under UV light.
All PCR assays were carried out in a Model T Gradient thermocycler (Biometra, Göttingen, Germany). To avoid PCR amplification product carryover, DNA extraction, PCR reaction set-up,
and gel electrophoresis were each carried out in a different room.
Appropriate negative reagent controls and positive DNA plasmid
controls, containing the target gene of each relevant organism, were
included in each PCR assay.
DNA sequencing
To confirm the identity of PCR-amplified products, selected amplicons were sequenced (Guelph Molecular Supercentre, Laboratory
2000;64:0–00
Reference
(15)
Services Division, University of Guelph, Guelph, Ontario) using
an ABI Prism 3100 Genetic Analyzer, and the Big Dye Terminator
Reaction Kit (Version 3) (Applied Biosystems) with either universal or specific primers. Sequencing was performed directly on
amplicons resulting from PCR amplification using primers specific
for B. clarridgeiae, R. felis, or Candidatus M. turicensis. The PCR
products resulting from DNA amplification specific for B. henselae
were cloned into pGEM-T Easy vector (Promega; Fisher Scientific,
Nepean, Ontario) and sequenced. The obtained sequences were
compared to known sequences held in the GenBank database using
the nucleotide-nucleotide BLAST function.
Blood culture for Bartonella spp.
Initially, 2 culture methods were used for isolation of Bartonella.
The first was direct culture of 200 mL of each blood sample on Brain
Heart Infusion Agar (BHIA) (Difco, Detroit, Michigan, USA) with
5% chocolatized sheep blood (“chocolate agar”). Agar plates were
incubated at 35°C in a 5% CO2 water-saturated atmosphere for
6 wk. The DNA was extracted from suspect colonies (small, slow
growing) and sequences specific to Bartonella spp. were targeted
as described previously. The other method used was a novel liquid
medium, Bartonella-Alphaproteobacteria growth medium (BAPGM)
(18). A 200 mL aliquot of blood was inoculated into a tube containing
BAPGM. Each tube was cotton plugged and incubated for 12 d at
35°C in a 5% CO2, water-saturated, atmosphere. After incubation,
200 mL of the blood-inoculated medium was used for DNA extraction and amplification. In addition, 200 mL of the blood-inoculated
­liquid medium that had been incubated for 12 d was plated on BHIA
with 5% chocolatized sheep blood. The plates were then incubated
for another 12 d at 35°C, as described. The DNA was isolated from
The Canadian Journal of Veterinary Research
413
for 12 d at 35°C. The DNA was extracted from the BAPGM and tested
using the Bartonella spp. specific PCR. Aliquots of the inoculated
BAPGM media were subcultured onto chocolate agar for a further
12 d; this study was done in triplicate.
Statistical analysis
The association of categorical variables of age categories and
seasons of the year with each infection were tested by a chi-squared
or Fisher’s exact test. The level of significance was considered at
P , 0.05. All of the statistical analyses were carried out using statistical software (MINITAB, version 15.1; Minitab, State College,
Pennsylvania, USA).
Results
PCR assay for Bartonella detection
Various primer combinations, each targeting the 16S–23S rRNA
intergenic region of the genus Bartonella, were assessed for their
efficiency of amplification of plasmid DNA containing the target
gene of B. henselae. Based on band intensity, the novel combination
of the forward primer MF 321 and the reverse primer JR 473 (Table I)
(9,15–17,19) gave better amplification than the original combination
of MF 321 and MR 983 or JF 302 and JR 473 suggested by Maggi and
Breitschwerdt (16) and by Jensen et al (15), respectively (Figure 1),
and was therefore used throughout the study. The PCR was optimized for DNA template concentration and annealing temperature
(data not shown).
Results of PCR on blood from healthy cats
Figure 1. Comparison of the efficiency of the combination of primers
JF-JR and MF-JR. Lane A — amplification of a 170 bp PCR product of
16S–23S rRNA intergenic spacer region of B. henselae by primers JF-JR.
Lane B — amplification of a 152 bp PCR product of 16S–23S rRNA intergenic space of B. henselae by primers MF-JR. The same concentration of
the cloned plasmid has been used as a DNA template for both reactions.
L: 50 bp. Agarose gel 3%.
suspect colonies (small, slow growing) and tested in the PCR assay
for confirmation as Bartonella spp.
Comparison of the sensitivity of blood culture and
PCR for Bartonella detection
The sensitivity of PCR and of blood culture on solid or in liquid
media for detection of Bartonella spp. in blood was compared in the
following way. Colonies of an isolate of B. henselae made from one
of the cats in the study were suspended in 700 mL sterile PBS. After
homogenization of the suspension, 10-fold serial dilutions were
made in PBS until 1029; 200 mL of each dilution was used for DNA
extraction and PCR amplification using primers specific for Bartonella
spp. In addition, 200 mL of each dilution was plated on chocolate
agar. The number of colony-forming units for each dilution was
determined following 12 d incubation at 35°C. Furthermore, 200 mL
of each dilution was inoculated directly into BAPGM and incubated
414
The Canadian Journal of Veterinary Research
A total of 646 and 742 blood samples, from July 2006 to March 2007,
were tested by PCR for the presence of Bartonella and hemoplasma,
respectively. The overall results of specific PCR on blood samples
are shown in Table II, while the monthly results for PCR are given in
Table III. The prevalence of infection with Bartonella and hemoplasma
in different seasons is illustrated in Figure 2. There was no association between the presence of Bartonella spp. and of hemoplasma in
healthy cats (Fisher exact probability test: P = 0.42).
No association was found between age category, # 2 and . 2 years
old, for either infection (P = 0.064 for Fisher’s exact test for Bartonella
infection and P-value = 0.457 for Fisher’s exact test for hemoplasma
infection). No association was found between each infection and the
season of sampling (P = 0.36 for chi-squared test for Bartonella infection and P = 0.33 for chi-squared test for hemoplasma infection).
After applying Candidatus M. turicensis-specific PCR to all
M. haemofelis PCR-positive samples, 1 cat from the domestic pet
cat population yielded a PCR product consistent with the expected
Candidatus M. turicensis amplicon of approximately 1300 bp. The
sequenced PCR product was 99% identical to, and had the highest homology with, the 16S rRNA gene sequence of Candidatus
M. turicensis in GenBank (Accession number DQ464422.1).
Comparison of the sensitivity of culture and PCR
Comparison of the sensitivity of detection of Bartonella, which
had been serially diluted in saline, showed that PCR was up to
10 times more sensitive than culture on chocolate agar, and that PCR
2000;64:0–00
Table II. Results of specific PCR on DNA extracted from the blood of pet
and stray domestic cats, as well as fleas isolated from stray cats
Organism amplified
B. henselae
B. clarridgeiae
M. haemofelis
M. haemominutum
R. felis
Pet cat
3.2% (21/646)
0.6% (4/646)
0.6% (5/742)
3.3% (25/742)
N/A
Sample source
Stray cat
57.7% (26/45)
0
46.6% (21/45)
13% (6/45)
0
Fleas
90% (45/50)
12% (6/50)
10% (5/50)
56% (28/50)
18% (9/50)
Table III. Results of specific PCR and direct culture of blood in chocolate agar for the detection of Bartonella spp. in pet cats in
Ontario (April 2006 to March 2007)
Method, age category
Culture
B. henselae
# 2 years old
Apr
0/16
May
0/11
Jun
0/20
Jul
0/41
Number of positive samples identified per month
Aug
Sep
Oct
Nov
Dec
Jan
1/37 2/45 1/44 0/42 1/27 0/45
Feb
2/45
Mar
0/25
Total positive
7/398 (1.8%)
PCR
B. henselae
# 2 years old
N/A
N/A
N/A
2/43
2/37
5/45
N/A
2/43
1/28
0/45
2/45
1/25
15/311 (4.8%)
PCR
B. clarridgieae
# 2 years old
N/A
N/A
N/A
0/43
0/37
0/45
N/A
1/43
0/28
0/45
0/45
1/25
2/311 (0.6%)
Culture
B. henselae
. 2 years old
1/45
0/45
2/30
0/41
0/45
0/45
1/40
3/45
0/42
0/43
0/45
0/32
7/498 (1.4%)
PCR
B. henselae
. 2 years old
N/A
N/A
N/A
0/45
1/45
1/38
N/A
0/45
0/42
2/43
0/45
2/32
6/335 (1.8%)
PCR
B. clarridgieae
. 2 years old
N/A
N/A
N/A
0/45
1/45
1/38
N/A
0/45
0/42
0/43
0/45
0/32
2/335 (0.6%)
detected between 1 and 10 colony-forming units. The broth culture
medium BAPGM, which was subcultured on chocolate agar, was
found to be between 100 and 1000 times less sensitive than direct
culture on chocolate agar. Culture in BAPGM broth, followed by
DNA extraction and PCR analysis was found to be about 100 times
less sensitive than direct culture on chocolate agar. Because of the
toxicity of the BAGPM medium identified in the controlled sensitivity experiments, its use was discontinued after the first 200 blood
samples were cultured.
culture for B. henselae (Table III). Bartonella clarridgeiae was not isolated from any of the samples tested.
Results of blood culture on chocolate agar
Results of PCR on fleas
Initially 938 blood samples were cultured for Bartonella detection
from April 2006 to March 2007. Of these samples, 42 blood samples
were discarded because of contamination. There was no significant
association between Bartonella isolation and season (chi-squared test
1.15, P = 0.76), nor between Bartonella isolation and age (Fisher’s
exact probability test, P = 0.78). With the exception of 3 samples, all
blood samples positive by culture were also PCR positive. Direct
PCR on blood was found to be 1.7 times more sensitive than blood
Results of specific PCR on pooled flea samples are shown in
Table II. Using primers targeting the gltA gene of R. felis, 5 of
50 samples were identified as positive and confirmed to be positive by sequencing of the resulting amplicons In contrast, 9 of
50 samples were identified as being positive using primers targeting the rOmpB of R. felis. Sequencing of the amplicons showed 99%
homology to the rOmpB sequence of R. felis in GenBank (Accession
Number CP000053.1). Three samples that yielded PCR products
2000;64:0–00
Results of PCR on blood from stray cats
The results of PCR for Bartonella spp., hemoplasma, and R. felis
shown in Table II indicate the high prevalence of B. henselae (58%)
and the absence of B. clarridgeiae in these cats. The high prevalence of
M. haemofelis (47%) and its greater prevalence than M. haemoninutum
(13%) is also shown (Table II).
The Canadian Journal of Veterinary Research
415
Prevalence (%)
5
4
3
2
1
0
Summer
Fall
Winter
Seasons
B. haenselae
B. clarridgeiae
M. haemofelis
M. haemominutum
Figure 2. The prevalence of blood-borne infection in domestic cats in
Ontario from summer 2006 to winter 2007 detected by PCR. Summer was
defined as July to September, Fall as October to December, and Winter as
January to March.
of the size expected for B. henselae were cloned into pGEM-T Easy
vector, and sequenced. Resulting sequences shared 99% homology
to a 16S–23S rRNA ITS sequence of B. henselae Houston-1 strain in
GenBank (Accession Number BX897699.1). To confirm the identity
of PCR products identified as B. clarridgeiae, 2 samples were found to
be 98% identical to the 16S–23S rRNA ITS sequence of B. clarridgeiae
Houston-2 strain in GenBank (Accession Number AF312497).
Discussion
This is the first systematic study of the prevalence of Bartonella
spp. and hemoplasma infection in healthy cats in Ontario, and
the first to report the presence of R. felis in cat fleas in Canada.
The study also documents the uncommon presence of Candidatus
M. turicensis. There was a marked contrast between the relatively
low prevalence of these bacteremic infections in healthy pet cats
versus their high prevalence in stray cats, and a strikingly higher
frequency of M. haemofelis in stray cats than in pet cats. In contrast
to the blood from stray cats, the dominant hemoplasma species in
fleas was M. haemominutum, as it was in pet cats, but the prevalence
of B. henselae in fleas was similarly very high.
The PCR assay suggested by Jensen et al (15) for diagnosis of
bartonellosis has been widely used in various epidemiological
studies (20–23). The primers used may nonspecifically amplify the
ubiquitous organisms of Mesorhizobium spp., so that Maggi and
Breitschwerdt suggested that other primers be used (16). However
these primers amplify a region of B. henselae in which there are variable repeats, resulting in amplicons of unpredictable sizes (24). The
use of a novel combination of these primers (MF321/JR473) was
chosen for study in this investigation. These primers amplify the
most common veterinary-relevant Bartonella spp. but do not target
the variable repeat region of B. henselae, thus yielding PCR products
of predictable and consistent size. In addition, PCR using this novel
primer pair may be more sensitive for the detection of Bartonella spp.
in blood than other PCR assays reported.
For clinical samples, PCR detection of Bartonella spp. was almost
twice as sensitive as culture of blood samples on chocolate agar,
which was less than the sensitivity assessed using serially diluted
cultures. Since 3 culture-positive samples were missed by PCR, the
new PCR approach used here is not perfect, so that the best method
for diagnosis of Bartonella bacteremia may be a combination of PCR
416
The Canadian Journal of Veterinary Research
and culture (25). In some other studies, blood culture has been
shown to be more sensitive than PCR (25). Culture of blood would
intuitively be an optimal approach to diagnosis, because of the relatively large volumes of blood that can be assessed compared with
PCR. We observed that PCR was, surprisingly, more sensitive than
blood culture. The novel liquid culture medium (BAGPM) described
by Maggi et al (18) was, however, far less sensitive than culture of
blood in chocolate agar or direct PCR. Recently described changes
in BAPGM may have improved the sensitivity of this medium (25).
We isolated no B. clarridgeiae which underlines its difficulty of isolation (26).
The prevalence of bacteremia in healthy cats obtained in the present study was 3.8% and 1.6%, based on the PCR and culture methods, respectively, for a combined prevalence of 4.3%. It appears that
Bartonella bacteremia is uncommon in healthy pet cats in Ontario,
which may reflect the type of cats sampled as well as the geographic
location. Since these were animals in which blood profiles were being
analyzed for evidence of “wellness,” it is likely that these cats were
well cared for and would be unlikely to have fleas. It was, however,
impossible to obtain such details. In the United States, Guptill et al
(26) found 6%, 12%, 28%, and 33% prevalence rates for Bartonella
bacteremia in pet cats in Chicago, Washington DC, California, and
Florida, respectively. Since Ontario is most similar climatically to
Chicago, our findings are consistent with those of Guptill et al (26).
As in the present study, Guptill et al (26) observed no association
between Bartonella bacteremia and season of sampling. The prevalence of Bartonella bacteremia is significantly higher in regions with
higher average temperatures and humidity, favoring flea infestation,
than in regions with temperate climatic conditions (26). Flea infestation, age , 13 mo, and adoption from a shelter or as a stray cat all
appear to be significant risk factors for Bartonella bacteremia (27,28).
In the current study, although the prevalence of Bartonella bacteremia
was higher in the age group of # 2 years old, the difference was
not significant. Lappin et al (23) conducted a PCR-based study of
Bartonella species in 92 flea-infested cats in Alabama, Maryland, and
Texas, and found B. henselae in 32 (34.7%), B. clarridgeiae in 9 (20.6%),
and both species in 7 (7.6%) cats, suggesting an association between
fleas and bacteremia. Many studies have determined the prevalence
of Bartonella bacteremia in different countries. In the Netherlands,
22% of 113 cats were positive by blood culture (27). In France, 16.5%
of domestic cats in Paris were found to be bacteremic (28). In the
United Kingdom, 34 (9.4%) out of 360 cats sampled were bacteremic
(29). It is difficult to make direct comparisons with other studies
since variables such as climate, flea infestation, age, and source all
appear to influence the prevalence of bartonellosis.
The prevalence of Bartonella bacteremia in stray cats in Ontario
was remarkably high compared with pet cats. This finding is generally supported by the results of other studies (26) that suggest that
being a stray cat is a risk factor for bartonellosis (27,28,30). Although
a higher prevalence of Bartonella bacteremia has been reported from
tropical countries (31,32), the high prevalence of Bartonella infection
in the current study is striking, considering the differences in climatic
conditions in Ontario compared to tropical countries or the southern
United States. The prevalence of Bartonella infection in stray cats
probably reflects higher exposure to cat fleas, which are considered
the major route of Bartonella transmission between cats (26,28), and
2000;64:0–00
is supported by the very high prevalence of Bartonella spp. in cat
fleas in Ontario (Table II).
Numerous studies have determined the prevalence of hemoplasma
infection in healthy and diseased cats in different countries. In a
PCR-based study, Jensen et al (17) found an overall prevalence of
19.5% hemoplasma in a population of healthy and anemic cats in
the United States. Although similar numbers of anemic and nonanemic cats were infected with M. haemominutum, significantly higher
numbers of anemic cats were infected with M. haemofelis. In a PCRbased study of healthy and diseased cats from Saskatchewan and
Alberta (33), most cats with regenerative anemia were infected with
M. haemofelis rather than M. haemominutum. In the United Kingdom,
Tasker et al (34) found the overall prevalence of hemoplasma infection in healthy and sick cats to be 18.5% but, in contrast with the
results of Jensen et al (17), most sick-anemic cats were infected with
M. haemominutum rather than M. haemofelis. In a study of 92 healthy
cats in the United States (23), 7.6% and 21.7% were infected with
M. haemofelis and M. haemominutum, respectively. The prevalence
of hemoplasma infection in healthy cats in the current study was
low, consistent with our earlier speculation that these cats would
be unlikely to be exposed to risk factors for hemoplasma infection, and M. haemoninutum was more common in healthy cats than
M. haemofelis, a finding consistent with that of most previous studies.
By contrast, the prevalence of hemoplasma infection in the stray
cats was considerably higher. This may reflect the likelihood that
being a stray implies a greater probability of flea-infestation and
of fighting, but no details were available to support this speculation. Besides the high prevalence, a second striking feature in stray
cats was the relatively high prevalence of M. haemofelis compared
to M. haemominutum. One explanation might be the ability of
M. haemofelis to produce prolonged bacteremia than M. haemominutum and Candidatus M. turicensis (35).
Candidatus Mycoplasma turicensis was recently discovered in a
Swiss cat with severe hemolytic anemia (9). In the current study,
one presumptively M. haemofelis PCR-positive samples was found to
be Candidatus M. turicensis, the first time this has been reported in
North America. In a study of 713 healthy and ill cats of Switzerland,
Willi et al (35) later reported a 1.1% infection rate for Candidatus
M. turicensis, all from ill cats. An infection rate for Candidatus
M. turicensis of 2.3%, 10% and 26% was observed in a sample of
healthy and ill cats in the United Kingdom, Australia, and ill cats
of South Africa (36). The current study suggests that the infection is
uncommon in cats in Ontario.
Rickettsia felis was identified here in cat fleas for the first time in
Canada. Others have found somewhat similar or higher infection
rates elsewhere (10,37,38). The PCR based on the rOmpB gene was
twice as sensitive as that based on the gltA gene. Despite the high
prevalence of Bartonella and hemoplasma infection, no stray cat
blood was PCR positive for R. felis. Natural infection of cats with
this organism has not been reported. Besides opossums, which are
the reservoir of this organism in North America, it is believed that
fleas are the main reservoir for R. felis, since vertical transmission of
this organism has been reported (14). Experimental infection studies
suggest that cats may naturally be infected by R. felis, but that the
period of bacteremia is short (13). The current study supports the
conclusion that R. felis bacteremia in cats is rare. In people, although
2000;64:0–00
this organism usually causes subclinical or mild “flu-like” symptoms, serious or even fatal infections especially in elderly and young
people have been reported (11,12). The presence of this organism in
cat fleas in Ontario underlines the need for flea control in domestic
cats and for physicians to consider this infection in people presented
with febrile illness and flea bites.
Bartonella DNA was amplified from 49 of the 50 flea pools, including 43 infected with B. henselae, 4 with B. clarridgeiae, and 2 that were
dually infected. This is higher than observed elsewhere (23,37,39).
The relatively high prevalence of infection of cat fleas in the current
study might relate to differences in sensitivity of the PCR assays
used in these studies. The infection rates for hemoplasma in pooled
fleas (33 of 50, 10% and 56% for M. haemofelis and M. haemominutum)
are higher than the rates obtained in similar studies by Shaw et al
(37) (49%, all M. haemominutum) and Lappin et al (23) (M. haemofelis
3.3%, and M. haemominutum 23.9%), but the higher prevalence of
M. haemominutum is similar. Since fleas are hematophagous, the
detection of pathogen DNA in fleas may reflect the existence of
these infections in their hosts as well, but the prevalence of infection
in the source cats was not determined. However the conclusion is
that cats infested with C. felis must be exposed to a combination of
flea-associated bacterial organisms, and that these may be present
at high prevalence in fleas.
Acknowledgments
The authors thank the Ontario Veterinary College’s Pet Trust
for financial support. We are also grateful to Drs. A. Abrams-Ogg,
H. Cai, and C. Ribble for discussions during the course of this work,
and to Drs. K.R. Macaluso and B. Willi for provision of control DNA
from R. felis and M. turicensis. Dr. H. Cai kindly provided control
DNA from M. haemofelis and M. haemominutum. Dr. D. Bienzle provided blood from the stray cats. The authors also thank the Humane
Societies of Cambridge, Kitchener, and Guelph for assistance with
obtaining cat fleas.
References
1. Breitschwerdt EB, Kordick DL. Bartonella infection in animals:
Carriership, reservoir potential, pathogenicity, and zoonotic
potential for human infection. Clin Microbiol Rev 2000;13:
428–438.
2. Koehler JE, Glaser CA, Tappero JW. Rochalimaea henselae infection.
A new zoonosis with the domestic cat as reservoir. J Am Med
Assoc 1994;27:531–535.
3. Kordick DL, Hilyard CEJ, Hadfield TL, et al. Bartonella clarridgeiae, a newly recognized zoonotic pathogen causing inoculation
papules, fever, and lymphadenopathy (cat scratch fever). J Clin
Microbiol 1997;35:1813–1818.
4. Avidor B, Graidy M, Efrat G, et al. Bartonella koehlerae, a new
cat-associated agent of culture-negative human endocarditis.
J Clin Microbiol 2004;42:3462–3468.
5. Anderson BE, Neuman MA. Bartonella spp. as emerging human
pathogens. Clin Microbiol Rev 1997;10:203–219.
6. Arvand M, Wendt C, Regnath T, Ullrich R, Hahn H. Characteriza­
tion of Bartonella henselae isolated from bacillary angiomatosis
The Canadian Journal of Veterinary Research
417
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
lesions in a human immunodeficiency virus-infected patient in
Germany. Clin Infect Dis 1998;26:1296–1299.
Boulouis HJ, Chang CC, Henn H, Kasten RW, Chomel BB. Factors
associated with the rapid emergence of zoonotic Bartonella infections. Vet Res 2005;36:383–410.
Sykes JE. Feline hemotropic mycoplasmosis (feline hemobartonellosis). Veterinary Clinics of North America, Small Animal
Practice 2003;33:773–789.
Willi B, Boretti FS, Cattori V, et al. Identification, molecular
characterization, and experimental transmission of a new hemoplasma isolate from a cat with hemolytic anemia in Switzerland.
J Clin Microbiol. 2005;43:2581–2585.
Marquez FJ, Muniain MA, Rodriguez-Liebana JJ, Del Toro MD,
Bernabeu-Wittel M, Pachon AJ. Incidence and distribution
pattern of Rickettsia felis in peridomestic fleas from Andalusia,
southeast Spain. Ann N Y Acad Sci 2006;1078:344–346.
Oliveira RP, Galvão MAM, Mafra CL, et al. Rickettsia felis
in Ctenocephalides spp. fleas, Brazil. Emerg Infect Dis 2002;8:
317–319.
Richter J, Fournier PE, Petridou J, Häussinger D, Raoult D.
Rickettsia felis infection acquired in Europe and documented by
polymerase chain reaction. Emerg Infect Dis. 2002;8:207–208.
Wedincamp J, Jr, Foil LD. Infection and seroconversion of cats
exposed to cat fleas (Ctenocephalides felis bouché) infected with
Rickettsia felis. J Vector Ecol 2000;25:123–126.
Boostrom A, Beier MS, Macaluso JA, et al. Geographic association
of Rickettsia felis-infected opossums with human murine typhus,
Texas. Emerg Infect Dis 2002;8:549–554.
Jensen WA, Fall MZ, Rooney J, Kordick DL, Breitschwerdt
EB. Rapid identification and differentiation of Bartonella species using a single-step PCR assay. J Clin Microbiol 2000;38:
1717–1722.
Maggi RG, Breitschwerdt EB. Potential limitations of the 16S-23S
rRNA intergenic region for molecular detection of Bartonella
species. J Clin Microbiol 2005;43:1171–1176.
Jensen WA, Lappin MR, Kamkar S, Reagan WJ. Use of a polymerase chain reaction assay to detect and differentiate two
strains of Haemobartonella felis in naturally infected cats. Am J Vet
Res 2001;62:604–608.
Maggi RG, Duncan AW, Breitschwerdt EB. Novel chemically
modified liquid medium that will support the growth of seven
Bartonella species. J Clin Microbiol 2005;43:2651–2655.
Rolain JM, Franc M, Davoust B, Raoult D. Molecular detection
of Bartonella quintana, B. koehlerae, B. henselae, B. clarridgeiae,
Rickettsia felis, and Wolbachia pipientis in cat fleas, France. Emerg
Infect Dis 2003;9:338–342.
Pons I, Sanfeliu I, Quesada M, et al. Prevalence of Bartonella
henselae in cats in Catalonia, Spain. Am J Trop Med Hyg 2005;72:
453–457.
Hackett TB, Jensen WA, Lehman TL, et al. Prevalence of DNA
of Mycoplasma haemofelis, ‘Candidatus Mycoplasma haemominutum’, Anaplasma phagocytophilum, and species of Bartonella,
Neorickettsia, and Ehrlichia in cats used as blood donors in the
United States. J Am Vet Med Assoc 2006;229:700–705.
Ishak AM, Radecki S, Lappin MR. Prevalence of Mycoplasma
haemofelis, ‘Candidatus Mycoplasma haemominutum,’ Bartonella
418
The Canadian Journal of Veterinary Research
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
species, Ehrlichia species, and Anaplasma phagocytophilum
DNA in the blood of cats with anemia. J Feline Med Surg 2007;
9:1–9.
Lappin MR, Griffin B, Brunt J, et al. Prevalence of Bartonella
species, haemoplasma species, Ehrlichia species, Anaplasma
phagocytophilum, and Neorickettsia risticii DNA in the blood of
cats and their fleas in the United States. J Feline Med Surg 2006;
8:85–90.
Dillon B, Iredell J, Breitschwerdt EB, Maggi RG. Potential limitations of the 16S-23S rRNA intergenic region for molecular detection of Bartonella species. J Clin Microbiol 2005;43:4921–4922.
Duncan AW, Maggi RG, Breitschwerdt EB. A combined approach
for the enhanced detection and isolation of Bartonella species
in dog blood samples: Pre-enrichment liquid culture followed
by PCR and subculture onto agar plates. J Microbiol Methods
2007;69:273–281.
Guptill L, Wu CC, HogenEsch H, et al. Prevalence, risk factors, and genetic diversity of Bartonella henselae infections in
pet cats in four regions of the United States. J Clin Microbiol
2004;42:652–659.
Bergmans AM, de Jong CM, van Amerongen G, Schot CS,
Schouls LM. Prevalence of Bartonella species in domestic cats in
The Netherlands. J Clin Microbiol 1997;35:2256–2261.
Gurfield AN, Boulouis HJ, Chomel BB, et al. Epidemiology of
Bartonella infection in domestic cats in France. Vet Microbiol
2001;80:185–198.
Birtles RJ, Laycock G, Kenny MJ, Shaw SE, Day MJ. Prevalence
of Bartonella species causing bacteraemia in domesticated and
companion animals in the United Kingdom. Vet Rec 2002;
151:225–229.
Fabbi M, De Giuli L, Tranquillo M, Bragoni R, Casiraghi M,
Genchi C. Prevalence of Bartonella henselae in Italian stray cats:
Evaluation of serology to assess the risk of transmission of
Bartonella to humans. J Clin Microbiol 2004;42:264–268.
Chomel BB, Carlos ET, Kasten RW, et al. Bartonella henselae
and Bartonella clarridgeiae infection in domestic cats from the
Philippines. Am J Trop Med Hyg 1999;60:593–597.
Marston EL, Finkel B, Regnery RL, et al. Prevalence of Bartonella
henselae and Bartonella clarridgeiae in an urban Indonesian cat
population. Clin Diagn Lab Immunol 1999;6:41–44.
Kewish KE, Appeleyard GD, Myers L, Kidney BA, Jackson ML.
Mycoplasma haemofelis and Mycoplasma haemominutum detection
by polymerase chain reaction in cats from Saskatchewan and
Alberta. Can Vet J 2004;45:749–752.
Tasker S, Binns SH, Day MJ, et al. Use of a PCR assay to assess
the prevalence and risk factors for Mycoplasma haemofelis and
‘Candidatus Mycoplasma haemominutum’ in cats in the United
Kingdom. Vet Rec 2003;152:193–198.
Willi B, Boretti FS, Baumgartner C, et al. Prevalence, risk factor analysis, and follow-up of infections caused by three feline
hemoplasma species in cats in Switzerland. J Clin Microbiol 2006;
44:961–969.
Willi B, Tasker S, Boretti FS, et al. Phylogenetic analysis of
“Candidatus Mycoplasma turicensis” isolates from pet cats in the
United Kingdom, Australia, and South Africa, with analysis of
risk factors for infection. J Clin Microbiol 2006;44:4430–4435.
2000;64:0–00
37. Shaw SE, Kenny MJ, Tasker S, Birtles RJ. Pathogen carriage by
the cat flea Ctenocephalides felis (Bouche) in the United Kingdom.
Vet Microbiol 2004;102:183–188.
38. Schloderer D, Owen H, Clark P, Stenos J, Fenwick SG.
Rickettsia felis in fleas, Western Australia. Emerg Infect Dis
2006;12:841–843.
2000;64:0–00
39. Kelly PJ, Meads N, Theobald A, Fournier PE, Raoult D. Rickettsia
felis, Bartonella henselae, and B. clarridgeiae, New Zealand. Emerg
Infect Dis 2004;10:967–968.
The Canadian Journal of Veterinary Research
419