Regulation of apical H+-ATPase activity and intestinal
HCO 3− secretion in marine fish osmoregulation
S. Guffey, A. Esbaugh and M. Grosell
Am J Physiol Regul Integr Comp Physiol 301:R1682-R1691, 2011. First published 24 August 2011;
doi:10.1152/ajpregu.00059.2011
You might find this additional info useful...
This article cites 41 articles, 25 of which can be accessed free at:
http://ajpregu.physiology.org/content/301/6/R1682.full.html#ref-list-1
Updated information and services including high resolution figures, can be found at:
http://ajpregu.physiology.org/content/301/6/R1682.full.html
Additional material and information about American Journal of Physiology - Regulatory, Integrative
and Comparative Physiology can be found at:
http://www.the-aps.org/publications/ajpregu
American Journal of Physiology - Regulatory, Integrative and Comparative Physiology publishes original investigations that
illuminate normal or abnormal regulation and integration of physiological mechanisms at all levels of biological organization,
ranging from molecules to humans, including clinical investigations. It is published 12 times a year (monthly) by the American
Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2011 by the American Physiological Society.
ISSN: 0363-6119, ESSN: 1522-1490. Visit our website at http://www.the-aps.org/.
Downloaded from ajpregu.physiology.org on December 5, 2011
This infomation is current as of December 5, 2011.
Am J Physiol Regul Integr Comp Physiol 301: R1682–R1691, 2011.
First published August 24, 2011; doi:10.1152/ajpregu.00059.2011.
Regulation of apical H⫹-ATPase activity and intestinal HCO⫺
3 secretion
in marine fish osmoregulation
S. Guffey, A. Esbaugh, and M. Grosell
Rosenstiel School of Marine and Atmospheric Sciences, University of Miami, Miami, Florida
Submitted 28 January 2011; accepted in final form 22 August 2011
water absorption; posterior intestine; pH-stat titration; salinity; ion
transport
MARINE TELEOST FISHES CONTINUOUSLY lose fluids, because they
maintain body fluid concentrations far below that of seawater.
To compensate, fishes drink seawater and absorb ions (predominantly Na⫹ and Cl⫺) and water along the gastrointestinal
tract, eliminating ions at the gill and kidney (4, 19, 29). The
composition of ingested seawater changes as it traverses the
gut, and fluid reaching the intestine is nearly isosmotic, although with a chemical composition much different from
extracellular fluids. The major routes for NaCl absorption in
the intestine have long been attributed to Na⫹-Cl⫺ cotransport
and Na⫹-K⫹-2Cl⫺ cotransport driven indirectly by basolateral
Na⫹-K⫹-ATPase (6, 8, 12, 13); however, ion flux measurements show Cl⫺ uptake rates in excess of Na⫹ uptake (1, 6, 11,
13), with this excess Cl⫺ absorption being accomplished by
apical anion exchange (11, 14, 40). In some cases, up to 70%
of Cl⫺ absorption in the intestine occurs as a result of Cl⫺/
Address for reprint requests and other correspondence: S. Guffey, 278
Science & Admin Bldg., Rosenstiel School of Marine and Atmospheric
Science, Miami, FL 33149 (e-mail: [email protected]).
R1682
HCO⫺
3 exchange mediated by the anion-exchange protein
SLC26a6 (6, 11, 12, 16, 22, 28), rather than by cotransporters.
This anion-exchange mechanism has the dual purpose of absorbing Cl⫺ and precipitating CaCO3 and MgCO3 in the
intestinal lumen, thereby reducing potential Ca2⫹ uptake and
lowering the osmotic concentration of the luminal fluids as
much as 70 –100 mosmol/kg (14, 34, 39, 40). The absorption of
Cl⫺ and the precipitation reaction contribute to solute-coupled
and diffusive water absorption, respectively (12, 13, 34).
Recent evidence has demonstrated the presence of a vacuolar-type (V) H⫹-ATPase, or H⫹ pump, on the apical membrane
of the intestinal epithelium of marine fishes (8, 12). Acid
secretion into the luminal fluid has been proposed to titrate
⫺
⫺
HCO⫺
3 and, thereby, enhance further Cl /HCO3 exchange and
water absorption (12). The existence of an apical H⫹ pump in
intestinal cells has been demonstrated in toadfish, killifish, and
rainbow trout and suggested in European flounder (8, 9, 12, 34,
41). The various transport processes in the gastrointestinal tract
cause large changes in the composition of the luminal fluid as
it passes through different sections of the gut. Up to 85% of
ingested water can be absorbed, resulting in high luminal
concentrations of Mg2⫹ and SO2⫺
4 , as these ions are not
absorbed by the intestine, and high HCO⫺
3 due to continued
secretion via Cl⫺/HCO⫺
3 exchange (11, 37). The progressive
change in chemical conditions likely favors different transport
mechanisms in different segments of the gut. Investigations
into the pyloric ceca, anterior intestine, and rectum have
revealed differences in transepithelial electrical potential
(TEP), electrical conductance, and HCO⫺
3 secretion rates
among these tissues, along with large variations in expression
of the SLC26a6, cytosolic carbonic anhydrase (CAc), Na⫹⫹
HCO⫺
3 cotransporter (NBC), and H pump genes (5, 8, 12, 27,
30). The anterior intestine appears to be the main site of Cl⫺
absorption, as evidenced by high conductance, ion flux rates,
and anion-exchange rates (5, 8, 11, 12), although the pyloric
ceca and other portions of the intestine may also be important
contributors (8).
The present investigation assesses the role of the posterior
segment of the intestine in maintaining ion and water balance
in an unfed marine fish, with particular regard to regulation of
⫹
HCO⫺
3 secretion and the apical H -ATPase in response to
increased salinity. During exposure to hypersalinity, increased
luminal Cl⫺ concentration in the anterior intestine is matched
by increased Cl⫺ uptake, likely through Cl⫺/HCO⫺
3 exchange;
however, luminal concentration of HCO⫺
3 does not increase as
much as Cl⫺, indicating the involvement of additional processes (5, 19). Increased luminal HCO⫺
3 and decreased luminal
Cl⫺ in the posterior intestine, along with increased osmotic
pressure in the luminal fluid, would reduce the favorability of
Cl⫺ and water absorption, in which case titration of luminal
⫹
HCO⫺
pumping would be advantageous (5, 19).
3 via H
0363-6119/11 Copyright © 2011 the American Physiological Society
http://www.ajpregu.org
Downloaded from ajpregu.physiology.org on December 5, 2011
Guffey S, Esbaugh A, Grosell M. Regulation of apical H⫹-ATPase
activity and intestinal HCO⫺
3 secretion in marine fish osmoregulation. Am
J Physiol Regul Integr Comp Physiol 301: R1682–R1691, 2011. First
published August 24, 2011; doi:10.1152/ajpregu.00059.2011.—The absorption of Cl⫺ and water from ingested seawater in the marine fish
intestine is accomplished partly through Cl⫺/HCO⫺
3 exchange. Recently, a H⫹ pump (vacuolar-type H⫹-ATPase) was found to secrete
acid into the intestinal lumen, and it may serve to titrate luminal
⫺
⫺
HCO⫺
3 and facilitate further Cl /HCO3 exchange, especially in the
posterior intestine, where adverse concentration gradients could limit
⫹
Cl⫺/HCO⫺
pump is expressed in all intestinal
3 exchange. The H
segments and in gill tissue of gulf toadfish (Opsanus beta) maintained
in natural seawater. After acute transfer of toadfish to 60 ppt salinity,
H⫹ pump expression increased 20-fold in the posterior intestine. In
agreement with these observations was a fourfold-increased H⫹ATPase activity in the posterior intestine of animals acclimated to 60
ppt salinity. Interestingly, Na⫹-K⫹-ATPase activity was elevated in
the anterior intestine and gill, but not in the posterior intestine. Apical
acid secretion by isolated intestinal tissue mounted in Ussing chambers fitted with pH-stat titration systems increased after acclimation to
hypersalinity in the anterior and posterior intestine, titrating ⬎20% of
secreted bicarbonate. In addition, net base secretion increased in
hypersalinity-acclimated fish and was ⬃70% dependent on serosal
HCO⫺
3 . Protein localization by immunohistochemistry confirmed the
presence of the vacuolar-type H⫹-ATPase in the apical region of
intestinal enterocytes. These results show that the H⫹ pump, especially in the posterior intestine, plays an important role in hypersaline
osmoregulation and that it likely has significant effects on HCO⫺
3
accumulation in the intestinal lumen and, therefore, the continued
absorption of Cl⫺ and water.
R1683
PROTON SECRETION IN THE FISH INTESTINE
Accordingly, this study also examines the effect of acclimation
to hypersalinity on the anterior and posterior intestine. The first
objective was to determine whether the H⫹-ATPase is regulated in response to osmotic challenges. It was hypothesized
that the response of the H⫹-ATPase would be most pronounced in the posterior intestine because of the accumulation
⫺
of HCO⫺
in luminal fluids contained
3 and depletion of Cl
therein. In addition, recent findings of high CAc expression in
the posterior intestine (27) suggest a need for acid secretion
due to high rates of CO2 hydration and imply that hydration of
endogenous CO2 is an important source of HCO⫺
3 for secretion
in the posterior intestine, a suggestion that was also tested in
the present study.
METHODS
AJP-Regul Integr Comp Physiol • VOL
Primer
Degenerate
Forward
Reverse
RACE
Forward
Nested-forward
Reverse
Nested-reverse
18S
Forward
Reverse
VHA
Forward
Reverse
Sequence, 5=-3=
Product
Size, bp
CNGCNATGGGNGTNAACATGG
GNGGRTARATCTGTCKGTTRTG
GGTGAACATGGAAACAGCCCGT
GACTACAGCCGAGTACCTGG
AGATCTGTCGGTTGTGCAGC
ATGTAGCCAGGGAAGCCTCG
GCTCGTAGTTGGATCTCGG
GGCCTGCTTTGAACACTC
CTACAGCCGAGTACCTGGCCT
CGCGTTCATAGATGGTGGCCAAATC
166
1,515
RACE, rapid amplification of cDNA ends; VHA, vacuolar-type H⫹-ATPase.
The effect of hypersalinity on V-H⫹-ATPase mRNA expression in
the gut and gill was examined using quantitative PCR (qPCR).
Reactions included 1 ␮l of template cDNA (diluted 1:10 for the
ATPase and 1:10,000 for 18S rRNA control gene), 0.5 ␮l of forward
and reverse primers, 6.25 ␮l of Brilliant SYBR Green qPCR Master
Mix (Stratagene, La Jolla, CA), and 4.75 ␮l of pure water for a total
reaction volume of 12.5 ␮l. For the V-H⫹-ATPase and the 18S rRNA
control gene, previously published primers designed from conserved
nucleotide regions across multiple teleost species were used (Table 1)
(12). The reactions were performed in a thermocycler (model MX4000, Stratagene) with the following cycling parameters: 95°C for 10
min followed by 40 cycles of 95°C for 30 s, 58°C for 1 min, and 72°C
for 1 min. A dissociation curve was subsequently performed on each
reaction to verify the presence of a single product per reaction. A
standard curve was created to calculate exact PCR efficiencies and
verify that they were near 100% for both primer sets. Expression
levels of the H⫹ pump gene relative to the 18S gene were calculated
from cycle threshold (CT) values using the ⌬CT method of Pfaffl (24).
Expression in other tissues. As a qualitative measure of expression
in the remaining tissues, standard PCR was performed to determine
whether the H⫹ pump gene was expressed in toadfish in normal
seawater. Using the same primers used for qPCR, reactions were
performed using standard Taq DNA polymerase and cDNA from
brain, red blood cells, muscle, kidney, liver, spleen, esophagus, and
stomach. These reactions were performed in a Peltier thermal cycler
(MJ Research, Waltham, MA) using the following parameters: 94°C
for 2 min followed by 35 cycles of 94°C for 15 s, 58°C for 30 s, and
72°C for 30 s and a final elongation step at 72°C for 5 min. The results
were visualized by agarose gel electrophoresis using a 2% gel containing the nucleic acid staining agent GelStar (Cambrex Bio Science,
Rockland, ME). For each tissue in each gel, H⫹ pump expression
levels were assigned integer values from 0 to 2 based on visual
brightness, where 2 indicates a bright band, 1 a moderate band, and 0
no band. The number of samples (out of 8) with detectable expression
was also recorded. To confirm the presence of cDNA in all samples,
controls were conducted using the 18S rRNA gene.
Enzymatic activity. Segments of the anterior intestine, posterior
intestine, and gill were dissected from toadfish acclimated to seawater
or 60 ppt (n ⫽ 8). For intestinal samples, the mucosal lining was
scraped from the serosal muscle layer with a glass microscope slide,
and the serosa was discarded. Tissues were then submerged in 500 ␮l
of sucrose-EDTA-imidazole buffer, frozen in liquid nitrogen, and
stored at ⫺80°C. After they were thawed, the tissues were sonicated
(Kontes rod sonicator, Pittsburg, PA) in three 2-s pulses. ATPase
activity of the homogenates was then measured as described by
McCormick (18) and Lin and Randall (17) for the Na⫹-K⫹-ATPase
and H⫹-ATPase, respectively.
301 • DECEMBER 2011 •
www.ajpregu.org
Downloaded from ajpregu.physiology.org on December 5, 2011
Experimental animals. Gulf toadfish (Opsanus beta) were obtained
from Biscayne Bay, FL, shrimp fishermen in fall 2009 and early
spring 2010 and housed at the University of Miami Rosenstiel School
of Marine and Atmospheric Science. Maintenance and use of the fish
were approved by the University of Miami’s Institutional Animal
Care and Use Committee. All fish received a malachite green ectoparasite treatment on arrival (20) and were maintained in 80-liter glass
aquaria supplied with flowing filtered seawater (30 –35 ppt salinity,
22–26°C). For experimental high-salinity treatments, the seawater
flow was terminated, and the salinity was raised to 60 ppt by the
addition of Instant Ocean sea salt. Water quality was then maintained
by biofilter recirculation, and debris was removed during weekly
water changes of 50%. All fish were given polyvinylchloride tubes as
shelter and were fed frozen squid weekly to satiation. Food was
withheld for ⱖ48 h prior to experimentation. Before experimentation,
fish were euthanized with an overdose of MS-222 (Argent Labs,
Redmond, WA).
Gene cloning and expression. Gene expression analysis was conducted using cDNA constructed from homogenized tissues harvested
from toadfish. This study utilized previously isolated DNase I-treated
mRNA, the isolation of which is described elsewhere (12). Briefly,
from a group of 40 toadfish acclimated to natural seawater, 8 were
euthanized, and samples were obtained by dissection of the following
tissues: brain, blood, muscle, kidney, liver, spleen, esophagus, stomach, anterior intestine, midintestine, posterior intestine, rectum, and
gill. The remaining 32 toadfish were transferred to a tank containing
seawater with salinity raised to 60 ppt as described above, and
temperature was held at 25°C. At 6, 12, 24, and 96 h after transfer,
eight fish were sampled as described above at each point. The tissue
samples were frozen in liquid nitrogen and later processed for extraction of RNA and generation of cDNA. Negative controls included
samples lacking template and samples lacking reverse transcriptase.
As an indicator of H⫹ pump expression, we focused on the
V-H⫹-ATPase catalytic subunit B. Homology cloning techniques
were used to obtain the nucleotide sequence of the V-H⫹-ATPase
subunit B gene. Degenerate PCR primers (Table 1) were designed by
alignment of available sequences from a number of vertebrates and
identification of conserved regions. PCRs were performed according
to standard protocols using commercial Taq DNA polymerase and
buffer (Qiagen). PCR products were gel-extracted (QIAquick kit,
Qiagen), cloned (TOPO TA cloning kit, Invitrogen), and sequenced. Primers for rapid amplification of cDNA ends (RACE)
and real-time PCR were designed using the fast pcr freeware
program (Table 1). RACE libraries were generated using the
SmartRace cDNA synthesis kit (Clontech). The sequence was then
aligned with pufferfish, eel, zebrafish, and rainbow trout sequences
(GenBank accession nos. CR663339, AF179250, BC071387, and
AF140022, respectively) and with the human kidney isoform
(accession no. NM001692) using the ClustalW program.
Table 1. Primers used for quantitative and standard PCR
R1684
PROTON SECRETION IN THE FISH INTESTINE
Table 2. Composition of solutions in pH-stat experiments
NaCl, mmol/l
KCl, mmol/l
MgSO4, mmol/l
MgCl2, mmol/l
Na2HPO4, mmol/l
KH2PO4, mmol/l
CaCl2, mmol/l
NaHCO3, mmol/l
HEPES, mmol/l
Free acid
Na salt
Urea, mmol/l
Glucose, mmol/l
Gas
pH
Mucosal
Serosal
HCO⫺
3 -Free Serosal
69.00
5.00
77.50
22.50
151.00
3.00
0.88
151.00
3.00
0.88
0.50
0.50
1.00
5.00
0.50
0.50
1.00
5.00
O2
7.80
11.00
11.00
4.50
5.00
0.3% CO2-O2
7.80
11.00
11.00
4.50
5.00
O2
7.80
Osmotic pressure of saline was adjusted to ⬃320 mosM using mannitol to
ensure isosmotic transepithelial conditions. pH was adjusted following ⬎90
min of equilibration with 0.3% CO2-O2 and O2 for serosal and HCO⫺
3 -free
serosal saline, respectively. Mucosal saline was maintained at pH 7.80 by
pH-stat titration.
AJP-Regul Integr Comp Physiol • VOL
After stable HCO⫺
3 secretion rates and TEP were observed for ⱖ60
min, a final concentration of 2 ␮mol/l bafilomycin in 0.2% DMSO
was added to the luminal chambers. HCO⫺
3 secretion rates and TEP
were recorded for 60 min following addition of bafilomycin. For
analysis, the last 30 min of the initial period were averaged as a
control rate for comparison with the bafilomycin treatment periods.
Protein localization by immunohistochemistry. Segments of the
anterior and posterior intestine were dissected from fish acclimated to
seawater or 60 ppt and fixed in 4% paraformaldehyde in PBS (pH 7.4)
for 4 h. Tissues were then dehydrated in 15% sucrose for 2 h and 30%
sucrose for 2 h. Fixation, dehydration, and subsequent storage in 30%
sucrose were performed at 4°C. Fixed tissues were sectioned at 6 ␮m
using a cryostat (model CM1850, Leica) and placed on glass slides
(Superfrost Plus, Thermo Scientific, Portsmouth, NH). Sections were
treated with 1% SDS in PBS for 5 min and washed twice for 5 min
with PBS containing 0.5% Triton X and 1% fetal calf serum as a
blocking agent. Primary H⫹ pump antibody (a gift from Jonathan
Wilson) (35) was applied at a 1:400 dilution. This affinity-purified
antibody was developed in rabbits against a synthetic peptide based on
the B subunit of eel V-H⫹-ATPase with sequence RKDHADVSNQLYACYA, a highly conserved sequence among V-H⫹-ATPases. To
control for nonspecific staining, some sections were not exposed to
primary antibodies. After incubation at 4°C for 2 days, the sections
were washed three times with PBS containing 0.5% Triton X and 1%
fetal calf serum. A secondary antibody mixture containing Alexa
Fluor 488-conjugated anti-rabbit IgG (1:300 dilution; Invitrogen) was
applied for 1 h at room temperature in darkened boxes. Finally, slides
were washed as described above and covered with mounting medium
for fluorescence with 4=,6-diamidino-2-phenylindole (Vector Labs,
Burlingame, CA). Images were recorded via an Olympus BX61
fluorescent microscope with a 3-megapixel color charge-coupled
device camera using IVision software (BioVision, Exton, PA). Controlled and stained images were cropped and normalized identically
using IVision.
Western blots were used to confirm antibody specificity. A RIPA
buffer protocol was used to extract total protein from the anterior
intestine of gulf toadfish. Approximately 40 mg of isolated mucosal
epithelial cells were suspended in 1 ml of RIPA buffer (50 mM
Tris·HCl, pH 8.0, 150 mM NaCl, 1% Nonidet, 0.1% SDS, and 0.5%
Na-deoxycholate) with 1 ␮l of protease inhibitor cocktail (catalog no.
539129, VWR) and allowed to incubate for 30 min on ice. The
resulting mixture was centrifuged at maximum speed in a table-top
centrifuge at 4°C for 15 min. The supernatant was removed and
assayed for total protein content using the commercially available
Brilliant Blue assay kit (Sigma) with bovine serum albumin as a
standard. Approximately 20 ␮g of protein were combined with denaturing loading dye (final concentration 50 mM Tris·HCl, pH 6.8, 2%
SDS, 1% glycerol, 1% ␤-mercaptoethanol, 12.5 mM EDTA, and
0.02% bromphenol blue), incubated at 95°C for 5 min, and snapcooled on ice. The protein was loaded onto a precast 10% SDSpolyacrylamide gel (Pierce), along with All Blue Precision Plus
Protein Standards (catalog no. 161-0373, Bio-Rad), and separated
using a minigel electrophoresis system (Bio-Rad) according to gel
manufacturer guidelines. A compatible wet transfer system was used
to transfer the protein to a polyvinylidene difluoride membrane. The
membrane was washed for 10 min in Tris-buffered saline ⫹ Tween 20
(TTBS: 150 mM NaCl, 20 mM Tris, pH 7.5, and 0.02% Tween 20)
and blocked for 60 min in 5% milk powder in TTBS and then in TTBS
(2 rinses and 4 washes for 10 min each). The membrane was exposed
to primary V-type ATPase antibody (1:300 antibody and 5% milk
powder in TTBS) overnight at 4°C with shaking. On the next day, the
membrane was washed as described above and exposed to secondary
antibody diluted at 1:500 antibody in 0.5% milk powder in TTBS
(stabilized peroxidase-conjugated goat anti-rabbit antibody; Thermo
Scientific) for 1 h at room temperature with shaking; then the membrane was washed as described above. The bound antibody was
detected using a chemiluminescent reaction (ECL Western blotting
301 • DECEMBER 2011 •
www.ajpregu.org
Downloaded from ajpregu.physiology.org on December 5, 2011
Intestinal HCO⫺
3 secretion rates measured by pH-stat titration. To
determine the rates of HCO⫺
3 secretion and the source of cellular
substrate and to quantify the effects of apical H⫹ pump activity in the
intestinal epithelium, isolated segments of the intestine were mounted
in Ussing chambers for pH-stat experiments, as described in detail
elsewhere (7, 8, 12). Two groups of toadfish were maintained in the
laboratory: one in flow-through natural seawater and another in 60
ppt. After ⱖ11 days of acclimation, the fish were euthanized, and the
intestines were isolated. Segments from the anterior and posterior
regions of the intestine were mounted on tissue holders exposing 0.71
cm2 (model P2413, Physiologic Instruments) and placed in Ussingstyle chambers (model P2400, Physiologic Instruments) maintained at
25°C. The luminal and serosal sides of the tissues were exposed to
differing in vivo-like saline solutions (1.6 ml total volume; Table 2)
pregassed with O2 and 0.3% CO2-O2, respectively. The same gases
were bubbled through the chambers to maintain dissolved gas concentrations during the experiment and to mix the salines. The luminal
sides of the tissues naturally secrete base mainly as HCO⫺
3 (7), which
raises the pH of the luminal chamber. The pH-stat system adds
metered amounts of acid to maintain the pH of the luminal chamber
at 7.8 (generally within ⫾0.004 pH unit), providing a measure of the
rate of HCO⫺
3 secretion by the tissue. Current and voltage electrodes
recorded TEP, as described previously (8, 12). This general procedure
was utilized in two sets of experiments with modifications outlined in
the following sections.
Dependence on serosal HCO⫺
3 . To determine the proportion of
secreted base that is produced by endogenous hydration of CO2 as
opposed to that drawn from the serosal fluid, tissues from seawaterand 60 ppt-acclimated fish mounted in Ussing chambers were deprived of serosal CO2 and HCO⫺
3 . After a control period of 90 min,
the in vivo-like serosal fluid (containing 5 mmol/l HCO⫺
3 ) was
replaced with a HCO⫺
3 -free saline gassed with O2 (Table 2). Rates of
HCO⫺
3 secretion and electrophysiological parameters were recorded
for 90 min; then control conditions were resumed through replacement of fresh serosal saline. Measurements were continued for an
additional 60 min. The last 40 min of the control period were averaged
to find the mean control rate, and the last 40 min of the HCO⫺
3 -free
period were averaged to find the mean HCO⫺
3 -free rate. Individual
10-min periods were then compared with the mean control rate.
Effect of H⫹ pump inhibition. To quantify the effect of apical H⫹
⫹
pump activity on net HCO⫺
3 secretion, the specific H pump inhibitor
bafilomycin A1 (LC Laboratories, Woburn, MA) was employed in a
separate experiment using the Ussing chambers in an identical setup.
R1685
PROTON SECRETION IN THE FISH INTESTINE
Table 3. V-H⫹-ATPase expression in various tissues
⫹
Samples expressing V-H -ATPase, %
Average expression, ABU
Brain
RBC
Muscle
Kidney
Liver
Stomach
Esophagus
Spleen
50
0.75
50
0.63
38
0.63
88
1.50
50
0.63
38
0.63
38
0.38
11
0.25
Arbitrary brightness units (ABU) from 0 to 2 are based on band brightness: 0 ⫽ no expression, 1 ⫽ moderate expression, 2 ⫽ high expression. Frequency
and strength of expression suggest that vacuolar-type H⫹-ATPase (V-H⫹-ATPase) gene is important in the kidney and expressed at moderate or low levels in
other organs.
RESULTS
The toadfish V-H⫹-ATPase subunit B gene transcript comprises a 1,515-nucleotide region coding for a 504-amino acid
protein (GenBank accession no. ADC80776). The nucleotide
sequence displays 75– 85% similarity to other teleost orthologs
(pufferfish, eel, zebrafish, and rainbow trout) and 74% similarity to the human kidney isoform. The amino acid sequence
displays 91–92% similarity to those teleost proteins and 87%
similarity to the human kidney isoform. In seawater-acclimated
toadfish, H⫹ pump expression was highest in the kidney,
intestine, and gill, and expression was moderate in the brain,
red blood cell, liver, muscle, and stomach (Table 3).
Acute transfer to high salinity caused a significant increase
in H⫹-ATPase expression in the posterior intestine after 24 h
(Fig. 1). After 96 h in 60 ppt, the posterior intestine exhibited
a 20-fold mean increase relative to the control. No significant
response in H⫹-ATPase expression was observed in response
to hypersalinity at any time in other intestinal segments or in
branchial tissue.
H⫹-ATPase and Na⫹-K⫹-ATPase activity was affected by
salinity acclimation (Fig. 2). The anterior intestine showed no
change in H⫹-ATPase activity (Fig. 2A), but Na⫹-K⫹-ATPase
activity increased from 5.20 ⫾ 0.41 ␮mol Pi·mg protein⫺1·h⫺1
in seawater to 7.63 ⫾ 0.72 ␮mol Pi·mg protein⫺1·h⫺1 in 60 ppt
(Fig. 2B). In agreement with the expression data, the posterior
intestine H⫹-ATPase activity showed a significant increase
from 0.21 ⫾ 0.09 ␮mol Pi·mg protein⫺1·h⫺1 in seawater to
0.80 ⫾ 0.28 ␮mol Pi·mg protein⫺1·h⫺1 in 60 ppt (Fig. 2C),
while activity of the Na⫹-K⫹-ATPase did not change (Fig.
2D). Gill Na⫹-K⫹-ATPase activity increased from 3.22 ⫾ 0.49
to 9.18 ⫾ 0.83 ␮mol Pi·mg protein⫺1·h⫺1 in 60 ppt (Fig. 2F)
with no significant change in H⫹-ATPase activity (Fig. 2E).
Intestinal preparations in the Ussing chambers appeared
viable for the duration of the experiments, exhibiting stable
secretion rates, TEP, and conductance under given conditions
AJP-Regul Integr Comp Physiol • VOL
(Figs. 3 and 4, Table 4). There was a tendency toward higher
TEP in the anterior than posterior intestine in seawater and 60
ppt (Table 4), which reached statistical significance in the
experiments testing the effect of bafilomycin on seawateracclimated toadfish. There was also a tendency toward higher
conductance in the anterior than posterior intestine, which was
statistically significant in 60 ppt-acclimated fish. In the set of
experiments testing the effects of bafilomycin, this difference
in conductance between anterior and posterior intestine was
significant at both salinities (Table 4). Neither bafilomycin nor
serosal HCO⫺
3 deprivation significantly changed TEP or conductance from control values (Table 4). No significant effect of
salinity acclimation on these electrophysiological parameters
was detected.
The two segments of the intestine exhibited significantly
different base secretion rates with seawater and hypersaline
acclimation (Fig. 3). Average resting HCO⫺
3 secretion rates
were 0.58 and 0.48 ␮mol·cm⫺2·h⫺1 in the seawater-acclimated
anterior and posterior intestine, respectively. These rates depended strongly on the availability of serosal HCO⫺
3 , which
accounted for ⬃65% of HCO⫺
3 secretion in the anterior intestine for seawater and high salinity acclimation (HCO⫺
3 -free
rates were 0.24 and 0.23 ␮mol·cm⫺2·h⫺1 for seawater and 60
ppt, respectively). In the posterior intestine, serosal HCO⫺
3
provided ⬃70% of HCO⫺
3 secretion under seawater acclimation and 80% under high salinity acclimation (HCO⫺
3 -free rates
were 0.16 and 0.12 ␮mol·cm⫺2·h⫺1 for seawater and 60 ppt,
respectively). Upon reinstatement of control conditions, HCO⫺
3
secretion rates began to rise but did not fully recover within the
last 60 min of the experiment. Tissues acclimated to high
salinity appeared to recover faster, with 60 –90% recovery of
Fig. 1. Expression of toadfish vacuolar-type H⫹-ATPase (V-H⫹-ATPase) in
anterior (Ant), mid (Mid), and posterior (Post) intestine, rectum (Rec), and gill
after transfer from seawater to 60 ppt salinity. Expression levels normalized to
18S are shown relative to expression in anterior intestine control. Values are
means ⫾ SE (n ⫽ 8). *Statistically significant difference (P ⬍ 0.05) from
within-tissue control.
301 • DECEMBER 2011 •
www.ajpregu.org
Downloaded from ajpregu.physiology.org on December 5, 2011
substrate, Pierce) performed according to the manufacturer’s guidelines and visualized on Biomax XAR film (Kodak).
Data presentation and statistical analysis. Values are means ⫾ SE.
Gene expression changes were compared with the control expression
level within each tissue using Bonferroni-corrected Student’s t-tests.
Student’s t-tests were also used to test differences in enzyme activity,
TEP, and conductance. The dependence of HCO⫺
3 secretion on serosal
HCO⫺
3 was analyzed with one-way repeated-measures ANOVA, and
individual time periods were compared with mean control values
using the Holm-Sidak post hoc test. Comparisons of mean control
rates and mean HCO⫺
3 -free rates across salinities were evaluated using
paired t-tests. The effects of bafilomycin on HCO⫺
3 secretion were
tested with one-way repeated-measures ANOVA with a Holm-Sidak
post hoc test. For data that were not normally distributed, Friedman’s
repeated-measures ANOVA on ranks was used with Dunnett’s post
hoc test. All differences were considered statistically significant at
P ⬍ 0.05.
R1686
PROTON SECRETION IN THE FISH INTESTINE
DISCUSSION
Fig. 2. H⫹-ATPase (A, C, and E) and Na⫹-K⫹-ATPase (B, D, and F) activity
in anterior (A and B) and posterior (C and D) intestinal mucosa and gill (E and
F) homogenates from fish acclimated to seawater (SW) or 60 ppt salinity (60
ppt). Values are means ⫾ SE (n ⫽ 8). *Statistically significant difference (P ⬍
0.05) from SW.
base secretion rate after 60 min compared with only 40 – 60%
recovery in seawater-acclimated tissues.
Acclimation to increased salinity appeared to cause a slight
increase in HCO⫺
3 secretion by the anterior intestine, but there
was no significant difference in maximum or minimum rates
across salinities (Fig. 3, A and C). In the posterior intestine,
however, acclimation to increased salinity appeared to cause a
decrease in net HCO⫺
3 secretion compared with seawateracclimated rates, with a magnitude of 0.05 ␮mol·cm⫺2·h⫺1
under control and HCO⫺
3 -free conditions (Fig. 3, B and D).
This equates to ⬃10% of resting HCO⫺
3 secretion in the
seawater-acclimated posterior intestine. An interesting difference was observed between these measurements and those in
the next experimental series. In the following bafilomycin
AJP-Regul Integr Comp Physiol • VOL
When fish are exposed to hypersalinity, intestinal ion and
water absorption become more important but also more chal⫺
lenging due to the buildup of HCO⫺
3 and depletion of Cl in
the luminal fluid as it travels along the intestine (19). Here we
have presented multiple lines of evidence showing that the
intestine responds to hypersalinity by regulating expression
and activity of an apical V-H⫹-ATPase. Protein localization
and increases in V-H⫹-ATPase gene expression, H⫹-ATPase
activity, and apical acid secretion in the posterior intestine of
hypersalinity-acclimated fish demonstrate that this transporter
is involved in ion regulation in the intestine.
The 20-fold increase in V-H⫹-ATPase gene expression in
the posterior intestine acclimated to 60 ppt salinity indicates a
particularly important role for this section of the intestine in
hypersalinity acclimation. This spatial trend in gene expression
closely matches that recently shown for expression of CAc
(27). High CAc concentration within cells of the posterior
intestine has been proposed to provide increased access to
⫹
HCO⫺
from hydrated metabolic CO2, which would
3 and H
help improve Cl⫺ uptake via anion exchange. An upregulation
in apical H⫹ pump activity may then titrate luminal HCO⫺
3, a
process aided by luminal membrane-bound carbonic anhydrase
(10), and allow anion exchange to continue against otherwise
adverse electrochemical gradients. Furthermore, luminal CO2
may diffuse back into the intestinal epithelium, where it would
again be hydrated by intracellular CAc. The trends for CAc and
H⫹ pump gene expression are in contrast to the trend for
301 • DECEMBER 2011 •
www.ajpregu.org
Downloaded from ajpregu.physiology.org on December 5, 2011
treatment experiments (Fig. 4), acclimation to high salinity
caused a significant increase in resting base secretion rates in
the posterior intestine.
It was hypothesized that addition of the H⫹ pump inhibitor
bafilomycin to luminal salines would increase the base secretion as apical acid secretion is eliminated or reduced. In the
seawater-acclimated anterior intestine, there was little or no
effect of bafilomycin addition (Fig. 4A). In the posterior intestine, however, there was a significant elevation of net base
secretion by 0.061 ␮mol·cm⫺2·h⫺1 after the addition of bafilomycin, equivalent to ⬎20% of resting base secretion (Fig.
4B). The effect of H⫹ pump inhibition was even greater in high
salinity. The overall effect was significant in the anterior
intestine of fish acclimated to 60 ppt, and although it was
transient, the mean increase immediately after bafilomycin
addition was 0.054 ␮mol·cm⫺2·h⫺1, which equates to a 9%
increase (Fig. 4C). The posterior intestine from fish acclimated
to 60 ppt also showed a significant increase amounting to 0.078
␮mol·cm⫺2·h⫺1, which is an even greater increase than in the
seawater-acclimated posterior intestine and equates to a ⬃20%
increase in apparent base secretion (Fig. 4D). The increase in
H⫹ secretion in the posterior intestine caused by hypersalinity
amounts to a 27% increase over seawater-adapted rates.
Protein localization showed V-H⫹-ATPase antibody reactivity with the apical and basolateral regions of intestinal
enterocytes (Fig. 5). This staining pattern was consistently
observed in anterior and posterior intestine at normal and high
salinity. When the V-H⫹-ATPase antibody was used for Western blot analysis using protein from the anterior intestine, only
a single band was observed, suggesting that the antibody is
specific.
PROTON SECRETION IN THE FISH INTESTINE
R1687
expression of the anion-exchange protein SLC26a6, which is
expressed most strongly in the anterior intestine and is not
notably upregulated in hypersalinity-acclimated toadfish (12),
although there is a trend toward increased expression in the
posterior intestine. This suggests that the rate of anion exchange in the posterior intestine is not limited by the anion
exchanger itself, but by unfavorable electrochemical gradients.
Furthermore, exposure of the posterior intestine to high
salinity caused an increase in H⫹-ATPase enzyme activity,
reflecting the observed increases in gene expression. In the
anterior intestine, however, the increased Na⫹-K⫹-ATPase
activity and unchanged H⫹-ATPase activity suggest that Cl⫺
transport processes proceed differently in these distinct segments of the gut. In the anterior intestine, increasing activity of
the Na⫹-K⫹-ATPase may drive increased Cl⫺ absorption
through Na⫹-Cl⫺ cotransport and Na⫹-K⫹-2Cl⫺ cotransporters, in addition to Cl⫺ absorbed through the Cl⫺/HCO⫺
3 exchanger (6); in the posterior intestine, Cl⫺ cotransport may be
limited by reduced luminal Na⫹, and, therefore, Cl⫺ absorption
may rely more heavily on Cl⫺/HCO⫺
3 exchange (12). In the
anterior intestine, a basolateral NBC is important for acquiring
serosal HCO⫺
3 for secretion, and this is powered by electrochemical gradients directing Na⫹ into the cell. The Na⫹-K⫹ATPase and NBC are upregulated in the anterior intestine
exposed to hypersalinity, presumably to maintain serosal
⫺
⫺
HCO⫺
3 acquisition and apical secretion by Cl /HCO3 exchange (30).
AJP-Regul Integr Comp Physiol • VOL
Recently, Whittamore et al. (34) showed that luminal Ca2⫹
was a major controller of HCO⫺
3 secretion in the perfused
flounder whole intestine. In consideration of our observations
of higher HCO⫺
3 secretion rates in the anterior than the posterior intestine and a theoretically even larger difference in vivo,
it seems that HCO⫺
3 secretion in the anterior intestine serves to
accumulate luminal HCO⫺
3 and, thus, facilitate CaCO3 precipitation. In contrast, the H⫹ pump in the posterior intestine,
⫺2
where Ca2⫹ is low relative to HCO⫺
3 and CO3 , acts to reduce
⫺
further luminal HCO3 accumulation while still allowing for
Cl⫺ absorption via anion exchange (19). The significance of
this process is likely associated with the reduction of luminal
osmotic pressure arising from the titration of HCO⫺
3 , which
will act to facilitate additional water absorption.
With gene expression and biochemical data supporting increased H⫹ pump activity in the posterior intestine, our subsequent series of measurements on intact tissues showed that
some of this activity takes place on the apical membrane.
Bicarbonate secretion rates measured here in the gulf toadfish
anterior intestine are comparable to those reported previously
(7, 12), but this is the first report of HCO⫺
3 secretion rates in a
marine fish posterior intestine acclimated to hypersalinity.
Although these parts of the intestine are not anatomically
distinct, they exhibit clear physiological differences. The difference in transport characteristics between intestinal segments
of toadfish are even more distinct than the differences between
the anterior intestine and pyloric ceca of rainbow trout, which
301 • DECEMBER 2011 •
www.ajpregu.org
Downloaded from ajpregu.physiology.org on December 5, 2011
Fig. 3. Base secretion rates of anterior (A and C) and posterior (B and D) intestine from toadfish acclimated to seawater (A and B) and 60 ppt salinity (C and
D) in the presence (gray bars) and absence (open bars) of serosal HCO⫺
3 and CO2. Values are means ⫾ SE (n ⫽ 8 anterior and 7 posterior). *Statistically
significant difference (P ⬍ 0.05) from the last 40 min of the initial control period. †Significant difference between anterior and posterior intestine rates averaged
across the last 40 min of each treatment. ‡Significant difference between seawater and 60 ppt rates averaged across the last 40 min of each treatment.
R1688
PROTON SECRETION IN THE FISH INTESTINE
have previously been found to differ in TEP and conductance,
but not HCO⫺
3 secretion rate (8). Here our observations of
higher conductance and TEP in the anterior intestine are
consistent with the high rates of ion absorption previously
reported (6, 7, 13). Although the overall rate of ion absorption
is probably lower in the posterior intestine, it seems that
continued absorption of Cl⫺ and water in that segment is
important for maintaining homeostasis in hypersalinity.
The observed effect of the H⫹ pump inhibitor bafilomycin
strongly supports the hypothesis of apical H⫹ pump activity
that increases along the intestine and during acclimation to
hypersalinity. The prominent response observed in the posterior intestine indicates that this region is important for maintaining osmotic balance in hypersalinity. The anterior intestine
exposed to hypersalinity would experience high levels of
luminal Cl⫺ and Ca2⫹ in vivo that would not limit Cl⫺ and
Table 4. Electrophysiological parameters of anterior and posterior intestine
Anterior Intestine
Treatment
SW
Control
HCO⫺
3 -free
60 ppt
Control
HCO⫺
3 -free
SW
Control
Bafilomycin
60 ppt
Control
Bafilomycin
Posterior Intestine
n
TEP, mV
G, mSi/cm2
8.86 ⫾ 0.64
9.07 ⫾ 0.50
7
7
⫺13.23 ⫾ 2.31
⫺12.30 ⫾ 2.29
6.89 ⫾ 0.91
7.35 ⫾ 0.79
⫺16.58 ⫾ 1.48
⫺15.92 ⫾ 0.97
10.06 ⫾ 0.41
10.25 ⫾ 0.38
7
7
⫺13.09 ⫾ 0.90
⫺12.57 ⫾ 1.38
6.58 ⫾ 0.59*
6.80 ⫾ 0.44*
9
9
⫺20.34 ⫾ 2.00
⫺19.06 ⫾ 2.10
11.79 ⫾ 0.38
12.04 ⫾ 0.42
9
9
⫺10.63 ⫾ 1.60*
⫺10.92 ⫾ 1.94*
8.76 ⫾ 0.30*
8.92 ⫾ 0.36*
6
6
⫺19.98 ⫾ 2.15
⫺20.38 ⫾ 3.69
9.88 ⫾ 0.29
10.00 ⫾ 0.31
6
6
⫺17.42 ⫾ 2.95
⫺14.58 ⫾ 3.12
8.76 ⫾ 0.31*
8.86 ⫾ 0.32*
n
TEP, mV
7
7
⫺18.78 ⫾ 1.43
⫺17.07 ⫾ 1.06
8
8
G,
mSi/cm2
Values are means ⫾ SE; n, sample size. TEP, transepithelial electrical potential; G, conductance; SW, seawater; 60 ppt, 60 ppt salinity. *Significant difference
from anterior intestine in similar conditions. No significant effect of salinity acclimation was detected.
AJP-Regul Integr Comp Physiol • VOL
301 • DECEMBER 2011 •
www.ajpregu.org
Downloaded from ajpregu.physiology.org on December 5, 2011
Fig. 4. Base secretion rates of anterior (A and C) and posterior (B and D) intestine from seawater-acclimated (A and B) and 60 ppt salinity-acclimated (C and
D) toadfish during control conditions (open bars) and after luminal addition of the H⫹-pump inhibitor bafilomycin (gray bars). Values are means ⫾ SE (n ⫽
6). *Statistically significant difference between an individual 10-min period and the last 30 min of the control period. †Significant difference between control
rates in anterior and posterior intestine. ‡Significant difference between control rates in seawater- and 60 ppt-acclimated fish. §Significant overall difference
between treatment values and the last 30 min of the control period.
PROTON SECRETION IN THE FISH INTESTINE
water absorption (8, 34). When those luminal fluids reach the
posterior intestine, further anion exchange and CaCO3 precipitation may become limited by those ions. In that case, apical
H⫹ secretion could titrate secreted HCO⫺
3 and allow continued
⫺
Cl⫺/HCO⫺
3 exchange, due to more favorable HCO3 gradients,
and associated solute-coupled water absorption. In addition,
diffusive water absorption may be enhanced by the titration of
luminal HCO⫺
3 to osmotically inert CO2.
Acclimation to hypersalinity seems to increase H⫹ pump
activity and absolute HCO⫺
3 secretion in the intestine. In our
first experimental series measuring only HCO⫺
3 secretion rates,
the anterior intestine showed no change in net HCO⫺
3 secretion
after acclimation to hypersalinity. This could represent a noneffect or a simultaneous upregulation of HCO⫺
3 secretion and
AJP-Regul Integr Comp Physiol • VOL
H⫹ secretion. In the posterior intestine acclimated to hypersalinity, the trend toward decreased net HCO⫺
3 secretion is
consistent with the increased H⫹ secretion observed in bafilomycin treatment experiments. The effects are the same under
⫹
HCO⫺
pump activity is
3 -free conditions, suggesting that H
⫺
independent of HCO3 availability. In the bafilomycin treatment experiments, acclimation to high salinity caused a significant increase in resting base secretion rates in the posterior
intestine, in contrast to the reduction observed in earlier experiments (Fig. 4 vs. Fig. 3). While the subsequent application
of bafilomycin showed that high salinity increases apical H⫹
secretion, it appears that the regulation of H⫹ secretion and
HCO⫺
3 secretion are independent. While the critical trigger
affecting HCO⫺
3 secretion is unknown, slight variations in
acclimation temperature may have contributed to our results
(15). Activity of the Na⫹-K⫹-ATPase is known to decrease at
lower temperatures and affect osmoregulatory capacity, but the
effect of acclimation temperature on the V-H⫹-ATPase and
SLC26a6 Cl⫺/HCO⫺
3 exchanger has not been investigated
(26). Our fish acclimated to seawater were exposed to flowing
natural seawater that was not strictly temperature-controlled,
and our location experienced unusually low temperatures when
the HCO⫺
3 dependence experiments were conducted, with fish
possibly experiencing temperatures ⬍22°C. During the acclimation period prior to bafilomycin experiments, water temperatures were in the normal range of 23–26°C. While differences
in temperature were slight, they may have affected the regulation of the Cl⫺/HCO⫺
3 exchanger in the posterior intestine. The
anterior intestine exhibited no such discrepancy between experiments. Despite this variation in resting base secretion rates, the
changes in H⫹ secretion measured in the bafilomycin experiments
were consistent with H⫹ secretion rates inferred in the first
experiment. Therefore, while the effect of hypersalinity on H⫹
secretion is clear, the variability in the regulation of Cl⫺/HCO⫺
3
exchange requires further study.
The source of HCO⫺
3 for apical secretion appears to be
mainly serosal, that is, from the blood, in the anterior and
posterior intestine. In concurrence with published data (7, 30,
32), the rate of HCO⫺
3 secretion is strongly dependent on the
availability of serosal HCO⫺
3 and CO2. Recent research implicated a basolateral Na⫹/HCO⫺
3 cotransporter as a limiting step
in acquiring HCO⫺
3 for apical secretion and showed that
expression of this transporter during hypersalinity exposure
increases most in the middle region of the intestine (30). Other
evidence indicates that luminal HCO⫺
3 stimulates activity of an
apical Na⫹-K⫹-2Cl⫺ cotransporter through activation of soluble
adenylyl cyclase, which concomitantly affects V-H⫹-ATPase
translocation to the apical membrane (2, 32, 33). When serosal
⫹
HCO⫺
3 is unavailable, increased apical H secretion may support
⫺
continued HCO3 secretion by creating luminal CO2, which could
diffuse back into cells for rehydration to HCO⫺
3 by CAc.
Anion exchange in the intestine also affects acid-base balance. Because the fluid absorbed by the intestine is acidic as a
result of net HCO⫺
3 secretion, this increased acid load must be
balanced by increased acid elimination elsewhere, mostly
through the gills (3, 5, 38). While intestinal acid secretion by
the V-H⫹-ATPase could contribute to acid-base balance, the
observed magnitude suggests that this contribution is only a
small part of whole body acid excretion. In the present experiment, the gills from fish acclimated to hypersalinity showed
no increase in H⫹-ATPase activity but a large increase in
301 • DECEMBER 2011 •
www.ajpregu.org
Downloaded from ajpregu.physiology.org on December 5, 2011
Fig. 5. V-H⫹-ATPase immunoreactivity in toadfish intestine. Left: control
images not exposed to primary antibody. Right: V-H⫹-ATPase immunoreactivity (green). Nuclei have been stained blue with 4=,6-diaminido-2-phenylindole. Scale bars (10 ␮m) indicate basolateral side of cells. V-H⫹-ATPase
immunoreactivity is apparent on apical and basolateral membranes of anterior
and posterior intestine in seawater- and hypersalinity-acclimated fish. G, goblet
cell.
R1689
R1690
PROTON SECRETION IN THE FISH INTESTINE
Perspectives and Significance
The marine teleost intestine secretes HCO⫺
3 in exchange for
Cl and also secretes H⫹ from the apical membrane as part of
the osmo- and ionoregulatory strategy. The rate of intestinal
HCO⫺
3 secretion increases during acclimation to hypersalinity,
and we have demonstrated that the rate of apical H⫹ secretion
increases as well, implicating this process in intestinal osmoregulation. While HCO⫺
3 secretion depends strongly on the
⫹
availability of serosal HCO⫺
secretion
3 , rates of apical H
appear unaffected. The pronounced response in the posterior
intestine corresponds with theoretical limitations placed on
Cl⫺/HCO⫺
3 exchange by unfavorable electrochemical gradients in that region. The posterior intestine was previously
assumed to be less important for osmoregulation than the
anterior intestine, but regulation of V-H⫹-ATPase activity here
indicates that additional Cl⫺ and water absorption in the
posterior intestine is important for maintaining homeostasis
during exposure to hypersalinity.
⫺
AJP-Regul Integr Comp Physiol • VOL
ACKNOWLEDGMENTS
The authors thank Lea Medeiros for help with immunohistochemistry and
Dr. Mike Schmale for the use of his fluorescent microscope.
GRANTS
This work was supported by National Science Foundation Grant IOS0743903 and an associated Research Experiences for Undergraduates supplement to M. Grosell.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
S. G., A. J. E., and M. G. conception and design of research; S. G.
performed experiments; S. G. analyzed data; S. G., A. J. E., and M. G.
interpreted results of experiments; S. G. prepared figures; S. G. drafted
manuscript; S. G., A. J. E., and M. G. edited and revised manuscript; S. G.,
A. J. E., and M. G. approved final version of manuscript.
REFERENCES
1. Ando M, Subramanyam MVV. Bicarbonate transport-systems in the
intestine of the seawater eel. J Exp Biol 150: 381–394, 1990.
2. Breton S, Brown D. New insights into the regulation of V-ATPasedependent proton secretion. Am J Physiol Renal Physiol 292: F1–F10,
2007.
3. Cooper CA, Whittamore JM, Wilson RW. Ca2⫹-driven intestinal
HCO⫺
3 secretion and CaCO3 precipitation in the European flounder in
vivo: influences on acid-base regulation and blood gas transport. Am J
Physiol Regul Integr Comp Physiol 298: R870 –R876, 2010.
4. Evans DH. Teleost fish osmoregulation: what have we learned since
August Krogh, Homer Smith, and Ancel Keys. Am J Physiol Regul Integr
Comp Physiol 295: R704 –R713, 2008.
5. Genz J, Taylor JR, Grosell M. Effects of salinity on intestinal bicarbonate secretion and compensatory regulation of acid-base balance in Opsanus beta. J Exp Biol 211: 2327–2335, 2008.
6. Grosell M. Intestinal anion exchange in marine fish osmoregulation. J Exp
Biol 209: 2813–2827, 2006.
7. Grosell M, Genz J. Ouabain-sensitive bicarbonate secretion and acid
absorption by the marine teleost fish intestine play a role in osmoregulation. Am J Physiol Regul Integr Comp Physiol 291: R1145–R1156, 2006.
8. Grosell M, Genz J, Taylor JR, Perry SF, Gilmour KM. The involvement of H⫹-ATPase and carbonic anhydrase in intestinal HCO⫺
3 secretion
in seawater-acclimated rainbow trout. J Exp Biol 212: 1940 –1948, 2009.
9. Grosell M, Gilmour KM, Perry SF. Intestinal carbonic anhydrase,
bicarbonate, and proton carriers play a role in the acclimation of rainbow
trout to seawater. Am J Physiol Regul Integr Comp Physiol 293: R2099 –
R2111, 2007.
10. Grosell M, Gilmour KM, Perry SF. Intestinal carbonic anhydrase,
bicarbonate, and proton carriers play a role in the acclimation of rainbow
trout to seawater. Am J Physiol Regul Integr Comp Physiol 293: R2099 –
R2111, 2007.
11. Grosell M, Laliberte CN, Wood S, Jensen FB, Wood CM. Intestinal
HCO⫺
3 secretion in marine teleost fish: evidence for an apical rather than
a basolateral Cl⫺/HCO⫺
3 exchanger. Fish Physiol Biochem 24: 81–95,
2001.
12. Grosell M, Mager EM, Williams C, Taylor JR. High rates of HCO⫺
3
secretion and Cl⫺ absorption against adverse gradients in the marine
teleost intestine: the involvement of an electrogenic anion exchanger and
H⫹-pump metabolon? J Exp Biol 212: 1684 –1696, 2009.
13. Grosell M, Taylor JR. Intestinal anion exchange in teleost water balance.
Comp Biochem Physiol A Mol Integr Physiol 148: 14 –22, 2007.
14. Grosell M, Wood CM, Wilson RW, Bury NR, Hogstrand C, Rankin C,
Jensen FB. Bicarbonate secretion plays a role in chloride and water
absorption of the European flounder intestine. Am J Physiol Regul Integr
Comp Physiol 288: R936 –R946, 2005.
15. Houston AH, Gingrasbedard JH. Variable versus constant-temperature
acclimation regimes— effects on hemoglobin isomorph profile in goldfish,
Carassius auratus. Fish Physiol Biochem 13: 445–450, 1994.
16. Kurita Y, Nakada T, Kato A, Doi H, Mistry AC, Chang MH, Romero
MF, Hirose S. Identification of intestinal bicarbonate transporters involved in formation of carbonate precipitates to stimulate water absorption
301 • DECEMBER 2011 •
www.ajpregu.org
Downloaded from ajpregu.physiology.org on December 5, 2011
Na⫹-K⫹-ATPase activity, similar to the response commonly
observed when euryhaline fish are introduced to seawater (36,
40). This suggests that increased branchial acid secretion in
hypersalinity is not accomplished primarily through the H⫹ATPase, but likely candidates include Na⫹/H⫹ exchangers,
which would be favored by the high ambient Na⫹ concentrations and increased activity of the Na⫹-K⫹-ATPase. Na⫹/H⫹
exchange seems to be the main route of acid excretion in
acidotic elasmobranchs and in hagfish (23, 31), but it remains
to be seen whether this is the main mechanism for increased
acid excretion in marine teleosts exposed to hypersalinity.
The magnitude of H⫹ secretion is probably underestimated
in our experiments, because the salines may allow resting
HCO⫺
3 secretion rates substantially higher than in vivo, especially for the posterior intestine. In vivo the posterior intestine
contains a luminal fluid different in composition from that
found in the anterior intestine, on which our experimental
salines were modeled (11). The fluid in the posterior intestine
⫺
will be higher in HCO⫺
3 and lower in Cl than the fluid used
here, so HCO⫺
secretion
in
vivo
would
be
even more depen3
dent on the action of the H⫹ pump. Additionally, when the H⫹
pump is inhibited with bafilomycin, extracellular and subcellular electrochemical gradients will become less favorable for
anion exchange, diminishing the observed effect. Therefore, it
can be concluded that, under normal seawater conditions, the
H⫹ pump is responsible for titrating ⱖ20% of HCO⫺
3 secretion
in the posterior intestine and that it may titrate an even greater
percentage of HCO⫺
3 secretion in fish acclimated to hypersalinity.
Additional evidence for apical localization of the H⫹-ATPase
comes from immunostained tissue sections. The V-H⫹-ATPase
antibody has previously been shown to be specific in numerous
fish species, including eel, sea lamprey, weather loach, and
others (21, 25, 35). Similarly, the single band observed in
Western blot analysis of the gulf toadfish anterior intestine
suggests that this antibody is also specific in this species. As
expected, both segments of intestine showed apical and basolateral H⫹-ATPase immunoreactivity on enterocyte plasma
membranes regardless of salinity acclimation. This supports
the model proposed by Grosell et al. (12).
PROTON SECRETION IN THE FISH INTESTINE
17.
18.
19.
20.
21.
22.
24.
25.
26.
27.
28.
29.
AJP-Regul Integr Comp Physiol • VOL
30. Taylor JR, Mager EM, Grosell M. Basolateral NBCe1 plays a ratelimiting role in transepithelial intestinal HCO⫺
3 secretion, contributing to
marine fish osmoregulation. J Exp Biol 213: 459 –468, 2010.
31. Tresguerres M, Katoh F, Fenton H, Jasinska E, Goss GG. Regulation
of branchial V-H⫹-ATPase, Na⫹/K⫹-ATPase and NHE2 in response to
acid and base infusions in the Pacific spiny dogfish (Squalus acanthias). J
Exp Biol 208: 345–354, 2005.
32. Tresguerres M, Levin LR, Buck J, Grosell M. Modulation of NaCl
absorption by [HCO⫺
3 ] in the marine teleost intestine is mediated by
soluble adenylyl cyclase. Am J Physiol Regul Integr Comp Physiol 299:
R62–R71, 2010.
33. Tresguerres M, Parks SK, Katoh F, Goss GG. Microtubule-dependent
relocation of branchial V-H⫹-ATPase to the basolateral membrane in the
Pacific spiny dogfish (Squalus acanthias): a role in base secretion. J Exp
Biol 209: 599 –609, 2006.
34. Whittamore JM, Cooper CA, Wilson RW. HCO⫺
3 secretion and CaCO3
precipitation play major roles in intestinal water absorption in marine
teleost fish in vivo. Am J Physiol Regul Integr Comp Physiol 298:
R877–R886, 2010.
35. Wilson JM, Leitao A, Goncalves AF, Ferreira C, Reis-Santos P,
Fonseca AV, Da Silva JM, Antunes JC, Pereira-Wilson C, Coimbra J.
Modulation of branchial ion transport protein expression by salinity in
glass eels (Anguilla anguilla L.). Mar Biol 151: 1633–1645, 2007.
36. Wilson JM, Whiteley NM, Randall DJ. Ionoregulatory changes in the
gill epithelia of coho salmon during seawater acclimation. Physiol
Biochem Zool 75: 237–249, 2002.
37. Wilson RW, Gilmour KM, Henry RP, Wood CM. Intestinal base
excretion in the seawater-adapted rainbow trout: a role in acid-base
balance? J Exp Biol 199: 2331–2343, 1996.
38. Wilson RW, Grosell M. Intestinal bicarbonate secretion in marine teleost
fish—source of bicarbonate, pH sensitivity, and consequences for whole
animal acid-base and calcium homeostasis. Biochim Biophys Acta 1618:
163–174, 2003.
39. Wilson RW, Millero FJ, Taylor JR, Walsh PJ, Christensen V, Jennings S, Grosell M. Contribution of fish to the marine inorganic carbon
cycle. Science 323: 359 –362, 2009.
40. Wilson RW, Wilson JM, Grosell M. Intestinal bicarbonate secretion by
marine teleost fish—why and how? Biochim Biophys Acta 1566: 182–193,
2002.
41. Wood CM, Bucking C, Grosell M. Acid-base responses to feeding and
intestinal Cl⫺ uptake in freshwater- and seawater-acclimated killifish,
Fundulus heteroclitus, an agastric euryhaline teleost. J Exp Biol 213:
2681–2692, 2010.
301 • DECEMBER 2011 •
www.ajpregu.org
Downloaded from ajpregu.physiology.org on December 5, 2011
23.
in marine teleost fish. Am J Physiol Regul Integr Comp Physiol 294:
R1402–R1412, 2008.
Lin H, Randall DJ. H⫹-ATPase activity in crude homogenates of fish gill
tissue—inhibitor sensitivity and environmental and hormonal-regulation. J
Exp Biol 180: 163–174, 1993.
McCormick SD. Methods for nonlethal gill biopsy and measurement of
Na⫹,K⫹-ATPase activity. Can J Fish Aquatic Sci 50: 656 –658, 1993.
McDonald MD, Grosell M. Maintaining osmotic balance with an aglomerular kidney. Comp Biochem Physiol A Mol Integr Physiol 143:
447–458, 2006.
McDonald MD, Grosell M, Wood CM, Walsh PJ. Branchial and renal
handling of urea in the gulf toadfish, Opsanus beta: the effect of exogenous urea loading. Comp Biochem Physiol A Mol Integr Physiol 134:
763–776, 2003.
Moreira-Silva J, Tsui TKN, Coimbra J, Vijayan MM, Ip YK, Wilson
JM. Branchial ammonia excretion in the Asian weatherloach Misgurnus
anguillicaudatus. Comp Biochem Physiol C Toxicol Pharmacol 151:
40 –50, 2010.
Mount DB, Romero MF. The SLC26 gene family of multifunctional
anion exchangers. Pflügers Arch 447: 710 –721, 2004.
Parks SK, Tresguerres M, Goss GG. Blood and gill responses to HCl
infusions in the Pacific hagfish (Eptatretus stoutii). Can J Zool Rev Can
Zool 85: 855–862, 2007.
Pfaffl MW. A new mathematical model for relative quantification in
real-time RT-PCR. Nucleic Acids Res 29: e45, 2001.
Reis-Santos P, McCormick SD, Wilson JM. Ionoregulatory changes
during metamorphosis and salinity exposure of juvenile sea lamprey
(Petromyzon marinus L.). J Exp Biol 211: 978 –988, 2008.
Sardella BA, Cooper J, Gonzalez RJ, Brauner CJ. The effect of
temperature on juvenile Mozambique tilapia hybrids (Oreochromis mossambicus ⫻ O. urolepis homorum) exposed to full-strength and hypersaline
seawater. Comp Biochem Physiol A Mol Integr Physiol 137: 621–629,
2004.
Sattin G, Mager EM, Beltramini M, Grosell M. Cytosolic carbonic
anhydrase in the Gulf toadfish is important for tolerance to hypersalinity.
Comp Biochem Physiol A Mol Integr Physiol 156: 169 –175, 2010.
Soleimani M. Expression, regulation and the role of SLC26 Cl⫺/HCO⫺
3
exchangers in kidney and gastrointestinal tract. Novartis Found Symp 273:
91–102, 2006.
Taylor JR, Grosell M. Feeding and osmoregulation: dual function of the
marine teleost intestine. J Exp Biol 209: 2939 –2951, 2006.
R1691