This page was intentionally left blank in electronic version.
Chapter
12
DNA Analysis
Objectives
After reading this chapter, you will understand:
• That DNA is a long-chain polymer found
in nucleated cells, which contain genetic
information.
• That DNA can be used to identify or clear
potential suspects in crimes.
• How DNA is extracted and characterized.
• How to apply the concepts of RFLP, PCR,
and STRs to characterize DNA.
• The role that statistics plays in determining
the probability that two people would have
the same sequence in a fragment of DNA.
You will be able to:
• Explain that DNA is a long molecule, tightly
packed in the form of a chromosome with
genetic material wrapped around it.
• Isolate and extract DNA from cells.
• Describe the function and purpose of a
restriction enzyme.
• Calculate probabilities of identity using STR.
• Use technology and mathematics to improve
investigations and communications.
• Identify questions and concepts that guide
scientific investigations.
• Communicate and defend a scientific
argument.
334
“The capacity to blunder slightly is the
real marvel of DNA. Without this special
attribute, we would still be anaerobic
bacteria and there would be no music.”
—Lewis Thomas, physician, author
335
DNA
The Human Genome
75–100 trillion . . . cells in the
human body
3.1 billion . . . base pairs in each cell
2.4 million . . . base pairs in the largest
human gene (dystrophin)
28,000–35,000 . . . genes in the
human genome
46 . . . chromosomes in each cell
DNA “fingerprinting” is a common way to identify
people by their unique genetic code. It is currently
being used to identify the perpetrator in a crime, to
identify fathers in paternity cases, and to identify
unknown remains in mass disasters and other
situations. DNA “profi ling” is a better way to refer
to the process; it has nothing to do with fingers or
fingerprints themselves. DNA is in every nucleated
cell of the human body and can be extracted from
blood, semen, urine, bone, hair follicles, and saliva.
Biological Aspects of DNA
chromosomes: long,
threadlike groups of genes found in
the nucleus of a cell
DNA: deoxyribonucleic acid,
the hereditary material of most
organisms
A basic functional and structural element of all
living things is the cell. Sometimes the cell functions
on its own, as in red blood cells, or in groups, as
in tissues or organs. In the nucleus of the cell are
chromosomes that are inherited from both parents.
Chromosomes are long-chain DNA molecules that
are tightly bound in a specific structure. Figure 12.1
shows the 21 chromosomes found in humans. If a
Chromosome 4
Chromosome 5
Chromosome 6
Chromosome 7
Chromosome 1
Chromosome 2
Chromosome 3
Chromosome 8
Chromosome 9
Chromosome 10 Chromosome 11 Chromosome 12 Chromosome 13 Chromosome 14
Chromosome 15 Chromosome 16 Chromosome 17 Chromosome 18 Chromosome 19 Chromosome 20 Chromosome 21
Figure 12.1 The 21 human chromosomes
336 Chapter 12
Nucleus
Gene
Cell
Chromosome
Figure 12.2 Illustration of how DNA fits into the cell
DNA
single DNA strand were stretched out, it would reach
about 5 cm in length.
The human body has approximately 35,000
genes, which are simply portions of the DNA that
code the information required to make specific
proteins. These proteins then determine human
traits and functions. Each gene has a specific
code for a specific body function; they are the
fundamental unit of heredity, determining traits
from hair color, eye color, and facial features to
certain diseases or disorders. A particular gene
can be carried by more than one chromosome.
Figure 12.2 shows how the gene is wrapped around
the chromosome and then packed into the cell
nucleus.
The acronym “DNA” stands for deoxyribonucleic
acid, a long-chain molecule made of four bases
that are paired and held together with hydrogen
bonds and a sugar-phosphate backbone. The
bases that pair are adenine (A) with thymine (T)
and guanine (G) with cytosine (C). The adenine and
thymine are connected with two hydrogen bonds,
If all the DNA in the human body were
put end to end, it would reach to the
sun and back more than 600 times
[100 trillion ⫻ 6 ft (1.8 m) divided by
92 million miles (148 million km) ⫽
1,200].
genes: specific sequences of
nucleotides in the DNA usually
found on a chromosome; the
functional unit of inheritance
threaded around its 23 paired
chromosomes
proteins: fundamental
components of all living cells,
including enzymes, hormones, and
antibodies. Proteins are composed
of amino acids linked together with
peptide bonds. Some of the more
familiar proteins are hemoglobin
and insulin.
hydrogen bonds: weak
attractive forces between hydrogen
atoms in a particular molecule and
a nearby electronegative atom, such
as oxygen, nitrogen, or fluorine, in
the same or another molecule
The Human Genome Project, begun in 1990, was a unified effort to identify and determine the sequence
of all genes found on the human chromosome. Most of the 28,000–35,000 genes in the human genome
have been identified and sequenced.
DNA Analysis 337
H
3C
O
N
O
NH
H 2N
2
N
N
H
NH
N
N
H
N
H
N
Thymine
Figure 12.3
Adenine
O
NH
N
N
Guanine
NH
2
N
H
O
Cytosine
Hydrogen bonding of base pairs
while the guanine and cytosine are connected with three hydrogen
bonds. See Figure 12.3.
A sequence of bases along each backbone of the DNA molecule is
abbreviated as shown in Figure 12.4.
Each of these bases contains the element nitrogen; they are sometimes
referred to as nitrogenous bases.
Each nitrogenous base is connected to a sugar molecule and a phosphate
group. These together make up what is called a nucleotide unit (Figure 12.5).
The sugar in DNA is deoxyribose.
Paired base (A-T or G-C) ⫹ sugar ⫹ phosphate ⫽ nucleotide unit
The structure of DNA is important to its function.
An unusual property of DNA is its ability to
helix: a three-dimensional,
replicate itself. It is arranged in a right-handed
twisted shape, like a spring
double helix (a twisted ladderlike structure). The
sides of the helix are the sugar and phosphate
groups; this is what gives DNA its acidic properties. On the inside are the
base pairs of adenine-thymine or guanine-cytosine (Figure 12.6).
The average DNA molecule contains approximately 100 million of these
nucleotide groups. In humans, the order of these nucleotide bases is
99.9 percent the same. The unique sequence of the other 0.1 percent makes
each human one of a kind (except for identical twins, who have the same
DNA).
On one strand
On the opposite strand
Figure 12.4
338 Chapter 12
Sequence of bases
G
O
O
A
C
NH2
phosphate
phosphate
P
O
Sugar
Phosphate
Backbone
Base pair
G
cytosine
cytosine
Adenine
N
C
A
T
A
O
Thymine
G
C
T
A
Nitrogeous
base
A
N
CH2
O
Guanine
O
H
O
A
A
H
deoxyribose
deoxyribose
Cytosine
H
H
G C
T
H
Figure 12.5 A nucleotide unit
Figure 12.6
The sequence of these bases is a code for specific
amino acids to combine to make specific proteins.
Genes can be as short as 1,000 base pairs or as long
as several hundred thousand base pairs wrapped
around the chromosome. One gene gives the
information for one cell to produce one protein. A
chromosome is a single DNA molecule twisted and
packed into the nucleus of the cell. The sequence of
the nucleotide bases is what determines the proteins
that will lead to specific growth, function, and
reproduction.
Figure 12.7 on the next page summarizes the
structural aspects described in the last few pages.
G C
T
A
A
T
Schematic of a portion of a DNA molecule
Identical twins come from one
fertilized egg that splits in two,
resulting in same-sex twins who share
100 percent of their DNA. Fraternal
twins result when two separate sperms
fertilize two separate eggs. These twins
share only 50 percent of their DNA, just
like regular siblings, and can be the
same gender or a boy and a girl.
amino acids: organic
compounds containing an amino
group, NH2, and a carboxylic acid.
Amino acids linked together make
up proteins.
The first reported use of DNA identification was in a noncriminal setting to prove a
familial relationship. A Ghanaian boy was refused entry into the United Kingdom for
lack of proof that he was the son of a woman living there. Immigration authorities
claimed that the boy could be the nephew of the woman, not her son. DNA testing
showed a high probability of a mother-son relationship, and authorities admitted
the boy.
—Criminal Law Review (1987)
DNA Analysis 339
A DNA molecule consists
of two spirally-wound sugarphosphate chains linked
through the hydrogen bonding
of four nitrogenous bases.
Adenine links with thymine
while guanine pairs with
cytosine.
Sugar-phosphate
backbone
A
T
G
C
T
A
Nitrogenous bases:
A: Adenine
T: Thymine
G: Guanine
C: Cytosine
A
P
P
T
A
Sugar
Sugar-phosphate
backbone + base = nucleotide
Sugar
P
P
C
G
Sugar
Sugar
P
P
T
A
Sugar
Sugar
P
P
C
Sugar
3' end
G
Hydrogen bond
Sugar
5' end
Figure 12.7 DNA molecule
Forensic Uses of DNA
The first forensic use of DNA
technology in criminal cases
was in 1986, when police asked
Dr. Alec J. Jeffreys (who coined
the term “DNA fingerprints”) of
Leicester University in England
to verify a suspect’s confession
that he was responsible for two
rape-murders in the English
Midlands. Tests proved that
the suspect had not committed
the crimes. Police then began
obtaining blood samples
from several thousand male
inhabitants of the area. The
perpetrator was identified and
convicted of the crimes.
340 Chapter 12
Blood and bodily fluids are the most common
evidence that forensic investigators use for testing
of DNA. Blood is made up of red blood cells, which
carry oxygen throughout the body; plasma, the
fluid that carries the cells; platelets, which facilitate
clotting; and white blood cells, which defend the
body against infection. Red blood cells lack the nuclei
that contain DNA, so it is the white blood cells that
interest forensic scientists. A single drop of blood
may contain anywhere from 7,000 to 25,000 white
blood cells with nuclei containing DNA. A small
sample with only a few white blood cells is enough to
extract DNA, and using the PCR (polymerase chain
reaction) method, billions of copies can be made
for testing.
DNA fingerprinting or profi ling can be useful for many purposes:
• To identify potential suspects whose DNA may match evidence left at
crime scenes
GO TO www.scilinks.org
• To clear persons wrongly accused of crimes
TOPIC DNA
• To identify crime and catastrophe victims
fingerprinting
• To establish paternity and other family relationships
CODE
forensics2E341
• To match organ donors with recipients in transplant
programs
enzymes: proteins that cause a
Samples collected from a crime scene are examined
chemical reaction to occur at a rate
that is sufficient to support life
to determine whether the sample is appropriate for
DNA analysis. If a sample is to be analyzed, it must be
properly prepared. First, the DNA is removed from the object it is attached
to (for example, clothing, weapon, skin); then it is extracted from the cell.
To isolate the DNA, the cellular components, such as fats, proteins, and
carbohydrates, must be removed. Then enzymes are used to release the
DNA from the chromosomal packaging. Once the DNA is extracted, it is
ready for characterization.
Extracting DNA from a Banana
Laboratory
Activity 12.1
You can readily see DNA with your naked eye when it is extracted from
a cell. The complex structure itself is not visible, but as it unravels
itself when coming out of the nucleus, the DNA makes such a large
molecule that you can see it. This gives you some idea of how well it
must be packed to fit in the nucleus.
DNA Analysis 341
Laboratory Activity 12.1, continued
Materials
For each lab group:
• banana
• lysis buffer: 200 ml of Murphy
Oil Soap, 20 g of salt, and 1 L
of water
• 5-in. square of cheesecloth
SAFETY ALERT!
• cold ethanol
• wooden toothpick or sticks to
spool the DNA
• plastic fork
• two 250-ml beakers
CHEMICALS USED
Always wear goggles and an apron when working in the labaratory
!
SAFETY NOTE Also wear disposable laboratory gloves. Avoid inhalation,
ingestion, and skin contact with chemicals.
Procedure
1. Mash a small piece of banana with a plastic fork.
2. Place the mashed banana in a 250-ml beaker and add 25 ml of the lysis
solution. Stir.
3. The DNA is now out of the cell but is still attached to the water molecules, so
it cannot be seen yet. Filter out the chunks of banana through two layers of
the cheesecloth, allowing the solution to run into another 250-ml beaker.
4. Put the cheesecloth and banana in the garbage.
5. Add 50 ml of the cold ethanol to the beaker by slowly pouring it down the
side of the beaker.
6. Observe the precipitate. This is the DNA. The water and ethanol stick
together better than water and DNA; therefore, the DNA is not attached to the
water anymore, and it comes out as a precipitate.
7. The DNA forms at the boundary of the water and ethanol. Slowly spool out
some of the DNA around a toothpick or a pencil.
8. Record all of your observations.
Analysis Questions
1. Why use a banana for studying DNA? What other types of materials could you
have used?
2. Why mash the banana? What does this do to the cells?
342 Chapter 12
Laboratory Activity 12.1, continued
3. The lysis buffer is made with soap and a bit of salt. Why do you add this
solution to the mashed banana?
4. Were you able to see the double helix structure of the DNA? Explain.
In 1994 a mother of five on Prince Edward Island, Canada, disappeared, leaving only one
clue: Her car was found near a bag that contained a blood-soaked jacket and a few white
hairs. Detectives hoped the hairs belonged to the murderer—but, in fact, the hair was
a cat’s. This was not altogether bad news. A certain feline named Snowball lived with
the woman’s estranged husband, but none of the forensic labs police called were willing
to test Snowball’s DNA. Eventually a team led by Stephen J. O’Brien, an NIH expert on
genes and cats, examined blood samples. Snowball’s DNA was a near-perfect match to the
cat hairs in the bag. The defendant was sentenced to 18 years for second-degree murder.
—from Scientific American, July 1997
RFLP Analysis for DNA Fingerprinting
At this time, a whole DNA molecule is too complex for scientists to
characterize completely, and therefore it cannot be used as individual
evidence. The best that forensic scientists can do is to characterize pieces or
fragments of DNA and use statistics to determine the likelihood of another
individual having the same fragments.
Forensic scientists use DNA fingerprinting to match
the unknown samples of DNA found at a crime scene
to known samples of DNA in the blood, semen, or
other cells of a suspect. DNA fingerprinting can also
be used in paternity cases to determine who the father
of a child may be. Testing in questions of paternity
is made easier because the field tends to be narrower
than in a crime, where there are often many suspects.
To characterize DNA, the scientist must cut it into
smaller pieces. This is done using restriction
enzymes. A restriction enzyme will recognize a specific
sequence of bases and cut the DNA molecule at a
specific point. For example, a restriction enzyme called
EcoRi will cut DNA whenever it finds the sequence
GAATTC. It will cut between the G and A, as in:
R – Restriction enzymes are
used to cut the DNA into
F – fragments that are many
different
L – lengths and exhibit
P – polymorphism, which is
a Greek term meaning many
shapes. The length of the
fragments varies greatly among
individuals.
restriction enzymes:
enzymes that are used to cut DNA
into smaller fragments
GAATTC
CTTAAG
DNA Analysis 343
Other restriction enzymes cut at different
sites. Table 12.1 lists four enzymes and their
cutting sites.
Table 12.1: Restriction Enzymes
Enzyme
Cutting Site
Bam HI
Hae III
Pst I
Bgl II
GGATCC between the G and G
GGCC between the G and C
CTGCAG between the A and G
AGATCT between the C and T
electrophoresis: a procedure
that separates DNA fragments
according to size
Once the DNA is cut into different-sized
fragments, these fragments are separated
through electrophoresis, using a gel and a
voltage source. This procedure separates the
fragments according to their sizes.
The fragments are very close together, and there
are so many of them that it is difficult to make them
visible. A probe (often radioactive) is added that will
adhere to specific fragments. By using a development
Typed human DNA sequence
344 Chapter 12
technique, the scientist can observe the new pattern,
analyze an unknown sample from a crime scene, and
compare it to the DNA of a suspect to see if it runs
through the electrophoresis in the same manner.
probe: a portion of a DNA
molecule with a known sequence
of bases that is used to find its
complementary strand
There are four main procedures involved in DNA
fingerprinting: isolation of the DNA to separate the DNA from the cell; cutting
with a restriction enzyme to make shorter base strands; sorting the segments
by size, using an electrophoresis procedure; and analyzing the resulting print
by identifying specific alleles.
Base pairs
Adenine
Thymine
Guanine
Cytosine
Sugar phosphate
backbone
Schematic of a portion of DNA
Simulation of RFLP
Activity 12.1
Purpose
In this activity you will take a long strand of simulated DNA and use
simulated restriction enzymes to cut the strand and make a DNA
fingerprint. Using a comparison of fragment lengths, you will then
analyze the DNA fingerprints to determine the perpetrator of a crime.
DNA Analysis 345
Activity 12.1, continued
Materials
For each lab group:
• 1.5-meter strip of adding
machine paper
• scissors
• meter stick
• graph paper
One per class:
• poster board for a simulated
gel box
Procedure: Part 1
The National Football
League used DNA
technology to tag all of
the Super Bowl XXXIV
balls, ensuring their
authenticity for years
to come and helping
to combat the growing
epidemic of sports
memorabilia fraud. The
footballs were marked
with an invisible, yet
permanent, strand of
synthetic DNA. The DNA
strand is unique and is
verifiable at any time
in the future using a
specially calibrated laser.
346 Chapter 12
1. On the 1.5-meter strip of adding machine tape, use a meter stick or ruler to
mark off every 2.5 cm. Make these marks on the entire length of the strip.
2. In every 2.5-cm block, write four letters representing the four base pairs
(A, T, G, C). Write the bases in any combination you wish, even repeating
some. Continue writing the four letters the entire length of the strip.
3. After you have constructed your base sequence, make the complementary
strand below the original. The strip now represents a piece of doublestranded DNA.
4. Now cut your DNA with a simulated restriction enzyme called TWI. This
restriction enzyme cuts DNA anywhere there is an AT sequence. Cut between
the A and T on the top strand, starting from the left and moving to the right.
You should also cut between the A and T of the complementary strand on the
bottom; however, on that strand, you will be moving from the right to the left.
5. Continue locating A and T sequences and cutting until you reach the end of
your strip.
6. Measure each of the fragments with your ruler; write the length on the back.
7. Your DNA fragments can be separated according to size. Make a chart as
shown below and write in the number of fragments you have for each category.
When other groups in your class finish, write their data in the appropriate
boxes. This simulates the gel separation of DNA according to size.
group 1
13–20 cm
9–13 cm
6–9 cm
4–6 cm
2–4 cm
0–2 cm
group 2
group 3
group 4
group 5
Activity 12.1, continued
8. After you and the other groups are finished, make a bar graph of the data
from the chart.
9. When you are finished, you will have a graph that looks like a DNA profile.
Procedure: Part 2
Someone in the class has been
stealing glassware. A broken flask
was found on the floor with some
drops of blood nearby. The DNA has
been extracted, and your teacher has
a copy of the sequence. It is up to
you to cut the DNA with a restriction
enzyme and run it through the gel
to catch the thief. Add a sixth lane
to your bar graph and draw the DNA
fingerprint of the glass thief. Compare
the DNA fingerprint with those of your
classmates to determine who the
thief is.
Analysis Questions
1. Why are restriction enzymes used for DNA fingerprinting?
2. Show how the following DNA sequence would be cut by the restriction
enzyme Hae III. Count the number of base pairs in each fragment and put a
label at the top of each fragment.
TTTAATTTGGCCATGTGTTACGGCCACGAATGGCCTTATCA
AAATTAAACCGGTACACAATGCCGGTGCTTACCGGAATAGT
3. Is cutting between the A and G on the top sequence the same as cutting
between the G and A on the bottom sequence?
4. Describe the steps a scientist would use to make a DNA fingerprint from
cells found underneath a murder victim’s fingernails.
DNA Analysis 347
The first case in which a murderer was convicted on DNA evidence obtained from a plant
was described in the PBS television series Scientific American Frontiers. A young woman
was murdered in Phoenix, Arizona, and a pager found at the scene of the crime led the police
to a prime suspect. He admitted picking up the victim, but claimed she had robbed him of his
wallet and pager. The forensic squad examined the suspect’s pickup truck and collected pods
later identified as the fruits of the palo verde tree (Cercidium spp.). One detective went back
to the murder scene and found several palo verde trees, one of which showed damage that
could have been caused by a vehicle. The detective’s superior officer innocently suggested
the possibility of linking the fruits and the tree by using DNA comparison, not realizing that
this had never been done before. Several researchers were contacted before a geneticist at
the University of Arizona in Tucson agreed to take on the case. Of course, it was crucial to
establish evidence that would stand up in court on whether individual plants (especially palo
verde trees) have unique patterns of DNA. A preliminary study on samples from different
trees at the murder scene and elsewhere quickly established that each palo verde tree is
unique in its DNA pattern. It was then a simple matter to link the pods from the suspect’s
truck to the damaged tree at the murder scene and obtain a conviction.
—WNED-TV (PBS Buffalo, NY)
Electrophoresis
Electrophoresis uses the fact that DNA is polar, or electrically charged,
to separate the fragments. The DNA molecule is negatively charged. The
size and shape of the fragments will determine how far the
molecules travel. The negative end of the DNA molecule
will migrate to the positive end of the electrode. The smaller
fragments will travel through the gel more easily than the
larger fragments and, therefore, travel a greater distance.
When a DNA fingerprint is viewed, the smaller pieces will
be deposited farther away from the wells where the samples
were loaded.
Like with paper or thin-layer chromatography, the fragments
separated by gel electrophoresis must be developed or
visualized in order to be seen. This is done by silver staining,
or with a dye like ethidium bromide or fluorescent dyes. A
more recent technique, capillary electrophoresis (CE or CZE),
uses the same principle as gel electrophoresis, but it is carried
out in capillary tubing. The bands are detected using uv-vis
absorbance or other, more sophisticated methods.
Your task today is to make and view a simulated DNA
fingerprint.
348 Chapter 12
Solidified
agarose gel
Glass plate
Masking tape
A. Casting tray
B. Pouring agarose solution
onto glass plate
C. Comb is pushed down into
gel to form wells
DNA fragments move
through gel toward
positive electrode
Cathode
m
Power
supply
+
Anode
D. DNA segments loaded into
wells with micropipette
E. Gel plate immersed in charged
buffer solution
Electrophoresis steps
DNA Analysis 349
Laboratory
Activity 12.2
Electrophoresis Separation of Dyes
Materials
For each lab group:
• 0.4 g agarose
• 5 ml of concentrated buffer
solution
• 250 ml of distilled water
• 150-ml and 250-ml beakers
• hot plate
SAFETY ALERT!
• thermometer
• dyes simulating DNA samples
• electrophoresis container
• micropipette
• DC power supply
CHEMICALS USED
Always wear goggles and an apron when working in the labaratory
!
SAFETY NOTE Avoid inhalation, ingestion, and skin contact with
chemicals.
Procedure
1. Measure 0.4 grams of agarose, and put it in a 150-ml beaker.
2. Measure 1 ml of buffer solution using a graduated cylinder. Add this to the
beaker.
3. Add 50 ml of distilled water to the beaker. Heat the mixture until the
solution is clear.
4. Stand the comb in the middle of the small tray. Tape the open edges closed.
5. Let the solution cool to 55°C; then pour it in the small tray.
6. After the gel has solidified, gently remove the comb and tape.
7. Place the tray in the electrophoresis container. Make sure the plastic tray is
touching the sides of the container.
8. Using a 250-ml beaker, make a diluted buffer solution by adding 4 ml of
concentrated buffer to 196 ml of distilled water.
9. Cover the gel completely with the buffer solution.
10. Load each “DNA” sample into one of the wells. Each sample should be about
35 to 38 μl, or four to five drops using a micropipette.
11. Connect the electrophoresis container to the power supply. Make sure the
current is flowing; you should see bubbles forming on the electrodes.
12. Cover the container with a lid, and allow it to run for 45 minutes to 2 hours.
Stop the power before the color bands run off the end.
350 Chapter 12
Laboratory Activity 12.2, continued
Analysis Questions
1. On what basis does agarose gel electrophoresis separate molecules? Name
three.
2. Explain migration according to charge.
3. Diagram what your DNA fingerprint looks like. Be sure to label all samples.
Sample wells
Negative
electrode
–
Gel support
Longest
fragments
DNA fragments
move through gel
toward positive
electrode
Power
supply
Shortest
fragments
Porous gel
+
Buffer fluid
Positive
electrode
Electrophoresis
Statistical Analysis in DNA Profiling
The DNA molecule is hundreds of thousands of
base pairs long. If you look at only a fragment
of the DNA, what are the chances of someone
else having the same size fragment? We are not
There are 3 billion (3,000,000,000)
letters in the DNA code in every cell in
your body.
DNA Analysis 351
asking if the sequence of bases in the fragments is the same, only if the
fragments are of the same length.
Is it possible to determine the probability that two people with the same
size fragment will be chosen at random? Can you estimate this probability
based on a limited sample size? You can simulate this problem by
answering the question: Can you estimate the quantity of macaroni in a
box by observing and counting only a handful?
Activity 12.2
Statistical Sampling Lab
The purpose of this activity is to estimate the number of macaroni pieces
in a package by actually counting only a small amount.
Materials
large package of elbow macaroni
Marked macaroni
Procedure
Key:
NMP: number of marked pieces
NSS: number in second sample
NMPSS: number of marked pieces in second sample
1. Have someone in your group take a sample, a small handful, from the
package of macaroni. Count the number of pieces removed and mark them
with a marker. Let this number be NMP.
2. Put the NMPs back into the package. Mix thoroughly.
352 Chapter 12
Activity 12.2, continued
3. Take a second sample. Count the number of macaroni pieces in the second
sample. Let this number be NSS.
4. Count the number of marked pieces that are in the second sample. Let this
number be NMPSS.
5. Let the total number of macaroni pieces in the bag be N. Set up the
proportion and solve:
NMP NMPSS
N
NSS
6. Use your algebra skills to rearrange the equation and solve for N.
N NSS(NMP)
NMPSS
7. Check for accuracy. Divide the contents of the package among your group
and count the total number of pieces. How does this number compare to your
estimate of N?
Analysis Questions
1. What are the limitations of the method used in the preceding activity?
2. How can the accuracy be increased?
3. If time permits, use the method you suggested in question 2 to see if the
accuracy increases.
4. How does this activity relate to using statistical analysis in DNA
fingerprinting?
PCR: Polymerase Chain Reaction and
DNA Profiling
In many forensic cases, there is very little evidence to work with. A technique
called polymerase chain reaction (PCR) offers the possibility for
increased sensitivity in DNA fingerprinting. It can take a very small sample of
DNA and make millions of copies by a relatively simple,
quick method. PCR requires about 50 times less DNA
polymerase chain
than what is required for RFLP.
reaction (PCR): a lab
Using the fact that the base pairs in DNA are
connected together with hydrogen bonds, which are
rather weak, the strand is divided lengthwise, and new
base pairs attach to the new strands. Done repeatedly,
technique used to make multiple
copies of DNA for further testing or
characterization
DNA Analysis 353
this method can make millions of copies in a short time. In forensic
applications, PCR has been able to identify perpetrators from as small a
sample as saliva residue left on a cigarette butt, a stamp, or the adhesive on
an envelope.
DNA is taken out of a small amount of blood, semen, or saliva in the same
way as discussed earlier, by breaking down the cell wall and unwrapping the
chromosome.
The next step in PCR is to break down the DNA strands by heating. The
heat separates the weak hydrogen bonds holding the base pairs together,
leaving each DNA strand as two half-strands.
The next step is to cool the mixture and add a primer, which is a short
sequence of base pairs that will add to its complementary sequence on the
DNA strand. The function of the primer is to begin the replication process.
An enzyme called DNA polymerase is added along with a mixture of
free nucleotide bases (A, T, G, and C), which then combine with their
complementary bases on the free strand. This reaction works best at around
75⬚C, so the mixture is heated again. Once the primer is in place, the
polymerase can take over, making the rest of the new chain.
A type of polymerase called Taq
polymerase has the following
sequence:
The two half-strands have now become four complete
strands of DNA. After another cycle, there will be
eight full strands of DNA.
The three steps in PCR (separation, adding primer,
and synthesis of the new chain) take only about
two minutes, mostly because of the heating
and cooling. At the end of the cycle, every strand of DNA has been
duplicated. It takes about three hours to make 1 million copies that can
then be further characterized. If the cycle were repeated 30 times, more
than a billion copies could be produced. Consider, however, if there is
a contaminant DNA in the sample. It, too, can be amplified. Controls,
therefore, are very important, but what is most important is to be aware
that contamination can occur and to keep asking, “Does this result
make sense?”
GTAAGAGTTCCGTAACAG
alleles: sites where two genes
that influence a particular trait
are found on a chromosome pair.
For example, a pair of alleles may
control the same trait such as eye
color: One codes for blue eyes,
another for brown eyes.
354 Chapter 12
When the DNA is so greatly amplified, its typing or
characterization can be simplified by methods that are
not as complex as RFLP. One method is to add the DNA
to a nylon strip that contains genetic markers, or alleles,
that will bind to specific sequences of the DNA. These
sequences can then be visualized and characterized.
When several markers are used on several strips, the
frequency of occurrence can be greatly reduced.
Primer
Template Polymerase
Nucleotides
A. Test tube containing DNA strand
fragments (templates), complimentary
fragments (primers), single nucleotides
and polymerases.
B. Solution heated to 95°C, causing DNA
strands to separate. Solution is then
cooled to 37°C, and primers attach to
complimentary sequences on each
template strand.
C. Solution is reheated to 72°C, causing
polymerases to attach to primer ends
and create new DNA strands using
single nucleotides.
D. Two identical copies of original DNA
fragment. Several more cycles follow,
doubling number of DNA fragments
each time.
PCR
Simulation of DNA Replication Using PCR
Activity 12.3
The enzyme that you will be using in this simulation is Hae III, which
slices the DNA between the C and G in the sequence CCGG. This
allows the DNA strand to be observed in smaller portions instead of the
extremely long strand.
As a forensic investigator, you will look at DNA left at a crime scene
and determine if it matches any of the suspects. The victim’s blood has
already been ruled out as a possibility.
DNA Analysis 355
Activity 12.3, continued
Materials
For each lab group:
• scrap paper
• six simulated DNA samples from suspects
• one simulated DNA sample from the crime scene
• glue
• highlighter
Procedure
1. You have “DNA” samples from the six people who submitted blood samples
and who are suspected of being involved in a crime. You also have the
“DNA” from the crime scene.
2. Begin by making copies of the crime scene DNA using a PCR-like technique.
3. Cut out the crime scene DNA and tape the ends together to make one long strip.
4. Make the complementary strand by writing the appropriate base below the
original.
5. Simulate the denaturing or “unzipping” of the DNA by cutting it into two
long pieces.
6. Add the primer, AT, to begin the process and continue adding
complementary base pairs until you have two new strands of DNA. Write the
complementary bases along both strips.
7. Repeat steps 4 and 5 until you have eight copies of the original crime scene DNA.
8. Cut the strip of DNA for each person and tape the ends together so that you
have one long strip for each person.
9. Mark the position of the restriction enzyme recognition site with your pencil
for each suspect and the crime scene. Remember that Hae III cuts between
the C and G of the CCGG sequence only. Cut the strands at this point.
10. Now it’s time to run your fingerprints. Make a column for each person and the
crime scene. Place each person’s DNA fragments in order of size from top to
bottom. The longest pieces should be the closest to the top, and the shortest
should be farthest away. Try to equally space the fragments in six rows.
11. Glue or tape these fragments to the scrap paper.
12. In order to see the DNA, you must use a probe or marker to show where
it is; otherwise the DNA molecule will be invisible. The probe that you are
using is a GTA probe. Match the probe with its complementary strand on the
DNA by coloring it with a highlighter.
13. Repeat this for each person and the crime scene DNA.
356 Chapter 12
Activity 12.3, continued
14. Make a chart for the DNA fingerprint. Use six rows (numbered 1 through 6)
and seven columns (one per sample). Draw a line in each of the rows where
you find a marker.
15. Can you tell if one of the suspects left the blood at the scene of the crime?
Analysis Questions
1. What are the four steps of DNA fingerprinting?
2. If everyone has A, T, G, and C as the base pairs for their DNA, then how is it
different in each person?
3. What is the complementary sequence for the GTAAG probe?
4. What is the function of the probe?
5. Can you tell if one of the suspects left the blood at the scene of the crime? How?
6. After two cycles, how many copies of the original DNA do you have? After
four cycles? After ten cycles? After 20 cycles?
STR: Short Tandem Repeats
A new technology in the analysis of DNA is short tandem repeats
(STR). This method is becoming more common than RFLP because it
takes less time for the analysis, takes less of a sample size, and is more
exclusionary, which means that it can eliminate
short tandem repeats
more people as possible sources. STRs are locations
(STR): specific sequences of
on the chromosome that repeat a specific sequence
DNA fragments that are repeated at
a particular site on a chromosome
of two to ten base pairs. For the analysis, scientists
The Innocence Project at the Cardozo School of Law began in 1992. Their mission is to
exonerate the wrongfully convicted through postconviction DNA testing and to develop
and implement reforms to prevent wrongful convictions. As of January, 2008, 212 have
been exonerated.
DNA Analysis 357
Eddie Joe Lloyd was convicted in 1985 for the brutal rape and murder of a 16-year-old
Michigan girl. During his imprisonment, Lloyd tried to appeal his sentence but was
unsuccessful. He then contacted the Innocence Project and asked for help in having his DNA
tested against samples remaining from the original crime scene. After thorough analysis,
the truth was revealed. The DNA proved that Lloyd was not responsible for the girl’s death.
In August 2002, after more than 17 years in prison, Lloyd was pardoned and released. His
exoneration was the 110th case of exoneration in U.S. history that was based primarily
on DNA evidence.
identify multiple locations. A variable number of tandem repeats
(VNTR) is also used, identifying repeats of 9 to 80 base pairs. Thousands
of STR sites have been identified. They are located on almost every
chromosome in the human genome. They can easily be amplified, using
PCR, and characterized based on the alleles. Alleles are generally named
by the number of repeats that they contain.
For example, D7S280 is an STR found on human chromosome 7 that
repeats the sequence GATA. The DNA sequence of the representative allele
of this locus is shown below. Find the repeat sequence GATA. How many
repeats are shown on the DNA sequence below? Different alleles of this
locus may have from 6 to 15 tandem repeats of GATA.
1 AATTTTTGTA TTTTTTTTAG AGACGGGGTT
TCACCATGTT GGTCAGGTG ACTATGGAGT
61 TATTTTAAGG TTAATATATA TAAGGGTAT
GATAGAACAC TTGTCATAGT TTAGAACGAA
121 CTAACGATAG ATAGATAGAT AGATAGATAG
ATAGATAGAT AGATAGATAG ATAGACAGAT
181 TGATAGTTTT TTTTTATCTC ACTAATAGT
CTATAGTAAA CATTTAATTA CCAATATTTG
241 GTGCAATTCT GTCAATGAGG ATAAATGTGG
AATCGTTATA ATTCTTAAGA ATATATATTC
301 CCTCTGAGTT TTTGATACCT CAGATTTTAA GGCC1
To identify individuals, forensic scientists can scan 13 DNA regions
that vary from person to person; they then use the data to create a DNA
profi le of that individual. There is an extremely
small chance that another person has the same
STR analysis is now the primary
method for genetic profiling
DNA profi le for a particular set of regions. D7S280
using 4-5 nucleotide repeat
is one of the 13 core CODIS STR genetic loci. The
units. The more STR sites
probabilities of the STRs used can be multiplied
sampled, the more probative the
together to narrow the field of suspects.
genetic profile.
1
The sequence comes from the National Center for Biotechnology Information, a public
DNA database.
358 Chapter 12
Table 12.2: CODIS STRs and Probabilities
STR African American
American Caucasian
D3S1358 0.097
VWA 0.074
FGA 0.036
TH01 0.114
TPOX 0.091
CFS1PO 0.079
D5S818 0.121
D13S317 0.139
D7S820 0.087
D8S1179 0.080
D21S11 0.042
D18S51 0.032
D16S539 0.076
0.080
0.068
0.041
0.080
0.207
0.128
0.166
0.081
0.067
0.069
0.041
0.032
0.091
The 13 standard CODIS STRs that the FBI uses to
maintain their databank and their probability of
identity are given in Table 12.2. Figure 12.8 shows the
location of the chromosomes of the STRs.
If only one STR, D3S1358, were used, the likelihood
that two African American individuals selected at
random would be the same would be 1 in 10.3. Using
Table 12.2 above, the calculation is as follows:
1
⫽ 0.097, with X as the number of individuals in
X
a sample
To solve for X,
X⫽
The FBI Laboratory’s Combined
DNA Index System (CODIS)
blends forensic science and
computer technology into an
effective tool for solving violent
crimes. CODIS lets federal, state,
and local crime labs exchange
and compare DNA profiles
electronically, thereby linking
crimes to each other and to
previously convicted offenders.
As of 2007, it contained over
4.5 million records.
1
⫽ 10.3
0.097
Is this an acceptable probability to be certain that the individual being
tested is guilty of a crime?
What if two STRs were used? Try D3S1358 and FGA. You multiply the two
probabilities together and get:
0.097 ⫻ 0.036 ⫽ .0035
Solving for X,
X⫽
1
⫽ 285.7, or one in 285.7 people
.0035
DNA Analysis 359
Figure 12.8 CODIS STR loci
CSI effect: “Every case requires
DNA analysis.” Because it is
time-consuming and costly
(several thousand dollars), DNA
testing often isn’t used, even in
some cases that might call for
it. A report commissioned by
the Department of Justice found
that 540,000 criminal cases
were still awaiting biological
evidence testing in 2004. Recent
developments in microchip
DNA analysis, “lab-on-a-chip,”
will surely decrease costs and
turnaround time.
See CSI effect information at the
beginning of the book.
The probability is getting better, but it’s still not
good enough. Forensic scientists will use several of
the STR sites to continue to narrow the possible
field of suspects. If all 13 STRs are used to profi le an
individual, multiplying all probabilities together can
narrow the field, or frequency of occurrences, to one
in billions.
The FBI maintains a forensic index that has DNA
profiles from crime scene evidence and an offender
index with DNA profiles of individuals convicted
of sex offenses and other violent crimes. All 50
states have become users and contributors to
the indices.
Matches made among profi les in the forensic index
can link crime scenes together, possibly identifying
repeat offenders. Based on a match, police in different jurisdictions can
coordinate their investigations and share the leads they have developed
360 Chapter 12
independently. Matches made between the forensic and offender indexes
provide investigators with the identity of the perpetrator(s). After CODIS
identifies a potential match, qualified DNA analysts in the laboratories
contact each other to validate or refute the match.
A pharmaceutical company suspected that sensitive data were taken from a computer
authorized to only one user. Because of the importance of the information in the
computer, an investigation was opened. To determine whether anyone other than the
authorized user had used the computer, the investigators proposed that DNA analysis
be performed on the trace evidence (hair and skin) found on the keyboard. Three STR
loci were amplified (D18S535, D1S1656, and D10S2325) using polymerase chain
reaction. The results indicated the existence of DNA in the samples from more than
one person.
—from the FBI Forensic Laboratory report of 2004
Mitochondrial DNA
Another structure in the cell that contains DNA is the mitochondria.
The mitochondria are considered the powerhouses of the cell, providing
90 percent of the energy a human needs to function.
Each cell contains thousands of mitochondria, each containing several
loops of DNA with 15,000–17,000 base pairs. Unlike nuclear DNA,
which is found on the chromosomes inherited from mother and father,
mitochondrial DNA (mtDNA) is inherited only from the mother. There
is usually no change in mtDNA from parent to offspring. This means
that individuals with the same maternal lineage are indistinguishable if
mitochondrial DNA is used for analysis.
The techniques scientists use to characterize mitochondrial
GO TO
DNA are significantly more sensitive than the techniques
TOPIC
for profi ling nuclear DNA; however, analysis for mtDNA
is more costly and takes considerably more time. An
CODE
advantage of mtDNA testing is that it can be done with
small and degraded quantities of DNA. Cases in which
hairs, bones, or teeth are the only evidence retrieved from a crime scene are
particularly well-suited to mtDNA analysis. Hairs recovered at crime scenes
can often be used to include or exclude individuals. Application to missing
persons cases is possible when skeletonized remains are recovered and
compared to samples from the deceased person’s maternal relatives. The
FBI maintains one of the few labs that perform mtDNA testing.
www.scilinks.org
mitochondrial
DNA
forensics2E361
DNA Analysis 361
Nuclear pore
Nuclear envelope
Chromatin
Nucleoplasm
Nucleolus
Cilia
Nucleus
Plasma membrane
Smooth endoplasmic
reticulum
Golgi
apparatus
Microvilli
Polyribosome
Fixed
ribosome
Rough
endoplasmic
reticulum
Secretory
vesicle
Exocytotic
vesicle
Lysosome
Cytoskeleton
Mitochondrion
Cytoplasm
Peroxisome
Microfilaments
Free ribosomes
Centrioles
Microtubules
Figure 12.9 Cell diagram
In December 2001, a young woman was reported missing in Anchorage, Alaska, by her
boyfriend—but she was not to be found despite all efforts. Finally, in May 2003, her
mother submitted a saliva swab sample to the FBI for analysis; we determined its nuclear
DNA and mtDNA profiles and entered it into our Combined DNA Index System for use
in the FBI’s National Missing Person DNA Database. It was there, ready for matching,
when hikers discovered the severely decomposed remains of a body on Alaska’s Seward
Highway that June. First, though, another agency believed the remains might match its
ongoing arson case. It had a nuclear DNA profile developed from the remains—but no
match! Then the Alaska crime lab and the FBI’s nuclear DNA lab got a hit between the
mother’s nuclear DNA and the Alaska remains, showing a possible biological relationship.
Our lab conducted mtDNA analysis on the remains, compared it to the mother’s profile,
and found the match. The remains were identified by the coroner, and the case was solved.
—from 2004 FBI report
362 Chapter 12
12.1: The Green River
Killer Case
The Green River Killer’s slaying spree began in 1982, when women
in the Seattle area, mainly runaways and prostitutes, were reported
missing. The first victims turned up near the banks of
the Green River south of Seattle, giving the killer his
nickname.
The remains of dozens of women turned up near Pacific
Northwest ravines, rivers, airports, and freeways in
the 1980s. Investigators officially listed 49 of them
as probable victims of the Green River Killer. Police
investigators were baffled and unable to identify any
suspects in the case.
In April of 2001, almost 20 years after the first known
Green River murder, Detective Dave Reichert of Seattle
began renewed investigations into a series of murders. He
refused to let go of the case and remained determined to
find the killer. This time the task force had technology on
their side.
Reichert formed a new task force team, initially consisting
of six members, including DNA and forensic experts
and detectives. It wasn’t long before the force grew to
more than 30 people. All the evidence from the murder
investigation was reexamined, and some of the old
forensic samples were sent to the labs.
The first samples to be sent to the lab were found with
three victims who were murdered between 1982 and 1983. The
samples consisted of semen supposedly left by the killer. The semen
samples underwent a newly developed DNA testing method and were
compared with samples taken from Gary Ridgway in April of 1987.
Gary Ridgway
Here is another example of old evidence
catching up to new developments in
science. Most important, that evidence
is saved, awaiting new science and cold
case investigators.
On September 10, 2001, Reichert received news from the labs that
there was a match found between the semen samples taken from
the victims and Ridgway. On November 30 Ridgway was stopped by
investigators on his way home from work and arrested on four counts of
aggravated murder. He eventually confessed to the murder of 48 women.
DNA Analysis 363
Checkpoint Questions
Answer the following questions. Keep the answers in your
notebook, to be turned in to your teacher at the end of the unit.
1. Where are chromosomes located?
2. Where are genes located?
3. What is the difference between a gene and a
chromosome?
4. What is the purpose of the Human Genome Project?
5. Where in the cell is DNA located?
6. Name the four bases that pair together in the DNA
molecule.
7. With all of the base pairs in DNA, why is
deoxyribonucleic acid not called deoxyribonucleic
base?
8. What evidence at a crime scene can be used for DNA
fingerprinting?
9. What do the letters RFLP stand for in DNA
fingerprinting?
10. What is the function of a restriction enzyme?
11. In RFLP, are the sequences of the base pairs the
same in fragments that are the same length?
364 Chapter 12
12. What is the advantage in the use of PCR for DNA
found at a crime scene?
13. How is the DNA molecule divided in RFLP? In PCR?
14. What is used to divide the DNA molecule in RFLP?
In PCR?
15. What is the function of a primer?
16. What is the function of a probe?
17. What is CODIS, and who uses it?
18. What is the difference between the forensic index
and the offender index?
19. What type of evidence is the source for
mitochondrial DNA?
20. From whom is nuclear DNA inherited? From whom is
mitochondrial DNA inherited?
DNA Analysis 365
Project: Both Sides of the Issue;
Establishment of a DNA Databank
Write a paper analyzing the arguments for and against the establishment
of a DNA databank. To gain an understanding of both sides of the issue,
and to get experience in identifying and defending the side of the issue you
disagree with, structure your paper in the following way:
TITLE: Should the United States Government Establish a DNA
Databank for All Citizens?
AUTHOR: Your name
INTRODUCTION: Write one or two paragraphs briefly explaining what
a DNA databank is and the controversy surrounding the issue.
PRO SIDE: Write one sentence stating that the United States should
establish a DNA databank for all citizens.
SUPPORT: Write a short statement of why there should be a DNA
databank. Write at least three paragraphs supporting the statement,
using at least three different sources.
CON SIDE: Write one sentence stating that the United States should
not establish a DNA databank for all citizens.
SUPPORT: Write a short statement of why there should not be a DNA
databank. Write at least three paragraphs supporting the statement,
using three different sources.
PERSONAL OPINION: Write your views and conclusions based on the
above arguments. You must support one side or the other.
WORKS CITED: List references for all the sources you have used.
366 Chapter 12
References
Books and Articles
Websites
BSCS Biology: An Ecological Approach (9th ed.).
Dubuque, IA: Kendall/Hunt, 2002.
Eckert, W. C. Introduction to Forensic Sciences
(2nd ed.). Boca Raton, FL: CRC Press, 1997.
The Evaluation of Forensic DNA Evidence.
Washington, D.C.: National Academy Press,
1996.
Mader, S. Biology (7th ed.). New York: McGraw-Hill,
2001.
Here are several good interactive sites:
www.pbs.org/wgbh/pages/frontline/shows/case;
“The Case for Innocence”
www.pbs.org/wgbh/nova/sheppard/analyze.html;
“Create a DNA Fingerprint”
www.virtualmuseum.ca/Exhibitions/Myst; “Interactive
Investigator”—virtual exhibit on forensic science
www.thirteen.org/edonline/ntti/resources/lessons/
ladder; “The Ladder of Life”
www-ceprap.ucdavis.edu/Software/VDNA/vdna.cfm;
virtual DNA fingerprinting laboratory
www.pbs.org/wgbh/pages/frontline/shows/dna;
“What Jennifer Saw”—relates to Ronald Cotton
misidentification (see Chapter 2)
www.ornl.gov/sci/techresources/Human_Genome/elsi/
forensics.shtml; about DNA technologies
www.scientific.org/tutorials/articles/riley/riley.html;
good explanation of DNA replication, analysis, etc.
DNA Analysis 367