TISSUE-SPECIFIC STEM CELLS
Adult Stem Cells Exhibit Global Suppression of RNA Polymerase II
Serine-2 Phosphorylation
RASMUS FRETER,a MASATAKE OSAWA,b SHIN-ICHI NISHIKAWAa
a
Ludwig Institute for Cancer Research, Nuffield Department of Clinical Medicine, University of Oxford,
United Kingdom; bCutaneous Biology Research Center/Center for Regenerative Medicine, Massachusetts General
Hospital/Harvard Medical School, Massachusetts, USA
Key Words. Adult stem cells • Quiescence • mRNA transcription • Cyclin-dependent kinase 9
ABSTRACT
Adult stem cells, which are characterized by their
capacity for self-renewal and differentiation, participate
in tissue homeostasis and response to injury. They are
thought to enter a state of relative quiescence, known as
reversible cell cycle arrest, but the underlying molecular
mechanisms remain poorly characterized. Previous data
from our laboratory has shown that housekeeping gene
expression is downregulated in melanocyte stem cells
(MelSCs), suggesting a global suppression of mRNA
transcription. We now show, using antibodies against
specific phosphorylated forms of RNA polymerase II
(RNApII), that adult MelSCs do not undergo productive
mRNA transcription elongation, while RNApII is activated and initialized, ready to synthesize mRNA upon
stimulation, and that the RNApII kinase CDK9 is absent
in adult MelSCs. Interestingly, other adult stem cells
also, including keratinocyte, muscle, spermatogonia, and
hematopoietic stem cells, showed a similar absence of
RNApII phosphorylation. Although it is difficult to show
the functional significance of this observation in vivo,
CDK9 inhibition resulted in enhanced survival of cells
that are deprived from survival factors. We conclude
that the absence of productive mRNA transcription is
an early, specific, and conserved characteristic of adult
stem cells. Downregulation of mRNA transcription may
lead to decreased rates of metabolism, and protection
from cellular and genetic damage. Screening heterogeneous tissues, including tumors, for transcriptionally quiescent cells may result in the identification of cells with
stem cell-like phenotypes. STEM CELLS 2010;28:1571–1580
Disclosure of potential conflicts of interest is found at the end of this article.
INTRODUCTION
Adult stem cells have the unique ability to undergo sustained
self-renewal and differentiation, which is essential for tissue homeostasis and response to injury. These cells are resistant to cytotoxic stress but retain the capacity for activation upon stimulation. Although active induction and maintenance of quiescence
are thought to be key mechanisms underlying these features of
the stem cell system, their molecular basis is unresolved.
Quiescence is commonly defined as a reversible exit from
the cell cycle. Quiescent stem cells have been analyzed in terms
of their cell cycle regulation [1], control of cellular metabolism
[2] and interaction with their special microenvironment, the
niche [3], but analysis of their general transcriptional machinery
has been scarce. In other quiescent cell systems, such as those
induced by serum starvation [4, 5], resting lymphocytes [6, 7]
and yeast cells in the stationary phase [8, 9], the global suppression of mRNA synthesis has been implicated as a factor in quiescence and the control of cell cycle and metabolism.
The mRNA transcription cycle of transcription initiation
and elongation, and the subsequent release of RNA polymer-
ase II (RNApII) from the DNA is tightly regulated by phosphorylation of the C-terminal domain (CTD) of RNApII [10,
11]. The CTD of mammalian RNApII is composed of 52
repeats of the consensus sequence YS2PTS5PS. Transcription
initiation requires phosphorylation of Serine five (Ser5) of the
CTD by TFIIH, consisting of CDK7 and CyclinH. Phosphorylation of Serine two (Ser2) of the CTD by p-TEFb, a heterodimer of CDK9 and Cyclin T1, T2, or K, triggers productive
transcription elongation, mRNA processing, and the release of
the mature mRNA [12, 13]. Ser2 phosphorylation and transcription elongation is the critical target for eukaryotic gene
expression [14, 15]. Inhibition of CDK9 function by 5,6dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) or flavopiridol results in degradation of most mRNA [15] and induces
apoptosis [16, 17]. Similarly, knockdown of CDK9 results in
complete absence of mRNA synthesis and embryonic lethality
[18, 19].
Most cells, including terminally differentiated and senescent cells, actively synthesize mRNA. In these cells, RNApII
is phosphorylated on both Ser2 and Ser5, independent of the
cell cycle [20, 21]. Quiescent cells, such as primary T lymphocytes, are characterized by an almost complete absence of
Author contributions: R.F.: conception and design, collection and/or assembly of data, data analysis and interpretation, manuscript
writing; M.O.: conception and design, final approval of manuscript; S.-I.N.: conception and design, data analysis and interpretation,
manuscript writing, final approval of manuscript.
Correspondence: Rasmus Freter, Ludwig Institute for Cancer Research, Nuffield Department of Clinical Medicine, University of Oxford,
United Kingdom; e-mail: [email protected] Received February 22, 2010; accepted for publication June 24, 2010; first
C AlphaMed Press 1066-5099/2009/$30.00/0 doi: 10.1002/stem.476
published online in STEM CELLS EXPRESS July 16, 2010. V
STEM CELLS 2010;28:1571–1580 www.StemCells.com
Reduced RNApII Ser2 Phosphorylation in Stem Cells
1572
RNApII phosphorylation [7, 21]. RNApII in yeast cells in the
stationary phase [8, 9] or on Drosophila species heat shock
genes [12, 22] is phosphorylated on Ser5, but not on Ser2. In
this situation, the rapid activation of gene transcription is possible upon stimulation, such as the addition of nutrients or
heat shock. Taken together, analysis of the specific phosphorylated sites in RNApII reveals phases of productive mRNA
elongation or paused mRNA transcription initiation.
Melanocyte stem cells (MelSCs) are defined as Dct-positive and c-Kit signaling-independent cells in the lower permanent portion of the hair follicle [23, 24]. Previous data from
our laboratory showed that several housekeeping genes,
including GapDH, ActB, ActG, and Aldoa, are expressed at a
lower level in MelSCs [24]. Additionally, MelSCs show
repression of the CAG housekeeping gene promoter, as well
as smaller cell size [25]. These findings prompted us to test if
mRNA transcription is globally downregulated in MelSCs.
In this study, we show that RNApII Ser2 phosphorylation,
reflecting productive mRNA transcription elongation, is absent
in adult MelSCs in the lower permanent portion of the hair
follicle, while mRNA transcription initiation is activated. In
line with this, CDK9 protein and mRNA were downregulated
in adult MelSCs. Interestingly, other adult stem cell systems,
including hematopoietic, keratinocyte, spermatogonia, and
muscle (satellite) stem cells, showed similar absence of RNApII Ser2 phosphorylation, suggesting a conserved mechanism
of transcriptional quiescence in various stem cells.
MATERIALS
AND
METHODS
Tissue Preparation and Antibody Staining
Mice of the indicated age were sacrificed by CO2 asphyxiation,
shaved, and their back skin (for staining of melanocytes and keratinocytes), testis, or muscle tissue dissected by scissors. Tissue
was fixed in 4% PFA in PBS at 4 C overnight, washed twice
with PBS, and dehydrated in 20% sucrose at 4 C overnight.
Tissue was mounted in frozen section medium (Richard-Allen
Neg-50) and snap-frozen in liquid nitrogen. Sections were cut at
12 lm with a Leica CM3050S cryostat, air-dried, and blocked
for 30 minutes with 2% Skim Milk (BD Difco) in PBS containing 0.1% Triton X-100 (PBS-T). Primary antibodies were diluted
in blocking solution and added onto the slides at 4 C overnight.
Antibodies used were rabbit anti-RNA polymerase II CTD repeat
YSPTSPS (phospho S2) (Abcam ab5095) at 1/500 dilution, rabbit anti-RNA polymerase II CTD repeat YSPTSPS (phospho S5)
(Abcam ab5131) at 1/50 dilution, goat anti-Trp2 (D-18, sc10451, Santa Cruz) at 1/250 dilution, rabbit anti-CDK9 (H-169,
sc-8338, Santa Cruz) at 1/50, rabbit anti-Ccnt1 (H-245, sc10750, Santa Cruz) at 1/250 dilution, rat anti-CD9 (KMC8, BD
Pharmingen) at 1/500, rat anti-c-Kit (Ack4, purified in our laboratory) at 1/250, rat anti-GFP (GF090R, Nacalai Tesque) at
1/500, rat anti-CD34 (RAM34, Ebiochem) at 1/250, rat antiCD45 (30-F11, BD Pharmingen) at 1/1,000, rat anti-NCAM
(H28.123, Millipore) at 1/50, rat anti-CD71 (R17217, eBioscience) at 1/1,000. Three times the slides were washed with
PBS-T for 10 minutes, and appropriate secondary antibodies conjugated with Alexa 488 or Alexa 546 (Invitrogen, 1/500 dilution)
as well as TO-PRO3 (Invitrogen, 1/1,000 dilution) were applied
to the slides, stained for 1 hour at room temperature, three times
the slides were washed with PBS-T for 10 minutes and mounted
using ProLong Gold Antifade (Invitrogen).
Antibody Specificity
Blocking of anti-CTD-Ser2 phosphorylation (Ser2-P) and Ser5-P
was performed by incubation of primary antibodies with 1 lg/ml
YSPTSPS peptide phosphorylated at Ser2 or Ser5 (Abcam
ab12793 and ab18488, respectively) at 37 C for 30 minutes with
shaking. Preincubation of anti-Ser5-P antibody with a synthetic
CTD-Ser2-P peptide resulted in a strong staining, which was
completely blocked by preincubation with a CTD-Ser5-P peptide
(Supporting Information, Fig.S1A, C). Similarly, the signal from
anti-CTD-Ser2-P antibody could be blocked by preincubation
with CTD-Ser2-P peptide, but not with CTD-Ser5-P peptide
(Supporting Information, Fig. S1B, S1D). Moreover, serum starvation of NIH 3T3 cells greatly diminished signal from anti-Ser2P antibody, which was regained after serum restimulation (Supporting Information, Fig. S2A–S2C). This increase in signal could
be blocked by treatment with the CDK9 inhibitor DRB (100 lM),
both in cell culture and western blot (Supporting Information,
Fig.S2D, S3F). We conclude that these antibodies enable the specific and sensitive detection of CTD-phosphorylation.
Cell Culture
Isolation and culture of primary melanoblasts was performed
as described previously [26]. Briefly, skin from E15.5 CAGCAT-eGFP x Dct-Cre mouse embryo was dissected and trypsinized. GFP positive melanoblasts were sorted and cocultured
on mitomycin C-treated XB2 feeder cells in the presence of
bFGF and SCF. CDK9 inhibition and c-Kit starvation was
performed by washing the cells and adding DRB (10 lM final
concentration) 30 minutes prior to addition of Ack2-5 lg/ml
final concentration overnight. Percentage of surviving cells
was calculated as number of GFP positive cells in DRBtreated versus DMSO-treated condition.
3T3 fibroblasts were maintained in Dulbecco’s modified
Eagle’s medium (DMEM) þ10% FCS. Cells were cotransfected with Venus reporter plasmid and expression plasmids
(pCMV) containing dominant negative CDK9 (D167N [27]) or
wild-type CDK9 and Ccnt1 separated by a 2A peptide (pTEFb).
Forty-eight hours after transfection, serum starvation was performed by washing and replacing medium with DMEM þ0.1%
FCS for 4 hours. mRNA was isolated using RNeasy columns
(Qiagen). Alexa 647-conjugated anti-Annexin V staining was
performed according to instructions, and the number of
Annexin V positive cells was counted by FACS Canto.
FACS Sorting and Quantitative Reverse
Transcription Polymerase Chain Reaction
Analysis
Quantitative polymerase chain reaction (qPCR) of FACS-sorted
MelSC and differentiated melanocytes cDNA libraries was performed after reverse transcription of mRNA isolated from
GFPhigh SSChigh (differentiated melanocytes) and GFPlow
SSClow (MelSC) [24] cells using oligo-dT30 primer. One-step
quantitative reverse transcription (qRT)-PCR with gene-specific
primers was conducted according to manufacturer’s instructions
(Qiagen) on GFP positive cells at p10 after or without Ack2
injection (MelSC and differentiated melanocytes respectively).
Primer sequences are available upon request.
FACS sorting and staining of CD34 KSL cells were performed after red blood cell lysis (PharmLyse, BD Biosciences) and lineage (CD4, CD8, CD11b, Ter119, GR-1, B220)
depletion using biotin-conjugated primary antibodies (BD
Pharmingen) and streptavidin-conjugated magnetic beads
(Biomag, Qiagen) according to manufacturer’s instructions.
FACS sorting was performed on a BD FACS Aria, using lineage-biotin primary and streptavidin-PE-Cy7 secondary antibodies, PE-conjugated anti-Sca-1, APC-conjugated anti-c-Kit,
FITC-conjugated anti-CD34 (all BD Pharmingen), and PI for
dead cell discrimination. CD34 c-Kitþ Sca-1þ Lin PI and
CD34þ c-Kitþ Sca-1þ Lin PI cells were isolated and sorted
Freter et al.
1573
separately onto a cooled Collagen type 1-coated two-well cell
culture slide (BD BioCoat). The slides were incubated at
37 C for 1 hour in a moisturized hybridization chamber, fixed
by adding 4% PFA at room temperature for 5 minutes,
washed (three times) with PBS 10 minutes, blocked by 2%
Skim Milk in PBS-T for 30 minutes, and incubated with primary antibodies at 1/1,000 dilution at 4 C overnight. Further
washes, secondary antibodies, and mounting were performed
as aforementioned. Images were captured with a LSM510
scanning module equipped Zeiss Axiovert 200M microscope
and analyzed with ImageJ and Excel.
Transgenic Mouse
Full-length CDK9 mRNA was obtained from MGC (IMAGE:
3601310), PCR amplified with the forward primer 50 GGCGC
GCCACCATGGATTACAAGGATGACGACGATA AGATGG
CCAAGCAGTACGACTC 30 and reverse 50 GGCGCGCCTCA
GAAGACAC GTTCAAATTCC 30 , resulting in addition of Asc1
sites at both ends, a Kozak sequence and N-terminal FLAG tag.
The purified PCR product was digested and ligated into modified
pROSA26-1 including a neo-stop cassette and IRES-eGFP [28].
TT2 embryonic stem cells were electroporated with linearized
vector and subjected to neomycin selection. Individual resistant
colonies were subjected to Southern blotting with external and internal probes. Correctly targeted colonies were transiently transfected with a pPGK-Cre plasmid, and expression of CDK9
mRNA fused to ROSA26 mRNA was confirmed by sequencing
of the RT-PCR product. Chimeric mice raised by morula aggregation were crossed to C57BL/6, backcrossed to Bl/6 for three generations, before crossing to Dct-Cre mouse [23]. K14-SCF [29]
and CAG-CAT-eGFP [30] mouse have been described previously.
All animal experiments were performed in accordance with the
guidelines of the RIKEN Center for Developmental Biology for
animal and recombinant DNA experiments.
RESULTS
Active Downregulation of CTD-Ser2-P in
Developing MelSCs
We previously reported a dramatic reduction in mRNA transcription in MelSC [24]. In this study, we investigated
whether or not this reduction of gene transcription involves
the alteration of RNApII CTD phosphorylation.
Staining of postnatal day (p) 28 back skin sections for
CTD-Ser2-P showed a complete absence of productive
mRNA transcription elongation in Trp2-positve MelSC compared with surrounding cells (Fig. 1A, arrowheads), suggesting a specific and active induction of MelSC quiescence
rather than growth factor deprival, which would affect surrounding cells as well. However, MelSC were strongly positive for CTD-Ser5-P (Fig. 1B, arrowheads), indicating a
paused state with a rapid reactivation of mRNA transcription
possible. Differentiated melanocytes in the bulb region were
positive for both CTD-Ser2-P and Ser5-P (Fig. 1C and 1D).
One criteria of adult MelSC is their survival after injection of
antagonistic c-Kit antibody at p0 [23], indicating that MelSC development is completed at early postnatal days. We analyzed the
level of CTD-Ser2-P during embryogenesis, and found that
migrating melanoblasts at embryonic day 14.5 (E14.5, Fig. 1E)
and melanocytes homing to hair follicles (E16.5, Fig. 1F) stained
positive for CTD-Ser2-P. However, downregulation of mRNA
synthesis begins in some MelSCs in guard hair follicle of ICR
mouse as early as E18.5 (Fig. 1G, filled arrowhead). At postnatal
day 0 (p0) all MelSCs in guard hairs of ICR mouse are negative
for CTD-Ser2-P (Fig. 1H). Of note, MelSC in Bl/6 downregulate
www.StemCells.com
Figure 1. Absence of mRNA transcription elongation in adult melanocyte stem cells. Staining of postnatal day (p) 28 mouse backskin
for RNA polymerase II C-terminal domain (CTD) Ser2-P (green) and
the melanocyte marker Trp2 (red) shows complete absence of mRNA
transcription elongation in melanocyte stem cells (MelSCs) ([A],
arrowheads) compared with surrounding cells. Asterisks denote dead
cells in the hair follicle. Note that MelSCs show strong signal for
mRNA transcription initiation (Ser5-P in green, arrowheads in [B]).
Differentiated melanocytes in the hair bulb are positive for both
mRNA transcription elongation and initiation (C, D). Migrating melanoblasts at embryonic day (E) 14.5 (E) as well as melanoblasts in
developing hair follicles at E16.5 (F) are positive for CTD-Ser2-P
(arrowheads). In E18.5 guard hair follicles of ICR mouse, some Trp2
positive cells at the lower permanent portion of the hair follicle start
to downregulate mRNA elongation (filled arrowhead in [G]), while
some are still positive (open arrowhead, [G]). At p0, all MelSCs in
guard hair follicle of ICR mouse are negative for CTD-Ser2-P (arrowheads, [H]). CTD phosphorylation in green, Trp2 in red. Scale bar ¼
20 lm (A–F), Scale bar ¼ 50 lm (G, H). Abbreviations: Ser2-P, serine 2 phosphorylation; Trp2, tyrosinase related protein 2.
1574
Reduced RNApII Ser2 Phosphorylation in Stem Cells
CTD-Ser2 later (p2, see Fig. 2D), possibly due to slower development, as reflected by smaller size at birth [31].
Suppression of CTD-Ser2-P Is Independent
of SCF Signaling
For many cell types, the first event leading to the induction of
quiescence is deprivation of cell survival factors. In embryonic melanoblasts, SCF/c-Kit signaling is essential for migration and survival of embryonic melanoblasts. A previous
study from our laboratory demonstrated that downregulation
of SCF from neonatal keratinocytes coincides with induction of MelSC [32]. To investigate whether or not downregulation of SCF is required for the repression of CTD-Ser2-P,
we took advantage of K14-SCF transgenic mouse as a model
system. Overexpression of SCF under control of the keratin14
promoter (K14-SCF) results in a massive increase in the number of adult melanocytes [29]. However, all adult MelSCs in
K14-SCF mouse are negative for CTD-Ser2-P phosphorylation (Fig. 2A, arrowheads), suggesting that neither induction
nor reactivation of quiescent MelSCs depends on SCF/c-Kit
signaling, as this is constitutively expressed in K14-SCF
mouse. We analyzed the time-course of MelSC quiescence
induction in K14-SCF mouse. At the day of birth, all MelSCs
were positive for CTD-Ser2-P (Fig. 2Bi and 2Ci). At p2,
CTD-Ser2-P is downregulated in both wild-type and K14-SCF
mouse (Fig. 2Bii and 2Cii). Unexpectedly, we observed a
clear increase in CTD-Ser2-P at p4 in K14-SCF mouse only,
whereas MelSCs in wild-type littermates remained quiescent
(Fig. 2Biii and 2Ciii). At p6 and p8, MelSCs in both wildtype and mutant mouse were quiescent again (Fig. 2Biv, 2Bv,
2Civ, 2Cv, quantification in 2D). Of note, expression of endogenous SCF in keratinocytes is downregulated at p4 in
wild-type [32]. This suggests that a short-lived signal has a
beneficial effect on the induction of MelSC quiescence at p2,
which is overridden by sustained SCF signaling at p4 in K14SCF mouse. However, this activated state is not sustained by
an active signal inducing MelSC quiescence at p6, suggesting
that induction and maintenance of MelSC quiescence are
regulated by different pathways at different times during
development.
Downregulation of CDK9 in MelSCs
To gain an insight into the mechanism underlying low CTDSer2-P in MelSC, we analyzed expression of the CTD-Ser2
kinase p-TEFb, consisting of a heterodimer of CDK9 and a
Cyclin partner (T1, T2, or K). Endogenous inhibitors of
CDK9 activity, or the absence of CDK9 itself, may cause dephosphorylation of CTD-Ser2. To test these possibilities, we
analyzed expression of CDK9 during MelSC development. As
shown in Figure 3A and 3B, we observed numerous MelSCs
that were already low in Ser2-P (Fig. 1H), but which
expressed a normal level of CDK9 at p0 in ICR mouse.
When we observed the expression of Cyclin T1 protein
(Fig. 3C) and mRNA (Fig. 3E) in adult MelSCs, the level of
the CDK9 protein was reduced in adult MelSC compared
with surrounding cells (Fig. 3D). In line with this, CDK9
mRNA was specifically downregulated in MelSC compared
with differentiated cells (Fig. 3E). To our knowledge, this is
the first report of the absence of CDK9 protein in any cell
type. This data suggests strongly that global transcriptional
suppression occurs before CDK9 downregulation, which is an
outcome rather than cause of global transcriptional
suppression.
Embryonic melanoblasts as well as transit amplifying and
terminally differentiated melanocytes depend on SCF/c-Kit
signaling for migration, proliferation and survival. Injection of
an antagonistic c-Kit antibody (Ack2) into newborn mice
Figure 2. Biphasic induction of melanocyte stem cell (MelSC) quiescence. Transgenic mouse over expressing SCF from the K14 promoter in
skin display an increased number of MelSCs (Trp2 in red, [A]). However,
all MelSCs are negative for mRNA transcription elongation (green, arrowheads, [A]). During development, both K14-SCF and C57Bl/6 wild-type littermates show positive signal for C-terminal domain (CTD)-Ser2-P (green)
at the day of birth (p0, arrowheads in Bi, Ci) and downregulation at p2 (Bii,
Cii). At p4, however, MelSC in K14-SCF mouse displays a strong positive
staining for mRNA transcription elongation (Ciii, arrowheads), while
MelSCs in wild-type mouse remain quiescent (Biii). Subsequently, mRNA
transcription is downregulated in MelSCs of wild-type and mutant mouse
(p6 in B/Civ, p8 in B/Cv). Scale bar ¼ 20 lm in (A), 5 lm in (B, C). Quantification of data from (B, C) is shown in (D). A total of 20 hair follicles of
three mutant and three wild-type mouse of each age were measured for
CTD-Ser2-P in MelSC. To avoid out-of-focus effects, quantification was
performed by normalizing CTD-Ser2-P signal to nuclear signal and plotting
the signal ratio from MelSCs as percent of control surrounding cells set to
100%. **, p < 104; ***, p < 105. n denotes the total number of MelSCs
counted. Abbreviations: K14-SCF, SCF expression from Keratin 14 promoter; Ser2-P, serine 2 phosphorylation; Trp2, tyrosinase related protein 2.
Freter et al.
1575
Figure 3. CDK9 downregulation in adult
MelSC. p-TEFb, consisting of a heterodimer of
Ccnt1 and CDK9, is the major kinase responsible for C-terminal domain (CTD)-Serine 2
phosphorylation (Ser2-P). CDK9 is expressed
in p0 ICR hair follicles ([A], magnification in
[B]). Although Ccnt1 protein was detected in
p28 adult MelSC (Ccnt1 in green, arrowheads
in [C]), CDK9 protein was absent in MelSCs,
but expressed in all surrounding cells (CDK9
in green, arrowheads in [D]). Quantitative polymerase chain reaction showed a threefold
lower expression of CDK9 mRNA in MelSC
compared with differentiated melanocytes,
while the level of Ccnt1 was similar between
the two populations ([E], *, p < .05, n ¼ 6
experiments). Serum starvation induces Pol2S2
dephosphorylation in 3T3 fibroblast cells ([F],
FCS) which is regained after restimulation
with FCS (/þFCS). This rephosphorylation
can be inhibited by DRB in a dose-dependent
manner (10 lM and 100 lM DRB). Note that
treatment with 10 lM DRB does not significantly inhibit CTD-Ser2-P in 3T3 cells. Lamin
B1 serves as loading control. Preincubation of
mouse primary embryonic melanoblasts with
10 lM DRB improves survival of anti-c-Kit
(Ack2) treatment in vitro. Representative
FACS plot and quantification of Ack2 treatment in G (n ¼ 7 experiments, *, p < .05).
Trp2 positive Melanoblasts surviving Ack2
treatment without addition of DRB show
decreased staining for C-terminal domain
(CTD)-Serine 2 phosphorylation (Ser2-P) (in
green, Trp2 in red, arrowheads in [H]) compared with cocultured XB2 feeder cells (surrounding cells) in vitro. Data shown as mean
6 SEM. Scale bar ¼ 10 lm in (A), 20 lm in
(B, C, D, H). Abbreviations: DMC, differentiated melanocytes; DMSO, dimethyl sulfoxide;
DRB, 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole; FCS, fetal calf serum; GFP, green fluorescent protein; Mbs, melanoblasts; MelSC,
melanocyte stem cell; SSC, side scatter; Trp2,
tyrosinase related protein 2.
www.StemCells.com
1576
results in complete whitening of the first post natal hair, while
hair color is restored during later hair cycles [23]. This indicates that MelSC are independent of c-Kit signaling and can
reconstitute the whole melanocyte system. To gain functional
insights into CTD-Ser2 dephosphorylation in MelSC, we
treated cultured embryonic GFPþ melanoblasts [26] with
DRB, a well-known inhibitor of CDk9 function. We found an
improved survival of embryonic melanoblasts upon Ack2
treatment in vitro (Fig. 3G), indicating that low inhibition of
CDK9 has a beneficial effect on survival of cells upon deprivation of survival factors. Under this experimental setting,
however, we cannot exclude that cocultured XB2 cells are
affected by DRB treatment as well, and that the observed
effect is indirect. On the other hand, cultured melanoblasts
surviving Ack2 treatment in vitro exhibit a decreased CTDSer2 phosphorylation (Fig. 3H), suggesting that CTD-Ser2 de-
Reduced RNApII Ser2 Phosphorylation in Stem Cells
phosphorylation is necessary for c-Kit independence. Similarly, overexpression of dominant negative CDK9 in 3T3
fibroblasts protected the cells from apoptosis induced by serum starvation (Supporting Information, Fig.S3B), suggesting
that transcriptional quiescence is beneficial for cell survival in
stress conditions.
CDK9 Expression Driven by the Rosa26 Promoter
Is Insufficient to Restore CTD-Ser2-P in MelSCs
To elucidate the function of CDK9 downregulation in
MelSCs, we created Cre-inducible CDK9 overexpressing
mice. The Rosa26 locus was successfully targeted with a
FLAG-tagged CDK9 and IRES-eGFP construct (Fig. 4A and
4B). Expression of GFP and CDK9 mRNA in-frame with
Rosa26 mRNA was confirmed in targeted ES transfected with
a Cre-expression plasmid (Fig. 4C and 4D). However, the
coat color of the third hair cycle of mice double-positive for
Dct-Cre and R26-CDK9 was indistinguishable from Dct-Cre
single-positive mice (Fig. 4E), suggesting that overexpression
of CDK9 in melanocytes does not impair MelSC function.
GFP expression was weak but detectable in MelSCs (Fig. 4G,
arrowheads). Surprisingly, we did not detect phosphorylation
of CTD-Ser2 in MelSC of double knock-in mouse (Fig. 4H),
implicating that expression of CDK9 from the R26 locus is
not sufficient to induce phosphorylation.
Because the level of expression of GFP from Dct-Cre x
R26-CDK9 IRES-eGFP melanocytes was very low, we used
the Dct-Cre x CAG-eGFP background to count the total number of melanocytes and remaining MelSCs after Ack2 treatment. Total melanocyte and MelSC numbers in p10 Dct-Cre
x CAG-eGFP were the same as those in triple Dct-Cre x
CAG-eGFP x R26-CDK9 mouse (Fig. 4F), further suggesting
that overexpression of CDK9 has no effect on melanocyte development or maintenance. Of note, this assay detects melanocytes that underwent Cre-recombination to express eGFP,
suggesting these cells also express CDK9. We confirmed Cre
recombination to be above 60% in Dct-Cre x R26-CDK9
mouse (Fig. 4I).
Figure 4. Overexpression of CDK9 in vivo. CDK9 IRES-eGFP was
knocked-in into the Rosa26 locus and expression in melanocytes induced
by crossing with a Dct-Cre mouse. (A): Scheme of targeting strategy,
with primer P1 on the Rosa26 mRNA and reverse primer P2 on CDK9.
Correct targeting and single integration was confirmed by southern blot.
Band marked ‘‘a’’ represents wild-type, band ‘‘b’’ targeted allele using
external probe, band ‘‘c’’ shows single integration in ES clones 68, 86, and
89 using an internal probe ([B], asterisk marks unspecific background).
GFP positive cells were observed only after Cre-mediated recombination in
clone 68 (C). Reverse transcription polymerase chain reaction (RT-PCR)
and sequencing (not shown) confirms expression of CDK9 in-frame with
Rosa26 mRNA in GFP positive recombined cells using primer P1 and P2
([D], all CDK9 as internal control). Hair color of the third hair cycle of double transgenic R26-CDK9 x Dct-Cre mouse was indistinguishable from
Dct-Cre control mouse ([E], hair cycle induced by epilation, mouse from
ES clone 68). Total number of GFP positive melanocytes and MelSC was
equal between double and triple mutant (F, n ¼ 6–8 mouse). GFP is
expressed in MelSCs (yellow indicates merge of green GFP and red Trp2
signal, arrowheads, [G]). Absence of C-terminal domain (CTD)-Ser2 phosphorylation in MelSCs of double transgenic mouse (Trp2 in red, To-Pro3 in
blue, arrowheads, [H]). Cre recombination efficiency (ratio of GFPþ/
Trp2þ cells) was calculated to be more than 60% (I). One-step quantitative
RT-PCR shows that total CDK9 is repressed in MelSC of Dct-Cre x R26CDK9 mouse ([J], **, p < .005). R26-CDK9 represents around 10% of all
CDK9 and is expressed at lower levels in MelSC compared with differentiated melanocytes (*, p < .05). Data shown as mean 6 SEM. Scale bar ¼
10 lm (G, H, I). Abbreviations: eGFP, enhanced green fluorescent protein;
FLAG, FLAG tag; IRES, internal ribosome entry site; MC, melanocyte;
MelSC, melanocyte stem cell; Ser2-P, Serine 2 phosphorylation; SSC, side
scatter; Trp2, tyrosinase related protein 2.
Freter et al.
1577
Figure 5. C-terminal domain (CTD)-Ser2-P is commonly suppressed in adult stem cells. Staining with the keratinocyte stem cell (KSC) marker
CD34 showed KSC are also low for mRNA transcription elongation (bracket, [A]). Muscle satellite cells, positive for NCAM ([B], red), showed
a similar decrease in CTD-Ser2-P. CD9 positive spermatogonia cells attached to the basal lamina were negative for CTD-Ser2-P ([C], filled
arrowheads), while CD9 positive cells detaching from the lamina started to upregulate CTD-Ser2-P ([C], open arrowheads). c-Kit positive transit
amplifying spermatogonia were positive for CTD-Ser2-P (D). CD34þ KSL cells, characterized as short-term repopulating HSCs, are homogeneously high positive for CTD-Ser2-P (E). Around three-fourth of long-term repopulating CD34-KSL cells are CTD-Ser2-P high positive ([F], open
arrowheads), while one-fourth is negative for mRNA elongation ([F], filled arrowheads). Quantification of HSC is shown in (G). The ratio of
CTD-Ser2-P versus nuclear signal was plotted as a histogram. CD34- KSL cells (black bars) show a shift toward lower CTD-Ser2-P values. Data
shown is cumulative of three experiments. *, p < .05, total cell number 700 cells of each population, error bars mean 6SEM. (H): Quantification of CTD-Ser2-P staining for MelSCs, KSCs (CD34 and K15), satellite cells (NCAM and Mcad), spermatogonia stem cells (CD9 and EpCAM)
and HSCs. CTD-Ser2-P/nuclear signal of equal numbers of surrounding cells was set to 100%, black bars represent CTD-Ser2-P/nuclear signal of
stem cells positive for the respective marker. E values at the top denote p-value of student’s t-test, n ¼ number of cells of each population. Scale
bars ¼ 50 lm (A), 20 lm (B–D) and 10 lm (F, E). Abbreviations: EpCAM, epithelial cell adhesion molecule; HSC, hematopoietic stem cell;
KLS, c-Kit- Sca1- lin- cells; MelSC, melanocyte stem cell; NCAM, neural cell adhesion molecule; Ser2-P, Serine 2 phosphorylation.
The total level of CDK9 was significantly lower in
MelSCs in Dct-Cre x R26-CDK9 mouse compared with differentiated melanocytes (Fig. 4J). Furthermore, expression of
R26-CDK9 was diminished in MelSC, suggesting that, as
with other housekeeping gene promoters, the Rosa26 locus is
repressed in MelSC.
CTD-Ser2-P in Other Stem Cell Types
During the imaging of MelSCs for CTD-Ser2 staining, we
observed a distinct zone of CTD-Ser2-low cells in the bulge
region of adult hair follicles. Staining with the keratinocyte
stem cell (KSC) marker CD34 [33] (Fig. 5A, bracket) and K15
[34] (not shown) proved that these CTD-Ser2 low cells are
KSCs. To determine whether this phenomenon in MelSCs and
KSCs is active in other quiescent stem cells, we tested other
adult stem cell systems, including muscle stem cells (satellite
cells) positive for NCAM [35] (Fig. 5B, arrowhead), and MCadherin [36] (not shown), spermatogonia stem cells positive
for CD9 [37] (Fig. 5C) and EpCAM [38] (not shown) and
www.StemCells.com
hematopoietic stem cells, defined as CD34-KSL cells [39]
(Fig. 5F). We observed that some of these stem cell marker positive cells showed significant absence of CTD-Ser2-P (quantification in Fig. 5H). Some CD9 positive spermatogonia stem
cells showed very low levels of CTD-Ser2-P (Fig. 5C, arrowheads), while c-Kit positive spermatogonia, actively cycling
cells, were detected as CTD-Ser2-P positive cells (Fig. 5D).
To further assess that low CTD-Ser2 is observed only in
the SC compartment, we took advantage of the hematopoietic
system, in which detailed staging is possible. Sorting and
staining of CD34þ KSL cells, defined as short-term repopulating hematopoietic stem cell (HSC), showed a very homogenous distribution of CTD-Ser2-P (Fig. 5E and 5G, white
bars). However, CD34- KSL cells clearly showed two distinct
populations, one with CTD-Ser2-P levels as high as CD34þ
KSL cells (Fig. 5F, open arrowheads) and another population
with extremely faint CTD-Ser2-P staining (Fig. 5F, filled
arrowheads). Accordingly, a histogram of CTD-Ser2-P normalized to nuclear staining showed a significant shift to lower
Reduced RNApII Ser2 Phosphorylation in Stem Cells
1578
CTD-Ser2-P signal in 27% of all CD34- KSL cells (Fig. 5G,
black bars).
Taken together, we have demonstrated that a significant
proportion of cells in at least five adult stem cell systems
show significant global repression of productive mRNA synthesis (Fig. 5H), raising the possibility that this conserved
mechanism of adult stem cell quiescence may play an important role in the maintenance of adult stem cells. Furthermore,
analysis of CTD-Ser2-P may help to identify cells with stem
cell properties in various organs and cancer tissues.
DISCUSSION
Adult stem cells have the unique ability to self-renew and differentiate, thereby maintaining tissue integrity and response to injury
throughout life. These cells must be protected from genetic and
cellular damage due to their life-long functionality. Maintaining
the quiescent state of the most immature compartment is a common strategy found in most adult stem cell systems.
One prominent common feature of adult stem cells is their
label-retaining capacity [41], suggesting that cell cycle quiescence is characteristic for adult stem cells. Indeed, activation of
the cell cycle leads to adult stem cell depletion [42–45]. However, how the quiescence of the stem cell compartment is
induced and maintained is largely unclear. It has been long
known that hematopoietic stem cells can be isolated by their
low retention of Pyronin Y, an RNA-binding dye [46], suggesting that the global suppression of transcriptional activity is a
hallmark of quiescent stem cells. This observation, however,
has not been investigated in terms of the global transcription activity of RNApII, which is responsible for all mRNA transcription. It is generally accepted that phosphorylation of the CTD
repeat of RNApII is tightly coupled to the different stages of
mRNA transcription [11]. Phosphorylation of CTD-Ser5 and
CTD-Ser2 is predominantly found during the initiation and
elongation phases of mRNA synthesis, respectively. It is now
becoming clear that most mRNA transcription is regulated at
the elongation phase. Signaling events result in the immediate
transcription of response genes, such as heat shock genes, stationary phase exit genes, differentiation induced genes, and primary response genes [8, 22, 47-50]. RNApII at such genes is already present at the promoter and phosphorylated at CTD-Ser5,
but remains stalled until signaling induces phosphorylation of
CTD-Ser2 by p-TEFb. Notably, this promoter proximal pause
is detected only on certain genes, while for example, housekeeping genes are actively transcribed.
The major aim of this study is to assess the phosphorylation
status of RNApII in stem cell compartments. We found a significant reduction in housekeeping gene expression in MelSCs and
showed that productive mRNA transcription elongation is globally downregulated in MelSCs. However, RNApII is present in
a CTD-Ser5 phosphorylated form, suggesting that the transcription machinery is poised for immediate transcription upon
appropriate signaling. Absence of CTD-Ser2-P specifically
marked MelSCs, while surrounding keratinocytes and fibroblasts were positive. This indicates an active repression of
mRNA transcription elongation, distinct from the quiescence
induced by nutrient starvation. MelSCs do however express
some mRNA [24]. This suggests the presence of a transcription
factor that directs the remaining p-TEFb to specific genes to
activate local mRNA transcription, as previously shown [13].
CDK9, the kinase subunit of p-TEFb, has been detected in
all cell types and tissues examined to date [51, 52], including
quiescent primary T lymphocytes [7, 21, 53]. In line with the
essential role of CDK9, its knockdown or inhibition leads to the
complete abolishment of global mRNA synthesis in vitro and
in vivo, and subsequent apoptosis [15, 18, 19, 27]. Surprisingly,
we found that CDK9 protein and mRNA expression are downregulated in adult MelSCs in vivo, while these cells maintain
Ccnt1 expression. To date, there is no known negative regulator
of the expression of CDK9 [54], which behaves as a typical
housekeeping gene. Indeed, the CDK9 promoter shows characteristics of a constitutive housekeeping gene promoter [55].
Thus, low CDK9 expression may be primarily an outcome of
the global suppression of housekeeping genes in MelSCs [24].
Nonetheless, it is possible that low CDK9 would strengthen this
state of global suppression. Which factor(s) induce downregulation of CDK9 transcript in MelSCs remains for future study.
To gain insight into the significance of CDK9 downregulation,
we inhibited CDK9 by chemical inhibitors and dominant negative
CDK9. In both cases, inhibition resulted in improved survival in
conditions of growth factor starvation, suggesting that transcriptional quiescence is beneficial in stressful conditions. To elucidate
the in vivo function of CDK9, we attempted to overexpress
CDK9 in melanocytes. However, our strategy failed to induce
CTD-Ser2 phosphorylation in MelSCs, and did not have any
effect on adult MelSCs, as CDK9 expression from the endogenous
Rosa26 promoter was also repressed in these cells. Consistent
with this is our observation that nascent MelSCs that are already
low in Ser2-P are still CDK9 positive. This strongly suggests that
global transcriptional suppression starts earlier than the downregulation of CDK9, probably through the regulatory circuit of pTEFb activity [13]. Thus, the signal that initiates the global transcriptional suppression in MelSC should be delivered around p2.
In most cells, quiescence is first triggered by the deprivation
of growth factors. To investigate whether or not this is also the
case for MelSCs, we analyzed CTD-Ser2-P in K14-SCF transgenic mice, which maintain SCF expression in epidermis, while
endogenous SCF expression is downregulated at around day 2 after birth [32]. Indeed, our previous studies on this strain showed
that activated melanoblasts are maintained in postnatal epidermis. Our findings in the present study show that Ser2-P negative
cells are present in K14-SCF mouse, suggesting that the mechanism inducing global suppression of transcription and Ser2-P
downregulation does not require deprivation of growth signaling.
Surprisingly, however, we also found a clear difference between
wild-type and K14-SCF transgenic mice. We observed a second
peak of CTD-Ser2-P during postnatal development in K14-SCF
mouse. Hence, it is likely that deprivation of the SCF signal from
epidermis may facilitate the induction of quiescent MelSCs
under normal circumstances. Nonetheless, all these results suggest the presence of a dominant signal that induces global transcriptional suppression, even in the presence of SCF, suggesting
that the induction and maintenance of transcriptional quiescence
are of great importance in the MelSC system.
To investigate whether or not our observation in MelSCs is
also found in other stem cells, we assessed CTD-Ser2 phosphorylation in a number of stem cell systems. Interestingly, we
observed lower CTD-Ser2 phosphorylation in various other adult
stem cell systems, including keratinocyte, muscle, spermatogonia, and hematopoietic stem cells, which suggests that global
suppression of mRNA transcription elongation is a conserved
feature of adult stem cells. Heterogeneity in the hematopoietic
stem cell system has recently been addressed, revealing a fraction of 15%–25% of cells with in vivo stem cell function [40, 56,
57], in agreement with our observation of 27% of CTD-Ser2-P
negative cells in the CD34-KSL population. However, whether
these CTD-Ser2-P negative cells exhibit increased HSC activity
remains to be shown.
Taken together, we have shown that global repression of
mRNA transcription elongation is a specific and early marker of
MelSCs. MelSCs display instead initiated but paused RNApII,
Freter et al.
1579
ready to start productive mRNA transcription upon appropriate
stimulation. Absence of CTD-Ser2 phosphorylation is a conserved feature of adult stem cells, reflecting their lower metabolic status and possibly protecting the cells from cytotoxic and
genetic damage. We suggest that the screening of tissues, including cancer, using antibodies against CTD-Ser2-P may facilitate
the detection of subsets of cells with stem cell-like phenotypes.
geting vector and support with western blotting, Dr. Lars Martin
Jakt for helpful discussion, Douglas Sipp for critical reading of
the manuscript, and the Laboratory for Animal Resources and
Genetic Engineering at the RIKEN CDB for injection of ES cells
and maintenance of mice. R.F. is supported by a Monbukagakusho scholarship.
DISCLOSURE
ACKNOWLEDGMENTS
We thank Dr. Igor Samokhvalov for support with the generation
of knock-in mice, Dr. Yoshiteru Sasaki for R26 IRES-eGFP tar-
REFERENCES
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
Orford KW, Scadden DT. Deconstructing stem cell self-renewal:
Genetic insights into cell-cycle regulation. Nat Rev Genet 2008;9:
115–128.
Tothova Z, Gilliland DG. FoxO transcription factors and stem cell homeostasis: insights from the hematopoietic system. Cell Stem Cell
2007;1:140–152.
Fuchs E, Tumbar T, Guasch G. Socializing with the neighbors: Stem
cells and their niche. Cell 2004;116:769–778.
Coller HA, Sang L, Roberts JM. A new description of cellular quiescence. Plos Biol 2006;4:e83.
Dubois MF, Nguyen VT, Dahmus ME et al. Enhanced phosphorylation of the C-terminal domain of RNA polymerase II upon serum
stimulation of quiescent cells: possible involvement of MAP kinases.
EMBO J 1994;13:4787–4797.
Yusuf I, Fruman DA. Regulation of quiescence in lymphocytes.
Trends Immunol 2003;24:380–386.
Garriga J, Peng J, Parreno M et al. Upregulation of cyclin T1/CDK9
complexes during T cell activation. Oncogene 1998;17:3093–3102.
Radonjic M, Andrau JC, Lijnzaad P et al. Genome-wide analyses reveal
RNA polymerase II located upstream of genes poised for rapid response
upon S. cerevisiae stationary phase exit. Mol Cell 2005;18:171–183.
Patturajan M, Schulte RJ, Sefton BM et al. Growth-related changes in
phosphorylation of yeast RNA polymerase II. J Biol Chem 1998;273:
4689–4694.
Komarnitsky P, Cho EJ, Buratowski S. Different phosphorylated forms
of RNA polymerase II and associated mRNA processing factors during transcription. Genes Dev 2000;14:2452–2460.
Sims RJ III, Elotserkovskaya R, Reinberg D. Elongation by RNA polymerase II: The short and long of it. Genes Dev 2004;18:2437–2468.
Ni Z, Schwartz BE, Werner J et al. Coordination of transcription,
RNA processing, and surveillance By P-TEFb kinase on heat shock
genes. Mol Cell 2004;13:55–65.
Kohoutek J. P-TEFb—The final frontier. Cell Div 2009;4:19.
Bentley DL. Regulation of transcriptional elongation by RNA polymerase II. Curr Opin Genet Dev 1995;5:210–216.
Chao SH, Price DH. Flavopiridol inactivates P-TEFb and blocks most
RNA polymerase II transcription in vivo. J Biol Chem 2001;276:
31793–31799.
Gojo I, Zhang B, Fenton RG. The cyclin-dependent kinase inhibitor
flavopiridol induces apoptosis in multiple myeloma cells through transcriptional repression and down-regulation of Mcl-1. Clin Cancer Res
2002;8:3527–3538.
Chen R, Keating MJ, Gandhi V et al. Transcription inhibition by flavopiridol: Mechanism of chronic lymphocytic leukemia cell death.
Blood 2005;106:2513–2519.
Shim EY, Walker AK, Shi Y et al. CDK-9/cyclin T (P-TEFb) is
required in two postinitiation pathways for transcription in the C. elegans embryo. Genes Dev 2002;16:2135–2146.
Eissenberg JC, Shilatifard A, Dorokhov N et al. Cdk9 is an essential
kinase in Drosophila that is required for heat shock gene expression,
histone methylation and elongation factor recruitment. Mol Genet
Genomics 2007;277:101–114.
Garriga J, Bhattacharya S, Calbo J et al. CDK9 is constitutively
expressed throughout the cell cycle, and its steady-state expression is
independent of SKP2. Mol Cell Biol 2003;23:5165–5173.
Marshall RM, Salerno D, Garriga J et al. Cyclin T1 expression is
regulated by multiple signaling pathways and mechanisms during activation of human peripheral blood lymphocytes. J Immunol 2005;175:
6402–6411.
Boehm AK, Saunders A, Werner J et al. Transcription factor and polymerase recruitment, modification, and movement on dhsp70 in vivo
www.StemCells.com
OF
POTENTIAL CONFLICTS
INTEREST
OF
The authors indicate no potential conflicts of interest.
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
in the minutes following heat shock. Mol Cell Biol 2003;23:
7628–7637.
Nishimura EK, Jordan SA, Oshima H et al. Dominant role of the
niche in melanocyte stem-cell fate determination. Nature 2002;416:
854–860.
Osawa M, Egawa G, Mak SS et al. Molecular characterization of melanocyte stem cells in their niche. Development 2005;132:5589–5599.
Nishikawa S, Osawa M. Generating quiescent stem cells. Pigment
Cell Res 2007;20:263–270.
Yonetani S, Moriyama M, Nishigori C et al. In vitro expansion of
immature melanoblasts and their ability to repopulate melanocyte
stem cells in the hair follicle. J Invest Dermatol 2008;128:408–420.
Foskett SM, Ghose R, Tang DN et al. Antiapoptotic function of Cdk9
(TAK/P-TEFb) in U937 promonocytic cells. J Virol 2001;75:
1220–1228.
Srinivasan L, Sasaki Y, Calado DP et al. PI3 kinase signals BCR-dependent mature B cell survival. Cell 2009;139:573–586.
Kunisada T, Yoshida H, Yamazaki H et al. Transgene expression of
steel factor in the basal layer of epidermis promotes survival, proliferation, differentiation and migration of melanocyte precursors. Development 1998;125:2915–2923.
Kawamoto S, Niwa H, Tashiro F et al. A novel reporter mouse strain
that expresses enhanced green fluorescent protein upon Cre-mediated
recombination. FEBS Lett 2000;470:263–268.
Blake JA, Bult CJ, Eppig JT et al. The mouse genome database genotypes::phenotypes. Nucleic Acids Res 2009;37:D712–D719.
Mak SS, Moriyama M, Nishioka E et al. Indispensable role of Bcl2 in
the development of the melanocyte stem cell. Dev Biol 2006;291:
144–153.
Trempus CS, Morris RJ, Bortner CD et al. Enrichment for living murine keratinocytes from the hair follicle bulge with the cell surface
marker CD34. J Invest Dermatol 2003;120:501–511.
Liu Y, Lyle S, Yang Z et al. Keratin 15 promoter targets putative epithelial stem cells in the hair follicle bulge. J Invest Dermatol 2003;
121:963–968.
Covault J, Sanes JR. Distribution of N-CAM in synaptic and extrasynaptic portions of developing and adult skeletal muscle. J Cell Biol
1986;102:716–730.
Irintchev A, Zeschnigk M, Starzinski-Powitz A et al. Expression pattern of M-cadherin in normal, denervated, and regenerating mouse
muscles. Dev Dyn 1994;199:326–337.
Kanatsu-Shinohara M, Toyokuni S, Shinohara T. CD9 is a surface
marker on mouse and rat male germline stem cells. Biol Reprod 2004;
70:70–75.
Anderson R, Schaible K, Heasman J et al. Expression of the homophilic adhesion molecule, Ep-CAM, in the mammalian germ line.
J Reprod Fertil 1999;116:379–384.
Osawa M, Hanada K, Hamada H et al. Long-term lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic
stem cell. Science 1996;273:242–245.
Ema H, Sudo K, Seita J et al. Quantification of self-renewal capacity
in single hematopoietic stem cells from normal and Lnk-deficient
mice. Dev Cell 2005;8:907–914.
Fuchs E. The tortoise and the hair: Slow-cycling cells in the stem cell
race. Cell 2009;137:811–819.
Cheng T, Rodrigues N, Shen H et al. Hematopoietic stem cell
quiescence maintained by p21cip1/waf1. Science 2000;287:
1804–1808.
Kippin TE, Martens DJ, van der Kooy D. p21 loss compromises the
relative quiescence of forebrain stem cell proliferation leading to
exhaustion of their proliferation capacity. Genes Dev 2005;19:
756–767.
Park IK, Qian D, Kiel M et al. Bmi-1 is required for maintenance of
adult self-renewing haematopoietic stem cells. Nature 2003;423:
302–305.
Reduced RNApII Ser2 Phosphorylation in Stem Cells
1580
45 Molofsky AV, Pardal R, Iwashita T et al. Bmi-1 dependence distinguishes neural stem cell self-renewal from progenitor proliferation.
Nature 2003;425:962–967.
46 Shapiro HM. Flow cytometric estimation of DNA and RNA content in
intact cells stained with Hoechst 33342 and pyronin Y. Cytometry
1981;2:143–150.
47 Muse GW, Gilchrist DA, Nechaev S et al. RNA polymerase is poised
for activation across the genome. Nat Genet 2007;39:1507–1511.
48 Zeitlinger J, Stark A, Kellis M et al. RNA polymerase stalling at developmental control genes in the Drosophila melanogaster embryo.
Nat Genet 2007;39:1512–1516.
49 Guenther MG, Levine SS, Boyer LA et al. A chromatin landmark and
transcription initiation at most promoters in human cells. Cell 2007;
130:77–88.
50 Hargreaves DC, Horng T, Medzhitov R. Control of inducible gene
expression by signal-dependent transcriptional elongation. Cell 2009;
138:129–145.
51 Grana X, De Luca A, Sang N et al. PITALRE, a nuclear CDC2related protein kinase that phosphorylates the retinoblastoma protein
in vitro. Proc Natl Acad Sci USA 1994;91:3834–3838.
52 Shore SM, Byers SA, Dent P et al. Characterization of Cdk9(55) and
differential regulation of two Cdk9 isoforms. Gene 2005;350:51–58.
53 Liu H, Herrmann CH. Differential localization and expression of the
Cdk9 42k and 55k isoforms. J Cell Physiol 2005;203:251–260.
54 Marshall RM, Grana X. Mechanisms controlling CDK9 activity. Front
Biosci 2006;11:2598–2613.
55 Liu H, Rice AP. Genomic organization and characterization of promoter function of the human CDK9 gene. Gene 2000;252:51–59.
56 Wilson A, Laurenti E, Oser G et al. Hematopoietic stem cells reversibly switch from dormancy to self-renewal during homeostasis and
repair. Cell 2008;135:1118–1129.
57 Foudi A, Hochedlinger K, Van Buren D et al. Analysis of histone 2BGFP retention reveals slowly cycling hematopoietic stem cells. Nat
Biotechnol 2009;27:84–90.
See www.StemCells.com for supporting information available online.