J. Microbiol. Biotechnol. (2015), 25(12), 2110–2115
http://dx.doi.org/10.4014/jmb.1505.05063
Research Article
Review
jmb
A Liquid-Based Colorimetric Assay of Lysine Decarboxylase and Its
Application to Enzymatic Assay
Yong Hyun Kim1†, Ganesan Sathiyanarayanan1†, Hyun Joong Kim1, Shashi Kant Bhatia1, Hyung-Min Seo1,
Jung-Ho Kim1, Hun-Seok Song1, Yun-Gon Kim2, Kyungmoon Park3*, and Yung-Hun Yang1,4*
1
Department of Biological Engineering, College of Engineering, Konkuk University, Seoul 05029, Republic of Korea
Chemical Engineering, Soongsil University, Seoul 06978, Republic of Korea
3
Department of Biological and Chemical Engineering, Hongik University, Sejong 30016, Republic of Korea
4
Microbial Carbohydrate Resource Bank, Konkuk University, Seoul 05029, Republic of Korea
2
Received: May 20, 2015
Revised: July 30, 2015
Accepted: August 11, 2015
First published online
August 13, 2015
*Corresponding authors
Y.H.Y.
Phone: +82-2-450-3936;
Fax: +82-2-3437-8360;
E-mail: [email protected]
K.P.
Phone: +82-44-868-6941;
Fax: +82-44-868-6941;
E-mail: [email protected]
†
These authors contributed
equally to this work.
A liquid-based colorimetric assay using a pH indicator was introduced for high-throughput
monitoring of lysine decarboxylase activity. The assay is based on the color change of
bromocresol purple, measured at 595 nm in liquid reaction mixture, due to an increase of pH
by the production of cadaverine. Bromocresol purple was selected as the indicator because it
has higher sensitivity than bromothymol blue and pheonol red within a broad range and
shows good linearity within the applied pH. We applied this for simple determination of
lysine decarboxylase reusability using 96-well plates, and optimization of conditions for
enzyme overexpression with different concentrations of IPTG on lysine decarboxylase. This
assay is expected to be applied for monitoring and quantifying the liquid-based enzyme
reaction in biotransformation of decarboxylase in a high-throughput way.
Keywords: Cadaverine, lysine decarboxylase, pH indicator, high-throughput colorimetric assay,
bromocresol purple
pISSN 1017-7825, eISSN 1738-8872
Copyright © 2015 by
The Korean Society for Microbiology
and Biotechnology
Introduction
Lysine decarboxylase (LDC; E.C. 4.1.1.18) is an enzyme
that converts lysine to cadaverine [13]. Cadaverine is
produced in metabolic pathways to protect the cells from
the drop of pH [4] and is widely used as chemical
intermediates for drugs, and it can also be used as the
monomer of polyamides such as Nylon 510 [10]. Normally,
to detect decarboxylase activity, pH indicators [3], enzyme
coupling [7], and high-performance liquid chromatography
(HPLC) are commonly used [5, 12]. Among these, HPLC
generally gives the best results with repetitive and stable
data; however, it takes tens of minutes to analyze a single
sample and sometimes requires derivatization of analytes
[11]. For the quick detection of decarboxylases, pH
J. Microbiol. Biotechnol.
indicators can be employed to monitor the progress of
enzyme-catalyzed reactions simply, and these colorimetric
methods can be used to measure enzymatic activity on the
basis of a color change as the reaction proceeds to release
or consume protons [1]. The color change can be easily
detected by a spectrophotometer, and thus allows
quantitative as well as qualitative measurements. In the
case of lysine decarboxylase, a pH indicator-based assay
has been previously reported on solid agar with pH
indicator [6]. However, this method was only used for
plate-based screening and qualitative purpose, and it is
inappropriate for the monitoring of samples in a short
period. As a result, the solid-based assay needs to be
modified, and a feasibility test of a liquid-based assay with
pH indicator to lysine decarboxylase will be very helpful.
Liquid Based Colorimetric Assay of Lysine Decarboxylase
2111
Here, we applied pH indicators for the quick detection of
liquid-based biotransformation systems with quantitative
data and applied it for practical purposes. It could be
applied to monitoring of lysine decarboxylase for repetitive
enzyme reaction, and quick quantification of activity for
optimization of lysine decarboxylase overexpression with
different IPTG concentrations. This assay is expected to be
applied for monitoring and quantifying liquid-based
enzyme reactions in biotransformation of decarboxylase in
a high-throughput way
sterile 0.2 M CaCl2 solution that was stirred continuously.
Alginate drops were solidified upon contact with CaCl2, forming
beads and thus entrapping bacteria cells. The beads were washed
two times with sterile distilled water and used for the production
of cadaverine. For the reusability test, each cycle for free and
immobilized cells was performed for 1 h with fresh 100 mM
L-lysine, 0.1 mM pyridoxal-5-phosphate, and 500 mM sodium
acetate buffer (pH 6.0) at 37°C in a water bath. After the reactions,
the cells were centrifuged and detection of lysine decarboxylase
activity was performed in a 96-well microplate. This procedure
was repeated for 18 cycles.
Materials and Methods
Expression of Various Lysine Decarboxylases
In order to construct vectors containing ldcC from Burkholderia
thailandensis, Enterobacter aerogenes, and E. coli, ldcC was amplified
by PCR using the upstream primers ldcC (HindIII)-F and ldcC
(XhoI)-R, and the PCR fragments were cloned into pET24ma
(Table 1). The resulting recombinant plasmids were transformed
into E. coli BL21(DE3), and E. coli BL21(DE3)/pET24ma-ldcC cells
were grown at 30°C and 200 rpm on a shaking incubator (HanBeak Science Co., Korea). The first pre-cultures (5 ml of LB
medium in 14 ml round-bottom tube) were inoculated with single
colonies from agar plates, made by adding Bacto-Agar (Difco) of a
concentration up to 2% and incubating for 16 h. Cells were
harvested by centrifugation (13,000 ×g for 2 min at 4°C), washed
with distilled water, and used as inoculums for the main
cultivation. This was then carried out in 50 ml of LB medium, in a
250 ml baffled flask containing 50 mg kanamycin l-1. The cells
were grown to an optical density of 0.6 at 600 nm, after which
various concentrations of IPTG were added to the cell broth to
induce recombinant protein expression. The cells were harvested
following 15 h of induction at 30°C and resuspended in 25 mM
Tris–HCl buffer (pH 8.0). The cultures were harvested by
centrifugation (13,000 ×g, 5 min, 4°C) and washed twice with
distilled water. The enzymatic reaction was performed at 37°C in
a total volume of 500 µl, containing 20 µl of lysine decarboxylaseoverexpressed whole cells, 500 mM sodium acetate buffer
(pH 6.0), 10 mM L-lysine, and 0.1 mM pyridoxal-5-phosphate as
final concentration. The reaction was stopped after 2 h by boiling
for 5 min at 95°C. For color assay, 180 µl of sodium acetate buffer
(50 mM), 10 µl of reaction sample, and 10 µl of BCP stock solution
were used.
Chemical Reagents
The chemical reagents used in this study, such as cadaverine,
lysine, bromocresol purple (BCP), bromothymol blue (BTB), phenol
red (PR), iso-propyl-ß-D-thiogalactopyranoside (IPTG), kanamycin,
and Tris–HCl, were purchased from Sigma Aldrich (St. Louis,
MO, USA). Bacto-Agar and LB medium were purchased from
Difco (Detroit, MI, USA).
Colorimetric Assay with pH Indicator
A stock solution of BTB was prepared by dissolving 134 mg of
BTB in 1 ml of 100% ethanol and diluted to 1 ml with water. A
stock solution of BCP was prepared by dissolving 162 mg of BCP
in 1 ml of 100% ethanol and diluted to 1 ml with water. PR was
prepared by dissolving 105 mg of PR to 1 ml with water. For color
assay, 180 µl of 500 mM sodium acetate buffer (pH 6.0), 10 µl of
reaction sample, and 10 µl of pH indicator stock solution were
used. All measurements were performed in a 96-well microplate
format and the most common 96-well (8 by 12 matrix) microplate
was used with a typical reaction volume of 200 µl per well in this
experiment. The absorbance at 595 nm of the pH indicator was
recorded with a UV-Vis spectrophotometer (TECAN Sunrise,
Tokyo, Japan). For the pH measurements, as ISTEK EcoMet p15
pH meter equipped with a combined glass calomel electrode was
used.
Immobilization of Whole Cells
For immobilized strains, the resulting recombinant plasmid
pET24ma-cadA was transformed into E. coli BL21(DE3) [8], and
E. coli BL21(DE3)/pET24ma-cadA cells were grown at 37°C with
shaking at 200 rpm in 100 ml of LB broth containing 50 mg
kanamycin l-1. The cells were grown to an optical density (OD) of
0.6 at 600 nm, after which 0.1 mM IPTG was added to the cell
broth to induce recombinant protein expression. The cells were
harvested following 16 h of induction at 30°C and resuspended in
25 mM Tris–HCl buffer (pH 8.0) [2]. Cells grown in 50 ml of LB
broth were mixed with an equal volume (1:1 (v/v)) of sodium
alginate solution and stirred for 5 min. The mixed solution
obtained was then placed in a syringe and allowed to drop into a
Results and Discussion
Screening of pH Indicator for Lysine Decarboxylase
Before several pH indicators were examined, variations
of pH with cadaverine and lysine concentration were
examined (Fig. 1). The pH change by lysine concentration
was negligible, and the pH remained around 5.8 regardless
of lysine concentration. However, when cadaverine was
December 2015 ⎪ Vol. 25 ⎪ No. 12
2112
Kim et al.
Table 1. Strains and plasmids used in this study.
Strains / Plasmids / Primers
Characteristics / Sequence
Source and
Reference
Strain
E. coli K12 MG1655
Wild type
KCTC
Burkholderia thailandensis E264
KACC 12027, Wild type
KACC
Enterobacter aerogenes
KCTC 2190, Wild type
KCTC
E. coli DH5-α
fhuA2 ∆(argF-lacZ)U169 phoA glnV44 ϕ80lacZ∆M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17
Novagen
E. coli BL21 (DE3)
F– ompT gal dcm lon hsdSB(rB- mB-) λ(DE3)
Invitrogen
pET24ma
Expression vector, T7 promoter, KmR , p15A ori modified in pET24a
[14]
pET24ma-cadA
cadA from E. coli K12 inserted into pET24ma
[8]
pET24ma-eco ldc
ldcC from E. coli K12 inserted into pET24ma
This study
pET24ma-Burk ldc
ldcC from B. thailandensis inserted into pET24ma
This study
pET24ma-Ent ldc
ldcC from E. aerogenes inserted into pET24ma
This study
Ec Ldc F
CGTCGTAAGCTTGCATGAACATCATTGCCATTATGG A
This study
Ec Ldc R
CGTCGTCTCGAGTCCCGCGATTTTTAGGACTCG
This study
E264 ldc F
CGTCGTAAGCTTATGAAGTTTCGTTTTCCCGTCGTCATCATC GAC G
This study
E264 ldc R
CGTCGTCTCGAGGTCGCGCACGCAGTCGACGTAATACTCG
This study
Ent ldc F
CGTCGTAAGCTTATGAACGTTATTGCAATCATGAATCACATG GGTG
This study
Ent ldc R
CGTCGTCTCGAGCTTGTTGTTTTCTTCTTTCAGCACTTTAACGG
This study
Plasmid
Primer
examined, the pH change of cadaverine moved from 5.8 to
10 depending on the concentration of cadaverine. Linear
regression showed that pH was correlated to the
concentration of cadaverine (R2 = 0.9155).
To screen out good indicators, a pH range for the lysine
decarboxylase reaction reaching from 6 to 10 was considered
Fig. 1. Change of pH with different concentration of cadaverine
and lysine.
J. Microbiol. Biotechnol.
and several candidates were selected based on previous
reports and pH range. Among them, BCP, BTB, and PR
were selected and examined further. Then 20 mg/ml of
BCP, BTB, and PR and different concentrations of cadaverine
were added to final concentrations of 1.25, 2.5, 5, 10, and
20 mM with 50 mM sodium acetate buffer (pH 6.0) in 96well plates and the OD595 was measured (Fig. 2). Depending
on the pH and indicator, the change of colors was different.
BCP changed from pale yellow to bright blue and BTB
changed from transparency to blue. However, PR showed
yellow with low pH and pink at high pH. When the
linearity was examined at different concentrations, BCP
(R2 = 0.9754) showed better linearity than BTB (R2 = 0.8094)
and PR (R2 = 0.8721). BCP was better than a regression of
pH with different cadaverine concentrations (R2 = 0.9155).
When the sensitivity and response were compared, BCP
showed 3.5-fold to BTB and 2.1-fold to PR based on the
slope of linear regression curve (Fig. 2). Based on these
results, BCP was used for further experiments for lysine
decarboxylase activity.
Application to Monitor the Repetitive Lysine Decarboxylase
Reaction in 96-Well Microplate
One advantage for this liquid-based colorimetric assay is
Liquid Based Colorimetric Assay of Lysine Decarboxylase
2113
Fig. 2. Standard curves of cadaverine with bromocresol purple (A), bromothymol blue (B) and phenol red (C) as indicator
(duplicated).
its quick and fast analysis of many samples. When we
apply HPLC analysis, it needs several preparation steps for
samples and takes some time to prepare the analytical
system and perform chromatography [9]. Specifically, when
we need continuous monitoring of repetitive reactions, it is
very hard to know when the reaction should be stopped
Fig. 3. Monitoring of repetitive enzyme reactions with free
and immobilized cells by colorimetric assay.
and new enzymes are introduced. Fig. 3 shows the
reusability test of cadA-overexpressed whole cell (free cell)
and cadA-overexpressed whole cell immobilized to Caalginate beads (immobilized cell). The cadA-overexpressed
whole cells were prepared for the reusability test as
explained in Materials and Methods. Free cells lost 50% of
their productivity after 10 cycles with 100 mM of lysine as a
substrate, and it was clearly monitored by the decrease of
color change rate from yellow to purple after 10 cycles. By
this result, we could know when our enzyme lost its
activity and when we need to stop this reaction. In contrast,
when immobilized whole cells were applied, the
immobilized whole-cell enzyme reaction showed repeated
color change until 18 cycles, meaning it kept its activity
until 18 cycles.
Optimization of Enzyme Expression with Different
Concentrations of IPTG on Different Enzymes
Normally, optimization of enzyme expression is laborous
because it needs many repetitive experiments to optimize
and sometimes several enzyme assays and SDS-PAGEs,
which could not give quantitative data easily, are needed.
Based on previous difficulties on optimzation of enzyme
overexpression, the liquid-based colorimetric assay was
applied to optimize lysine decarboxylase overexpression
with different concentrations of IPTG. We applied this to
find the optimal IPTG concentration for newly cloned
lysine decarboxylase from B. thailandensis, E. aerogenes, and
December 2015 ⎪ Vol. 25 ⎪ No. 12
2114
Kim et al.
Fig. 4. Optimization of enzyme expression with different concentrations of IPTG.
(A) Effects of different concentrations of IPTG on lysine decarboxylase activity and (B) SDS-PAGE of lysine decarboxylase from E. aerogenes
overexpressed in E. coli (M: Protein marker; Lane 1: Soluble fraction; Lane 2: Insoluble fraction).
E. coli ldcCs in E. coli. Once cells were induced, the same
amount of cells was moved to 1.5 ml Eppendorf tubes and
10 mM of lysine and 0.74 mM of BCP were mixed in, and
after 1 h, the OD was measured at 595 nm (Fig. 4A). By
doing this, we compared different IPTG effects on different
strains and compared the absorbance as different expression
level effects on the enzyme activity of lysine decarboxylases.
Among the tested strains, 0.1 mM of IPTG and 0.001 mM of
IPTG with E. aerogenes ldcC were applied to SDS-PAGE,
confirming that our system works for optimization of
lysine decarboxylase overexpression (Fig. 4B).
In conclusion, in this study, we applied a simple and
convenient bromocresol purple-based colorimetric method
for fast detection of lysine decarboxylase activity. This
method seems quite useful for monitoring the lysine
decarboxylase reaction in biotransformation, meaning one
substrate like lysine is changed to one product like
cadaverine. It will be especially useful for the screening of
lysine decarboxylases from a library, because these
experiments need a lot of samples and experiments for the
detection of enzyme reaction.
Acknowledgments
2.
3.
4.
5.
6.
7.
8.
This work was supported by the faculty research fund of
Konkuk University in 2014.
References
1. Banerjee A, Kaul P, Sharma R, Banerjee UC. 2003. A highthroughput amenable colorimetric assay for enantioselective
J. Microbiol. Biotechnol.
9.
10.
screening of nitrilase-producing microorganisms using pH
sensitive indicators. J. Biomol. Screen. 8: 559-565.
Bhatia SK, Shim YH, Jeon JM, Brigham CJ, Kim YH, Kim
HJ, et al. 2015. Starch-based polyhydroxybutyrate production
in engineered Escherichia coli. Bioprocess Biosyst Eng. 38:
1479-1484.
Bover-Cid S, Holzapfel WH. 1999. Improved screening
procedure for biogenic amine production by lactic acid
bacteria. Int. J. Food Microbiol. 53: 33-41.
Brooker DC, Lund ME, Blazevic DJ. 1973. Rapid test for
lysine decarboxylase activity in Enterobacteriaceae. Appl.
Microbiol. 26: 622-623.
Flores HE, Galston AW. 1982. Analysis of polyamines in
higher plants by high performance liquid chromatography.
Plant Physiol. 69: 701-706.
Goldschmidt MC, Lockhart BM, Perry K. 1971. Rapid
methods for determining decarboxylase activity: ornithine
and lysine decarboxylases. Appl. Microbiol. 22: 344-349.
Janne J, Williams-Ashman HG. 1971. Dissociation of putrescineactivated decarboxylation of S-adenosyl-L-methionine from
the enzymic synthesis of spermidine and spermine by purified
prostatic enzyme preparations. Biochem. Biophys. Res. Commun.
42: 222-229.
Kim HJ, Kim YH, Shin JH, Bhatia SK, Sathiyanarayanan G,
Seo HM, et al. 2015. Optimization of direct lysine
decarboxylase biotransformation for cadaverine production
with whole cell biocatalysts at high substrate concentration.
J. Microbiol. Biotechnol. 25: 1108-1113.
Kim YH, Kim HJ, Shin J-H, Bhatia SK, Seo H-M, Kim Y-G,
et al. 2015. Application of diethyl ethoxymethylenemalonate
(DEEMM) derivatization for monitoring of lysine decarboxylase
activity. J. Mol. Catal. B Enzym. 115: 151-154.
Kind S, Wittmann C. 2011. Bio-based production of the platform
Liquid Based Colorimetric Assay of Lysine Decarboxylase
chemical 1,5-diaminopentane. Appl. Microbiol. Biotechnol. 91:
1287-1296.
11. Knapp DR. 1979. Handbook of Analytical of Derivatization
Reactions, p. 6. John Wiley & Sons, NY.
12. Kvannes J, Flatmark T. 1987. Rapid and sensitive assay of
ornithine decarboxylase activity by high-performance liquid
chromatography of the o-phthalaldehyde derivative of
putrescine. J. Chromatogr. 419: 291-295.
2115
13. Phan AP, Ngo TT, Lenhoff HM. 1982. Spectrophotometric
assay for lysine decarboxylase. Anal. Biochem. 120: 193-197.
14. Yang YH, Brigham CJ, Song E, Jeon JM, Rha CK, Sinskey
AJ. 2012. Biosynthesis of poly(3-hydroxybutyrate-co-3hydroxyvalerate) containing a predominant amount of 3hydroxyvalerate by engineered Escherichia coli expressing
propionate-CoA transferase. J. Appl. Microbiol. 113: 815-823.
December 2015 ⎪ Vol. 25 ⎪ No. 12