Use of Biorational Products for the Control of Diseases in HighTunnel Tomatoes and Induction of Certain Defense Genes in Tomato by Trichoderma hamatum 382 A Thesis Presented in Partial Fulfillment of the Requirements for The Degree Master of Science in the Graduate School of The Ohio State University By Nagendra Subedi Graduate Program in Plant Pathology The Ohio State University 2009 Thesis Committee: Dr. Sally A Miller, Advisor Dr. Anne E Dorrance Dr. Terrence L Graham Copyright by Nagendra Subedi 2009 ABSTRACT High tunnels not only extend the tomato production season and help farmers capture peak prices but also provide favorable conditions for diseases such as Fulvia leaf mold (Fulvia fulva), Botrytis gray mold (Botrytis cinerea), and white mold (Sclerotinia sclerotiorum) that are not common in open field conditions. Hence it is essential to establish good disease management practices in high tunnels to ensure highly profitable production. In this study we evaluated two fungi, Trichoderma hamatum 382 and Muscodor albus, singly and in combination along with the copper compound ‘Kocide’, a commercial formulation of hydrogen peroxide ‘OxiDate’, and composted dairy manure. OxiDate and Kocide suppressed the severity of Fulvia leaf mold. None of the foliar treatments or Muscodor reduced the incidence of Botrytis gray mold; however, compost amendment reduced disease pressure when plants were pruned. Plants grown in compost‐amended plots had better growth, and the severity of ‘other’ rots was low compared to those grown in non‐amended plots. In this study we observed that T. hamatum 382, a good colonizer of potting/planting mix, was not able to colonize field soil. ii We also evaluated the bio‐control activity of T. hamatum 382 against bacterial leaf spot (Xanthomonas euvesicatoria 110C) of tomato in greenhouse conditions. In this study we use Real Time quantitative PCR (qPCR) to monitor the expression of extensin, osmotin and expansin genes in tomato leaves in the presence and absence of T. hamatum 382 before and after inoculation with X. euvesicatoria 110C. Extensin and expansin are cell wall proteins, whereas osmotin is an acidic protein of the PR‐5 protein family. Extensin makes crosslinks in cell walls to provide mechanical strength. Expansin makes cell walls weaker by moving cell wall microfibrils apart. Osmotin has antibiotic activities. T. hamatum 382 applied as an amendment of planting mix significantly (P = 0.05) reduced bacterial leaf spot without colonizing above‐ground plant parts. Expression of these genes was not consistently changed by T. hamatum 382 before X. euvesicatoria 110C inoculation. However, after X. euvesicatoria 110C inoculation, extensin was up‐
regulated in both T. hamatum 382‐amended, and X. euvesicatoria 110C‐inoculated plants. Osmotin was up‐regulated only in X. euvesicatoria 110C‐inoculated plants. T. hamatum 382 amendment had no impact on osmotin expression. Expansin was initially down‐regulated in X. euvesicatoria 110C‐ inoculated plants regardless of T. hamatum 382‐amendment. However, expression of the gene remained low over time only in X. euvesicatoria 110C‐inoculated plants growing in T. hamatum 382‐amended planting mix. Results of this study suggest that the resistance induced by T. hamatum 382 in tomato plants is different from SAR. During this process tomato plants are primed to down‐regulate the expression of the expansin gene after pathogen attack. iii To My Parents iv Acknowledgement I would like to express my sincere gratitude to my advisor, Dr. Sally A Miller for her support and guidance throughout my research, and specially for accepting me in her laboratory as a graduate student. I would like to thank the members of my student advisory committee, Dr. Anne E Dorrance and Dr. Terrence L Graham for their helpful comments and support. Special thanks to Dr. Harry A J Hoitink for his technical help and support during this study, and Dr. Tea Mulea for her skilled inputs on qPCR. I am grateful to Dr. Fulya Baysal‐Gurel, Mrs. Melanie Lewis Ivey and Mr. Jhony Mera for their invaluable support on all laboratory, greenhouse and field researches. My appreciation is extended to Xiulan Xu, Sawsan Elateek and Freddy Cruz. I also would like to thank Biljana, Silviane, Andresh, Seema, Lucia and Diego for their assistance in field experiment. Thanks to Mr. Bill Bardall, Mr. Bob James, Mrs. Laurel Leedy and the Snyder farm crew for their help in greenhouse and field experiment. v Very special thanks to all who made my stay at The Ohio State a pleasant and memorable part of my life: Rosie, Clara, Alfred, Kristen, Daniel, He He, Alissa, Maria, Rosa, Christian, Gautam, Zhifen, Valdir, Moshwori, Umakant, Keshav, Amulya, Nirpesh, Dhiraj, Manoj, Tripty, Shruti, Saugata, Dharnesh… I would like to acknowledge Integrated Pest Management Collaborative Research Support Program (IPM‐CRSP) and The Ohio State University for providing financial support during my study. The greatest thanks to all of my family members, for their continuous and unconditional support and encouragement. vi Vita 1977…………………………………………Born, Chitwan, Nepal 1999…………………………………………B. Sc. Biology, Tribhuvan University, Nepal 2001…………………………………………M. Sc., Botany, Tribhuvan University, Nepal 2006 to present……………………….Graduate Research Associate, Department of Plant Pathology, The Ohio State University Fields of Study Major Field: Plant Pathology vii TABLE OF CONTENTS Page Abstract…………………………………………………………………………………………………………………….. ii Dedication…………………………………………………………………………………………………………………. iv Acknowledgement…………………………………………………………………………………………………….. v Vita…………………………………………………………………………………………………………………………….. vii List of Tables………………………………………………………………………………………………………………. x List of Figures……………………………………………………………………………………………………………… xiii Chapters: 1. Literature Review Tomato………………………………………………………………………………………………. 1 Tomato Diseases………………………………………………………………………………... 3 High Tunnel…………………………………………………………………………………………. 8 Compost……………………………………………………………………………………………… 9 Muscodor……………………………………………………………………………………………. 13 Trichoderma………………………………………………………………………………………… 15 Extensin……………………………………………………………………………………………….. 19 Osmotin……………………………………………………………………………………………….. 20 Expansin……………………………………………………………………………………………….. 24 References……………………………………………………………………………………………. 32 2. Use of Biorational Products for the Control of Diseases in High tunnel Tomatoes Introduction…………………………………………………………………………………………. 53 Materials and Methods………………………………………………………………………… 57 viii Results…………………………………………………………………………………………………….………… 70 Discussion…………………………………………………………………………………………….. 85
References…………………………………………………………………………………………… 91 3. Induction of Certain Defense genes in Tomato by Trichoderma hamatum 382 Introduction…………………………………………………………………………………………. 96 Materials and Methods………………………………………………………………………… 102 Results………………………………………………………………………………………………….. 116 Discussion…………………………………………………………………………………………….. 134 References…………………………………………………………………………………………… 140 4. Bibliography………………………………………………………………………………………………………. 145 ix LIST OF TABLES Table 2.1 2.2 2.3 Effect of treatments on foliar diseases and plant height in Experiment I. Disease rating and area under the disease progress curve (AUDPC) are based on the values of the scale of 0‐100 percentage foliage affected. AUDPC was calculated according to the formula: Σ ([(xi+ xi‐
1)/2] (t i‐ t i‐1)), where xi is the rating at each evaluation time and (t i‐ t i‐
rd th
th
1) is the time between evaluations. Heights of the 3 , 4 and 5 plants within each plot were measured 1 month after transplanting. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. Effect of treatments on fruit health in Experiment I. Fruits were harvested into bulk bins and were classified in different categories and weighed. There was no bacterial disease on fruits. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. Effect of compost and compost x treatment interaction on foliar diseases, fruit diseases and plant height in Experiment I. Disease rating and area under the disease progress curve (AUDPC) are based on the values of the scale of 0‐100 percentage foliage affected. The AUDPC was calculated according to the formula: Σ ([(xi+ xi‐1)/2] (t i‐ t i‐1)), where xi is the rating at each evaluation time and (t i‐ t i‐1) is the time between evaluations. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. x Page no.
71
72
73
2.4 2.5 2.6 2.7 3.1 Effect of treatments on foliar and fruit diseases in Experiment II. Disease rating and area under the disease progress curve (AUDPC) are based on the values of the scale of 0‐100 percentage foliage affected. The AUDPC was calculated according to the formula: Σ ([(xi+ xi‐1)/2] (t i‐ t i‐1)), where xi is the rating at each evaluation time and (t i‐ t i‐1) is the time between evaluations. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. Effect of treatments on root diseases and plant height in Experiment II. Disease rating are based on the values of the scale of 0‐100 percentage root area affected. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. Effect of compost and compost x treatment interaction on foliar and fruit diseases in Experiment. Disease rating and area under the disease progress curve (AUDPC) are based on the values of the scale of 0‐100 percentage foliage affected. The AUDPC was calculated according to the formula: Σ ([(xi+ xi‐1)/2] (t i‐ t i‐1)), where xi is the rating at each evaluation time and (t i‐ t i‐1) is the time between evaluations. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. Effect of compost and compost‐treatments interaction on root diseases and plant height in Experiment II. Disease ratings are based on the values of the scale of 0‐100 percentage root area affected. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. Composition of modified Hoagland’s solution. Table shows the molecular formula, molecular weight, amount of ingredients required making 1L stock solution, and the volume of stock solution required to make a liter of nutrient solution. 77
78
79
80
105
xi Numbers of leaf spots produced by Xanthomonas euvesicatoria 110C on tomato plants (Experiment II). Leaf spots were counted 9, 11 and 13 days post‐inoculation (PI) by X. euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 3.2 118
Dry weight of above ground parts of tomato plants grown in Trichoderma hamatum 382‐amended (T+) and non‐amended (T‐) planting mix. Means followed by the same letter are not significantly different (p‐value < 0.05). 3.3 119
xii LIST OF FIGURES Figure 2.1 2.2 2.3 2.4 2.5 Page no.
High tunnel. Compost amended and non‐amended plots(A). Rolling side wall of the high tunnel. Temperature and moisture of the high tunnel was regulated by rolling side walls up and down early in the morning and late evening respectively (B). Rows with different treatments. Plants in each row were supported with wooden stakes (C). Preparation of Muscodor albus inoculum. (A) Muscodor colony on PDA, (B) Flask containing Potato Dextrose Broth (PDB) and Muscodor plugs being shaken on a shaker, (C) Barley seed‐based formulation of Muscodor alba and (D) Beds incorporated with Muscodor and covered with plastic mulch. Fruit diseases. (A) Anthracnose, (B) Botrytis fruit rot, (C) Botrytis ghost spot on green fruit, (D) Blossom end rot (BER), (E) Other rots, (F) Insect‐damaged fruit. diseases. (A) Fulvia leaf mold, (B) Botrytis gray mold (infected flower), (C) Early blight, (D) Septoria leaf spot. Trends of Trichoderma hamatum 382 populations in Experiment I (A) and II (B). Population count at 0 and 4 weeks after T. hamatum 382 amendment were done from planting mix, and at 8 and 12 weeks after amendment were done from rhizosphere soil and roots of tomato plants growing in compost‐amended and non‐amended plots. Population of T. hamatum 382 is expressed as Log Colony Forming Units (CFU) per gram of dry weight of planting mix/soil. xiii 60
64
67
68
84
3.1 Tomatoes grown in styrofoam cups fitted with siphon delivery systems. Tomatoes in four tables representing four blocks before Xanthomonas euvesicatoria 110C inoculation (A), Single line serving each cup (B). 104
3.2 Colonies of Trichoderma hamatum 382 growing on Chung’s medium (Chung and Hoitink, 1990) during dilution planting. (A) Front view of a plate. (B) Rear view of the plate. 105
3.3 Bacterial leaf spots caused by Xanthomonas euvesicatoria 110C on the lower surface of tomato leaf after thirteen days of inoculation. 109
3.4 Melting curve chart (Fluorescence vs Temperature). (A) Extensin, (B) Osmotin, and (C) Extensin genes. Only one peak, at the temperature above 800C, rules out primer‐dimer and unspecific binding by the primer sets. 115
3.5 Roots and stem sections of tomato on Trichoderma selective medium. Roots of tomato plants grown on (A)Trichoderma hamatum 382‐amended (T+) and (B) non‐amended (T‐) planting mix without surface sterilization; (C) T+ roots after surface sterilization, (D) T‐ stem disc from 15 cm above the soil line without surface sterilization, (E) T+ stem section from 5cm above the soil line without surface sterilization. 118 3.6 Trichoderma hamatum 382 populations in planting mix amended with T. hamatum 382 spores. Weekly population counts of T. hamatum 382 are expressed as log colony forming units (CFU) per gram dry weight of planting mix. The first population count was done one week after T. hamatum 382 amendment. 119
xiv 3.7 Threshold cycle (Ct) values for extensin, osmotin and expansin genes in tomatoes grown in Trichoderma hamatum 382‐amended (T+) and non‐amended (T‐) planting mix before the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 123
3.8 Extensin expression in Experiment I: Pattern of tomato extensin gene expressed in terms of Threshold Cycle (Ct) values 2, 5 and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 124
3.9 Extensin expression in Experiment II: Pattern of tomato extensin gene expressed in terms of Threshold Cycle (Ct) values on 2, 5 and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 125
3.10 Osmotin expression in Experiment I: Pattern of tomato osmotin gene expressed in terms of Threshold Cycle (Ct) values 2, 5 and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 128
3.11 Osmotin expression in Experiment II: Pattern of tomato osmotin gene expressed in terms of Threshold Cycle (Ct) values 2, 5, and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 129
xv 3.12 Expansin expression in Experiment I: Pattern of tomato expansin gene expressed in terms of Threshold Cycle (Ct) values 2, 5, and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 132
3.13 Expansin expression in Experiment II: Pattern of tomato expansin gene expressed in terms of Threshold Cycle (Ct) values 2, 5, and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 133
xvi CHAPTER 1 LITERATURE REVIEW 1.1 Tomato Tomato, Lycopersicon esculentum Mill, was originated in South America in the narrow west‐coast area between the Andes and the ocean extending from the equator to about thirty degrees south latitude. It spread in pre‐Columbian times as a weed of fields and door yards throughout much of the tropical America, either with or without human’s active involvement. It was first domesticated in Mexico, due to its general similarity to the older food plant Physalis. From Mexico the cultivated forms were taken to Europe and other parts of the Old World (Jenkins, 1948; de Candolle, 1884; Sabine, 1819). It is a major vegetable crop of the world. In 2007, 126 million tonnes of tomatoes were produced worldwide on 4.6 million hectares. In the United Sates, 115 million tonnes of tomatoes were produced on 175 thousand hectares (FAO 2007). Ohio is one of the leading producers of tomatoes in the United States with 2,387 hectares of 1 processing tomatoes and 1,982 hectares of fresh market tomatoes (USDA, 2008). The world wide productivity of tomato is 272893 hectogram/hectare (FAO 2007). Productivity of the United States is 657143 hectogram/hectare and that of Ohio is 29.1 tonnes/hectare (FAO, 2007; USDA, 2008). Tomato is a hairy herb in the Solanaceae family. Leaves are 10‐25 centimeters, interruptedly pinnate with 5‐9 leaflets on petiole (Acquaah, 2002). Leaflets are ovate or ovate oblong and pointed (Willis, 1924). Fruit is a berry. Size varies from small with two locules to large multi‐locular. It can be yellow, orange, pink, red, or even white. Fresh market tomatoes are round to flat‐round while processing tomatoes are elongated or pear‐shaped (Peet, 1995).Tomato plants fall under three groups. “Indeterminate” vines grow constantly throughout the season; “large determinate” vines grow to a good size, but increases little more after that; “determinate” vines stay smaller to medium sized. Vine growth depends on variety (Anonymous, botany.com). There are hundreds of tomato varieties available in markets. Selection of a cultivar for production depends on various factors such as market demand, disease resistance, suitability of production systems, and regional adaptability (Diver et al. 1999). Ohio Vegetable Production Guide 2008 has recommended 32 fresh market cultivars, 12 processing cultivars and 6 red beefsteak varieties for greenhouse. All these cultivars are resistant to Verticillium wilt (race 1) and Fusarium wilt (race 1). ‘Mountain Spring’ and ‘Florida 47’ are two fresh market tomato cultivars common in Ohio. Both are midseason cultivars with determinate growth, produce very large fruits and are resistant 2 to Stemphylium sp., Verticillium dahlia race 1, Fusarium wilt race 1. Mountain spring is tolerant to crack and stress and also resistant to Verticillium albo‐atrum (Anonymous, 2000). 1.2 Tomato Diseases Plant diseases are important limiting factors in tomato production, and there are nearly two hundred tomato diseases described. Bacteria, mycoplasmas, fungi, viruses, viroids, nematodes, insects and parasitic phanerogams are the major causes of parasitic diseases. Similarly, non‐ parasitic diseases are caused by extremes in light, heat, soil moisture and pH, and by nutritional imbalances. Damage caused by herbicides, pesticides, lightning and genetic disorders are also non‐parasitic diseases (Jones et al. 2006). Alternaria solani (Ell. & Mart.) L. R. Jones & Grout is the most widespread tomato pathogen, and it causes early blight. This disease affects all aboveground parts. Brownish black lesions with concentric rings are produced on older leaves. These lesions often coalesce and result in defoliation. Dark, elongated and slightly sunken lesions occur on stems and pedicels. Fruit infection starts from the calyx, producing big concentric and leathery lesions that generally are covered with dark fungal spores (Jones, 2006; Menzies and Jarvis, 1994). Alternaria stem canker is another disease caused by A. alternata (Fr.:Fr.) Keissl. f. sp. lycopersici (Grogan et al., 1975). The disease is characterized by dark concentric zonation and is often associated with cankers near 3 the soil line. Spots on leaves and fruits are also common with this disease (Paulus, 2006; Grogan et al., 1975). Grey mold, caused by Botrytis cinerea Pers.:Fr., is another ubiquitous tomato disease. The disease affects all aerial parts of the tomato plant. Leaves and stems develop lesions that appear fuzzy, gray‐brown due to fungal sporulation. Senescing petals are particularly susceptible. This fungus enters from the calyx into the corolla and attacks the fruit. Infected fruits result in pre‐ and post‐harvest rots (Koike et al., 2007; Stall, 2006; Menzies and Jarvis, 1994). A distinct fruit infection, called ‘ghost spots,’ occurs when the pathogen invades the fruit but then dies prior to causing decay. The resulting symptom is a white to yellow ring that ranges from 3‐10 mm in diameter (Koike et al. 2007). Leaf mold, caused by Fulvia fulva (Cooke) Cif., is a worldwide problem of tomatoes grown under high humidity. Pale green or yellowish spots without well defined margins appear on mature leaves which later turn yellow. Underneath these spots, olive‐green‐mold can be seen. Symptomatic leaves will eventually curl and wither. Under favorable conditions, the fungus may also colonize all above ground parts. Fruits may have a black, leathery rot on the stem end (Jones and Jones, 2006). Anthracnose is a common disease of ripe tomato fruits and can be very destructive under favorable moisture conditions. This disease is caused by several species of Colletotrichum: C. coccodes (Wallr.) S. J. Hughes, C. gloeosporiod (Penz.) Penz. & Sacc. in Penz., C. dematium (Pers.) Grove, and others ( Stevenson and Pohronezny, 4 2006). Recently, C. acutatum, which causes anthracnose to many plants including strawberry and pepper, was also found to infect tomato (Jelev et al., 2009; 2008). Young, green fruits do not show symptoms until the fruit begin to ripen. The disease begins as a small, round, grayish, sunken, water‐soaked lesion. The center of the spots become tan and flecked with small black specks. Individual spots enlarge concentrically and become covered with numerous, submerged, black acervuli. Under wet conditions, these acervuli produce a mass of slimy, salmon‐colored conidia. Multiple lesions often coalesce to completely rot the fruit (Koike et al., 2007; Dal Bello, 2000). Several species of Phytophthora cause different diseases on tomato. Phytophthora parasitica Dastur, P. capsici Leonian, and P. drechsleri Tucker cause Buckeye rot. P. parasitica Dastur, P. capsici Leonian and P. cryptogea Pethybr. & Laff. cause root rot. These two diseases are reported in humid and warm places (Stevenson, 2006; Koike et al., 2007). Late blight, caused by Phytophthora infestans (Mont.) de Bary, is a very serious disease in consistently cool and humid weather. Migration of exotic strains of P. infestans has resulted in the re‐emergence of this disease (Koike et al., 2007; Fry and Goodwin, 1997). Several Phytophthora species are also involved in seed decay and damping off of tomato (Koike et al., 2007). Buckeye rot starts from the point of contact between the fruit and infested soil. Disease begins as a small, brown spot which grows into a large lesion with concentric rings of alternating light and dark brown discoloration. Phytophthora root rot starts as a water‐soaked discoloration on roots, which later girdle and decay the root. Infected 5 roots may show discoloration on vascular and stele tissues. Late blight appears as water‐
soaked spots at the tips or edges of leaves which soon turn brown. Under cool, humid conditions spots enlarge rapidly, covering all leaflets, petioles, and eventually the stem, turning the whole plant brown. Decaying vines produce a characteristic foul odor. Infected fruits have dark, green‐brown, greasy lesions (Stevenson, 2006). The number of diseases caused by bacteria in tomato is considerably lower than those caused by fungi; however, under certain conditions, they are more aggressive and very difficult to manage (Agrios, 1997). Bacterial spot, caused by several species of Xanthomonas, such as X. euvesicatoria, X. vesicatoria, X. perforans, and X. gardener, is one of the most important foliar diseases of tomato (Jones et al. 2004). This disease is characterized by brown, roughly circular spots on stems, leaves, and petioles. The spots are generally smaller than 3 mm in diameter, surrounded by a yellow halo, and become water soaked with high humidity. Under favorable conditions, spots coalesce to result in severe defoliation. On the fruits, symptoms appear as minute slightly raised blisters. These blisters slightly increase in size and become brown and scabby (Jones et al. 1997; Basim et al. 2004). Bacterial speck is another common tomato disease caused by Pseudomonas syringae pv. tomato (Mahesaniya et al. 2002). Symptoms appear on all aerial parts, such as leaves, stems, peduncles, calyces, flowers, and fruits. Infected leaves bear water soaked spots, which rapidly develop into dark spots with halos. Spots on fruits are raised, dark, and more or less circular (Bashan, 1982). Both bacterial spot and speck are 6 favored by prolonged leaf moisture levels, high relative humidity, and poor air circulation; however, warm temperatures (24‐30 0C) is more favorable for bacterial spot and cool (18‐24 0C) temperatures are more favorable for bacterial speck (Beattie and Lindow, 1995; Hirano and Upper, 1983; Romatschuck, 1992). Bacterial canker, caused by Clavibacter michiganensis subsp. michiganensis (Smith) Davis, is a sporadic disease with world‐wide appearance. This disease is characterized by systemic wilting of the plant. Normally, leaflets of lower leaves first start to wilt following marginal necrosis, and the symptoms move upward. For infections that begin in upper parts of a plant, symptoms move downward. Vascular tissues show brown discoloration, which is more prominent at the nodes. Symptoms on fruits do not always appear, but when present, make the diagnosis of the disease easier. This disease produces characteristic spots with raised brown centers that are surrounded by opaque white haloes, called “bird’s eyes.” This disease can be controlled by using disease free seed and transplants (Gitaitis, 2006). Blossom end rot (BER) is a common physiological disorder associated with calcium deficiency. Fluctuation of temperatures and soil moisture levels during blossom set results in enlarged, water soaked lesions on the bottom of the tomato fruits. As the fruit grows, the lesion dries out, giving a leathery appearance. Generally, such lesions are subsequently colonized by saprophytic Alternaria spp. and turn black. Maintaining adequate soil fertility and constant soil moisture levels reduces the incidence of BER. Fruit deformation, scars and holes (cat face), and zippering are other common 7 physiological disorders associated with thermal fluctuations, herbicide injury and low soil moisture levels. Proper irrigation schedules, appropriate planting dates, and selection of tolerant varieties can avoid such problems (Precheur, 2005). 1.3 High tunnel High tunnel is a plastic covered frame heated with the solar radiation. A high tunnel does not require electricity. Temperature and moisture in high tunnel are managed simply by rolling the side walls up and down. (Jett, 2006a).It offers environmental protection and control intermediate to heated green houses and open fields (Hightunnels.org, 2009). The tunnel location is very important for temperature and moisture control. It should be oriented in such a way that significant winds pass through it. Being a semi‐permanent structure, it should be located on well drained, fertile soil with pH 6.0‐7.0 for tomato production (Zitter, 2007; Jett, 2006b). High tunnel is generally associated with raised beds, drip irrigation and plastic mulch (Jett, 2006). 25 cm tall and 0.8 mwide beds enhance soil warming and drainage, and provide enough space for root development. Drip tape is buried 2 cm deep with the drippers facing the top. Drip irrigation enables to apply water soluble nutrients through the irrigation system. Plastic mulches are applied on beds after setting drip irrigation. Black, clear or infrared transmitting (IRT) mulch increase soil temperature and reduce weed emergence during early tomato production. White plastic mulch, which reduces soil temperature, is recommended for late summer or fall tomato production. Clear 8 plastic mulches are more effective at increasing soil temperature but less effective at controlling weeds. While the reverse is true for black plastic mulches (Jett, 2006b). High tunnels extend the growing season, provide shade during summer, protect plants from wind and rain, and decrease incidence of pests and diseases (Hightunnels.org, 2007). Increased temperature in high tunnels allows Ohio farmers to plant tomatoes early in the season and harvest until fall. Protection provided by high tunnels against rain and wind reduces “rain‐splash” borne diseases of tomato such as Septoria leaf spot caused by Septoria lycopersici , bacterial spot caused by Xanthomonas euvesicatoria and bacterial speck caused by Pseudomonas syringae pv. tomato. However, high tunnel environment favors diseases which are not much common in open fields. Such diseases include white mold or timber rot caused by Sclerotinia sclerotiorum, botrytis blight caused by Botritis cinerea and leaf mold caused by Fulvia fulva (syn. Cladosporium fulverum) (Miller, 2006). 1.4 Compost Compost is the end product of controlled biological decomposition of organic materials such as yard trimmings, wood chips, vegetable scraps, paper products, municipal solid waste, animal carcasses, manures, and wastewater sludge (CIWMB, 2006). Compost is a key component in the maintenance of healthy, productive soils (Smith et al., 2001). It contains wide varieties of chemical substances; however, the quality depends on the nature of starting materials and the condition of decomposition (Handayanto et al., 1997; CIWMB, 2006). Carbon is the most abundant element in 9 compost and is not particularly high in essential nutrients. Hence it is considered as a soil conditioner rather than a fertilizer (CIWMB, 2006; Iannotti, 2009). Usually 1‐2 percent nitrogen is present in compost. The ratio of carbon to nitrogen reflects the quality of starting material and maturity of compost. Aged compost has higher concentration of nitrogen due to the loss of carbon as carbon dioxide gas (Mellilo et al., 1982; CIWMB, 2006; Mugendi et al., 1999). Low quality compost has high lignin and polyphenol contents resulting in slower decomposition and nutrient release rates (Mellilo et al., 1982) Application of compost to the field increases the quality of soil in several ways. Compost supplies essential nutrients such as nitrogen, phosphorous, potassium, calcium, sulfur and micronutrients to plants. Unlike soluble inorganic fertilizers, nitrogen in compost is organic in form and mineralizes over time ensuring long term supply of nitrogen (Kettler, 1997; Mellilo et al., 1982; CIWMB, 2006). In addition to fertilization, compost is also used as a soil amendment. Compost lowers the bulk density and increases the permeability and porosity of soil. Compost also adds microorganisms which produce cementing agents such as gels, gums, slimes, and other polysaccharides which help binding soil particles together. It also protects clayey soil from compaction and provides the sandy soil with the capacity to retain water. Organic matters present in compost have high cation exchange capacity (CEC). High CEC of the compost helps to retain plants nutrients such as calcium, magnesium and potassium, which is generally cationic. 10 CEC increases the buffering capacity of compost which in turn protects soil from rapid fluctuations in pH (CIWMB, 2006). Disease suppression is another important aspect of compost. Numerous reports of disease suppression by compost have been published. Diseases caused by soil inhabiting pathogens Rhizoctonia solani and Sclerotinia rolfsii were suppressed by composted cattle manure or composted grape mare (Hadar and Gorodecki, 1991). Disease conducive planting mixes prepared with sphagnum peat when mixed with compost suppressed Pythium root rot and damping off (Chen et al.,1988). Compost amendment reduced the incidence of anthracnose fruit rot in organic tomato and bacterial spots on fruits in conventional tomato production (Abbasi et al., 2001). Scheuerell et al. (2005) analyzed thirty six compost samples for suppression of damping‐
off, 67 percent of them reduced damping‐off of cucumber caused by Pythium irregulare, 64 percent reduced damping‐off of cucumber caused by P. ultimum, and 17 percent suppressed damping‐off of cabbage caused by Ralstonia solani. The authors recommended fortifying composts with antagonistic microorganisms for the control of R. solani. Beside root and soil borne diseases, compost also suppressed foliar diseases. Powdery mildew on small grains and anthracnose of cucumber was significantly reduced by the application of compost in soil (reviewed in Hoitink et al., 2001). Recently, composts are also being used as tea. Compost tea is prepared by incubating the mixture of compost and water in presence or absence of air and is called aerated compost tea (ACT) or non‐aerated compost tea (NCT) respectively. In aerated 11 compost tea, one part compost is generally mixed with 10‐50 parts water and incubated for about 12‐24 hours. Non‐aerated compost tea has one part of compost mixed with 3‐
10 parts of water and incubated for 1‐3 weeks. These teas can also be amended with additives such as molasses, yeast, and algal powder to increase microbial population densities (NOSB, 2004; Scheuerell et al., 2004). Compost tea is produced to augment and transfer microbial biomass, fine particulate organic matter and soluble chemicals of compost into an aqueous phase, which makes its application on plant surface and soil easier and possible (NOSB, 2004). However, compost and compost tea are not always able to suppress plant diseases. Nelson and Craft (1992) used six different animal manures against dollar spot disease of turf grass. None of them suppressed the disease. They also reported that some composts were disease suppressive in laboratory but were ineffective in the field (Craft and Nelson, 1996). Boehm and Hoitink (1992) showed that planting mix with most decomposed, dark peat was least effective against Pythium root rot of poinsettia and vice versa. This variability in the activity of compost and compost tea may be due to the variability in starting materials, the production process, nutrients, application method and timing, pathogen pressure and environmental conditions (NOSB, 2004).
Autoclaving the compost prior to sowing eliminates it disease suppression capacity. This attributes the disease suppression activity of compost to the microbial population (Chen and Nelson, 2008). Nelson et al (1983) analyzed the ability of 331 fungal isolates from composted media to suppress damping‐off disease. Members of 12 genera Trichoderma, Gliocladium, Penicillium, Mortierella, Paecilomyces, Geomyces, and Ophiostoma were the most effective. Similarly, the bacteria species Bacillus cereus, Enterobacter cloacae, Flavobacterium balustinum, Janthinobacterium lividium, Pseudomonas fluorescens biovar III, P. putida, P. stutzeri, and Xanthomonas maltophilia suppressed the damping‐off disease in compost amended media (Kwok et al., 1987). Competition, antibiosis, hyperparasitism and induction of resistance in host plant are general disease suppression mechanisms. Germination and growth of propagules of Pythium and Rhizoctonia are inhibited by the activity of wide range of micro‐organisms found in compost. This kind of suppression is called “general suppression”. In case of Rhizoctonia solani, there are relatively very few groups of microorganisms which can inhibit its growth. Hence this kind of suppression is called “specific suppression” (Hoitink et al., 1991, 2001). 1.5 Muscodor Muscodor albus is an endophytic fungus isolated from the tree, Cinnamomum zeylanicum in 1997 (Strobel et al. 2001, Strobel and Ezra 2008). The fungus got its name from its white (latin: albus) appearance and the stinky (latin: Muscodor) gas it produces (Woropong et al. 2001). In culture, White suppressed mycelium of the fungus has coiled and ropy hyphae with frequent right angle branching (Strobel 2006). The fungus does not produce any kind of spores. Hence it has been placed under the family Xylariaceae on the basis of Internal Transcribed Spacers (ITS) sequence of ribosomal DNA (Woropong et al. 2001). 13 M. albus produces highly active volatile organic compounds (VOCs) with antibiotic effects. Gas Chromatography‐Mass Spectrometry (GC/MS) analysis of the VOCs revealed the presence of 28 different compounds of five major classes: lipids, esters, alcohol, ketones, and acids ( Strobel et al. 2001, Strobel and Ezra 2008). VOCs produced by M. albus though have in vitro antibiotic effect on many pathogenic fungi, Gram positive and Gram negative bacteria, some of them, such as Bacillus subtilus, are not affected (Strobel , 2006). These VOCs are also lethal to many human pathogens like E. coli, Vibrio cholerea, Candida albicans and Aspergillus fumigates. Hence M. albus is being used to control harmful microbes in human and animal wastes (Strobel and Ezra 2008). This fungus has been studied the most for its effect to control postharvest rots and root diseases of plants. M. albus was more effective against post harvest gray mold of grape caused by Botrytis cinerea at 20oC than at 5oC (Gabler et al. 2006). Brown rot of peach caused by Monilinia fructicola was controlled during cold storage (1‐2oC). The disease control was as effective as fungicide in enclosed cartoons (Schnabel and Mercier, 2006). The fungus provided complete protection of apple fruits from blue mold (Penicillium expansum) and gray mold (Botrytis cinerea), and lemon from green mold (Penicillium digitatum ) and sour rot (Geotrichum citir‐aurantii ) (Mercier and Jimenez, 2004; Mercier and Smilanick, 2005). “Mycofumigation is the use of antimicrobial volatiles produced by fungi such as Muscodor albus and M. roseus for the control of other organisms” (Stinson et al. 2003). 14 After the ban on methyl bromide containing products Muscodor albus have been studied as one of the alternatives for controlling soil borne pathogens. Fumigation of soil with M. albus and M. roseus significantly reduced the diseases caused by Rhizoctonia solani, Pythium ultimum, and Aphanomyces cochlioides on sugar beet and Verticillium wilt on eggplant (Stinson et al. 2003). The incidence of damping off of broccoli caused by R. solani (Mercier and Manker, 2005), and Phytophthora blight of sweet pepper and butternut squash caused by Phytophthora capsici (Camp et al 2008) were reduced by fumigation with M. albus. Pre plantation fumigation of soil with M. albus significantly reduced the incidence of Rhizoctonia root and hypocotyl rot of radish caused by Rhizoctonia solani (Baysal et al. 2007) and damping off of cabbage caused by Pythium aphanidermatum (Gurel and Miller, 2008). 1.6 Trichoderma Trichoderma is a common soil fungus. It is classified as a member of the family Hypocreaceae, order Hypocreales of the phylum Ascomycota (Hawksworth et al. 1995, Alexopoulos et al. 1996). Conidiophores are simple or branched, bearing phalides from which conidia are produced. Most do not have a sexual reproductive phase, however, a few Trichoderma species are known to have a teleomorphic state, represented by the Hypocerea species and possibly also the Podostroma species and other closely related genera of Hypocreaceae (Bissett, 1984, 1991). The species are characterized by fast growing colonies, initially hyaline then turning green (Esposito and de silva 1998). 15 Trichoderma species have been used in the biological control of plant diseases (Esposito and de Silva, 1998). In many cases they are found to be as effective as fungicides in controlling some plant diseases. For example, T. hamatum 382 was as effective as metalaxyl against Phytophthora capsici in cucumber (Khan et al. 2004). Similarly, it provided a very high level of protection against powdery mildew and Botrytis blight of begonia (Horst et al. 2005), Phytophthora crown rot and leaf blight of cucumber (Khan et al. 2004), damping off of radish (Chung et al. 1990), and leaf spot of tomato caused by Xanthomonas euvesicatoria 110C (Alfano et al. 2007). T. harzianum T39 suppressed grey mold of tomato, lettuce, pepper, bean and tobacco (De Meyer et al. 1998); foliar pathogens such as Botrytis cinerea, Pseudoperonospora cubensis, Sclerotinia sclerotiorum and Sphaerotheca fucas of cucumber (Elad 2000). Likewise, T. harzianum was effective against Phoma tracheiphila and grey mold of lemon plants (Gentile et al. 2007). T. virens controlled the Pythium ultimum, Rhizoctonia solani and Rhizopus oryzae of cotton (Djonovic et al. 2007). Similarly, Pseudomonas syringae pv. lachrymans in cucumber was controlled by T. asperellum (T‐203) (Yeddia et al. 2003). There are more than 50 Trichoderma based agricultural products available worldwide (Woo et al. 2006). They employ a wide range of mechanisms for disease control (Howell 2003, Harman et al. 2004, Harman 2006, Hoitink et al. 2006,). Principle mechanisms proposed include acting directly upon the pathogens, such as mycoparasitism, antibiosis and competition (Elad 1996, Chet et al. 1998). Weindling (1932) presumed biocontrol of 16 Rhizoctonia solani by T. lignorum by mycoparasitism. Gliotoxin produced by T. virens was effective against Rhizoctonia solani and Sclerotinia americana (Weindling 1941, Rehner and Samuels 1994). Similarly, gliovirin, an antibiotic, produced by T. virens (GV‐
P) was inhibitory to Pythium ultimum and Phytophthora species (Howell and Stipanovic 1983). Production of enzymes such as chitinase and/or glucanases is another possible mechanism (Howell, 2003). T. koningii protected onion roots from Sclerotium cepivorum by producing endo‐ and exo‐chitinases (Metcalf and Wilson 2001). An endochitinase mutant of T. harzianum had reduced biocontrol activity on Botrytis cinerea, however, the mutant was as effective as the wild type against P. ultimum. This suggests that activities other than chitinase are also involved in biocontrol (Woo et al. 1999). Recent studies have demonstrated Trichoderma as an agent to induce systemic or localized resistance in plants (Herman, 2005). Trichoderma colonizes the roots, which substantially changes the proteome and metabolism of plants by inducing resistance pathways (Herman, 2004). Resistance is induced in plants in response to various biotic and/or abiotic activities, for example, attack by a pathogen, physical damage, treatment with various chemical inducers and root colonization by growth promoting rhizobacteria (Kuc, 2001; Pieterse et al., 1996, 1998, 2000). On the basis of inducers of resistance and certain intermediates of resistance pathways, induced resistance has been described as either Systemic Acquired Resistance (SAR) or Induced Systemic Resistance (ISR). SAR is induced by necrotizing or avirulent pathogens; salicylic acid is accumulated in plants and detectable amounts of pathogenesis‐ related proteins (PR Proteins) are expressed 17 (Sticher et al. 1997). Unlike SAR, ISR is induced by root colonizing rhizobacteria and requires a functional response to jasmonic acid and ethylene. Both SAR and ISR are dependent on the transcription factor NPR1 (Bakker et al. 2003, Pieterse et al., 1998). However, Ryu et al (2004) showed that the jasmonic acid pathway is independent of NPR1. The mechanism of resistance induction by Trichoderma species is still unclear. Colonization of roots by T. harzianum T‐203 was accompanied by increased accumulation and activity of PR proteins (Yedida et al., 2000), which resembles SAR activated by pathogens and/or salicylic acid. However, another study showed that T. asperellum modulated the expression of genes Lox1, Pal1, ETR1, and CTR1 which are involved in ISR pathways (Shoresh et al. 2004). Woo et al (2006) showed that Trichoderma spp. transfer different types of proteins like ABC transporters, enzymes and other proteins that are involved in gene‐for‐gene interactions, resistance and mycoparasitism induction in the plant during root colonization. Trichoderma species also induce plant proteins involved in the protection of plants. Similarly, SM1 (Small protein 1), an elicitor secreted by T. virens, increased the production of reactive oxygen species in plants and induced the expression of defense related genes (Djonovic et al. 2006). To understand the mechanism of resistance induced by Trichoderma, Alfano et al. (2007) performed high density oligonucleotide microarray experiment. They showed that 45 out of 15,925 genes of tomato were differentially expressed in the leaves of 18 plants grown in Trichoderma hamatum 382 amended planting medium. These differentially expressed genes were associated with biotic and abiotic stress and metabolism. The main markers of SAR were not expressed. They found that extensin and extensin‐like proteins and osmotin‐like proteins were upregulated; expansin was down regulated. 1.7 Extensin Extensin is a class of structural cell wall protein (Showalter 1993). The term “extensin” refers to the extended rod‐like appearance provided by the polyproline II helical conformation of the protein (Cooper et al. 1987). They are hydroxyprolin‐rich glycoproteins (HRGPs) with the highly repeated pentapeptide Ser(Hyp)4 separated by short oligopeptides (Guzman et al. 1990, Tierney and Varney 1987). They are secreted in soluble form in the cell wall and later solidify by the formation of intra and inter‐cross‐
links (Kieliszewski and Lamport 1994). These cross‐links strengthen the cell wall, and discourage the penetration by pathogens (Showalter et al. 1985). Genes encoding extensin have been isolated from different plants. npExt has been isolated from roots of tobacco (De Loose et al. 1991), aExt from roots of almond (Garcia‐Mas et al. 1992), SbHRGP3 from roots of soybean (Ahn et al. 1996), atExt1 from roots, inflorescences, leaves, abscission and senescence region of Arabidopsis (Merkouropoulous and Shirsat 2003), and Ext 1 from leaves of Arabidopsis (Wei and Shirsat 2006). 19 Extensin genes are expressed throughout plant development (Merkouropoulous and Shirsat 2003). Roots, nodes and vascular tissues that bear pressure are the major sites where these genes usually are expressed (Kellar and Lamb 1989, Tire et al. 1994). Abiotic activities such as wounding, exogenously supplied salicylic acid, methyl jasmonate, auxins and brassinosteroids induced expression of the Ext 1 extensin gene of Arabidopsis (Merkouropoulous and Shirsat 2003). Increased deposition of extensin proteins in the cell wall provides a physical barrier that makes it difficult for invading pathogens to penetrate the wall. This prevents the entry of pathogens into the vascular system and thus limits their systemic spread (Showalter 1993). There is evidence indicating the role of extensin in plant defense. Transgenic Arabidopsis over‐expressing the EXT 1 extensin gene had five times smaller lesions than wild type plants when challenged with Pseudomonas syringae DC 3000. Bacteria were restricted within the lesion of the leaves in the transformed plants (Wei and Shirsat 2006). Increased levels of extensin shown in Arabidopsis inoculated with Xanthomonas campestris pv. campestris also emphasize the role of extensins in plant defense (Merkouropoulos and Shirsat, 2003). 1.8 Osmotin Osmotin is a pathgenesis‐related (PR) protein (Anzlovar and Dermastia, 2003). Plants respond to pathogen invasions or severe environmental stresses by accumulation of various proteins. PR proteins are encoded by the host plant following attack by various pathogens such as viruses, bacteria, and fungi. They are also induced by the 20 application of chemicals that mimic the effect of pathogen infection or induce similar stresses (Bol et al. 1990). These proteins were first isolated from tobacco showing a hypersensitive reaction against tobacco mosaic virus (Van Loon and Van Kammen, 1970). PR proteins were previously divided into five groups (Bol et al. 1990), later another six groups of proteins induced by pathogens were added as PR proteins (Van Loon et al. 1994), and currently 14 classes are recognized (Van Loon and Van Strien, 1999). The group of PR‐5 proteins is cysteine‐rich and has neutral, basic and acidic isoforms. The members of this group are evolutionarily conserved among plants and have been isolated from tobacco (singh et al. 1987), maize (Roberts and Selitrennikoff, 1990), barley (Hejgaard et al. 1991), soybean (Graham et al. 1992), tomato (Rodrigo et al. 1993), Diospyros texana (Vu and Huynh, 1994), pumpkin (Cheong et al. 1977), bittersweet nightshade (Newton and Duman, 2000) and chestnut (Gracia‐Casado et al. 2000). The amino acid sequences of all PR‐5 proteins are similar to that of the sweet‐
tasting protein thaumatin, hence the whole group of PR‐5 proteins is referred to as thaumatins (Anzlovar and Dermastica, 2003). Osmotin was originally identified as the predominant protein accumulated in NaCl‐adapted tobacco cell cultures (Singh et al. 1987). The name was applied because of the positive correlation between the accumulation of the protein and the cell osmotic potential (LaRosa et al. 1992). They are acidic proteins occuring in two forms: an aqueous soluble form (osmotin‐I) with an isoelectric point (pI) of 7.8 and a detergent 21 soluble form (osmotin‐II) with an isoelectric point (pI) 8.2 (Singh et al. 1985, 1987). Osmotins are synthesized as proteins with a molecular weight of 26.4 kDa and processed to 24 kDa (Singh et al. 1989). Post‐translation cleavage may be a requirement for correct transport of osmotins that would otherwise be directed to the apoplast (Melchers et al. 1993).Many native osmotin‐like proteins were reported to have a cationic character with basic or neutral isoelectric points, their isoelectric points estimated from the deduced amino sequences of the corresponding cDNA clones are acidic (Anzlovar and Dermastic, 2003). Sequence data of osmotin‐like genes show that there is no intron interruption in the sequence and the proteins are encoded by a small gene family or by a single copy gene. These proteins have a putative signal N‐terminal sequence of 20‐30 amino acids, conserved 16 cysteine residues and a propeptide of different length at their C‐terminal. Cysteine residues are presumably involved in disulfide bonding (Anzlovar and Dermastic, 2003). Expression of osmotin gene is tissue specific. The highest level of osmotin gene was expressed in older leaves of Arabidopsis thaliana (Capelli et al. 1997) and flower buds of Brassica campestris (Cheong et al. 1997) indicating a preventive measure against opportunist pathogens. Capelli et al. (1997) and Cheong et al. (1997) found very low levels of osmotin in roots. On the contrary, Kim et al. (2002) and Anzlovar (2002) found that the osmotin was primarily expressed in the roots. Osmotin and osmotin‐like proteins have also been isolated from seeds (Anzlovar et al. 1998, Shih et al. 2001) and fruits (Pressey 1997). 22 Besides the constitutive presence of osmotins in different plant tissues, there are several reports of their induction after biotic or abiotic stresses. Osmotin was strongly induced in leaves that were exposed to several biotic or abiotic agents such as fungi, bacteria, wounding, octadecaniod pathway intermediates, and treatments with aspirin and salicylic acid (Kim et al. 2002, Koiwa et al. 1994). Osmotin and osmotin‐like proteins have demonstrated in vitro inhibition of hyphal growth and spore germination, spore lysis and reduction in viability of germinated spores. Though the exact mechanism of action is still unknown, it is supposed that they may act by increasing permeabilty of fungal membranes or interaction with fungal membrane receptors (Newton and Duman, 2000, Abad et al. 1996, Ibeas et al. 2000). In addition, it has been demonstrated that a number of PR‐5 proteins bind β‐1,3‐glucan and show weak β‐1,3‐glucanase activity. Further, a tobacco osmotin induces apoptosis in yeast cells (Narasimhan et al. 2001). However, the molecular mechanisms of membrane permeabilization, interaction with fungal receptor and apoptosis remain unclear (de A Campos et al. 2008). Expression of osmotin in plants after pathogen attack increase plants resistance to the pathogen. Osmotin extracted from tobacco inhibited in‐vitro growth of 31 isolates of 18 genera of fungi studied (Abad et al. 1996). Grape osmotin inhibited hyphal growth of Botrytis cinerea (Salzman et al. 1998). Over expression of osmotin‐like protein P23 inhibited the growth of a mumber of phytopathogenic fungi such as Fusarium oxysporum f.sp. lycopersici, Colletotrichum coccodes, Trichothecium roseum, and 23 Phytophthora citrophthora to different degrees (Rodrigo et al. 1993). PR‐5 from tobacco strongly inhibited hyphal extension of Alternaria solani, Candida albicans, Fusarium oxysporum, Neurospora crassa and Trichoderma reesei (Koiwa et al. 1997). Overexpression of osmotin in potato plants resulted in delayed development of disease symptoms after inoculation with Phytophthora infestans (Liu et al. 1993). Similarly, the maize PR‐5 protein zeamatin caused lysis of Neurospora crassa and Candida albicans cells (Roberts and Selitrennikof, 1990). 1.9 Expansin Expansin proteins were first isolated from cucumber seedlings. As those proteins were able to induced acid mediated expansion of isolated cucumber cell walls they were named expansins (McQueen‐Mason et al. 1992, Li et al. 1993). Since then similar proteins have been found in all seed plants examined (Lee et al. 2001). Expansins are secreted by plants during growth, loosening cell walls resulting in cell enlargement. Germinating grass pollen also secretes expansin to loosen maternal cell walls and help to penetrate the stigma by the pollen tube (Cosgrove, 2000). Expansin also plays an important role in plant‐microbe interactions. Recent studies have shown that nematodes, bacteria and fungi use expansins for invasion and colonization of plant tissue (Brotman et al. 2008, Kerff et al. 2008, Wieczorek et al. 2006, Qin et al. 2004, Cosgrove et al. 2002). Expansins are encoded by multigene families. BLAST searches of the Arabidopsis genome revealed a total of 38 open reading frames (ORFs) that encode expansin‐like 24 proteins, compared to 80 in rice. On the basis of a phylogenetic tree generated from expansin sequences, they were divided into two subfamilies: α‐ and β‐ expansins (Cosgrove 2002, Yi et al. 2003). Two additional subfamilies have now been identified, γ‐
and δ‐ expansins, from Arabidopsis and rice respectively. Both are derivatives of α‐ and β‐expansins. γ‐expansins lack the carboxy‐terminal half of the canonical α‐and β‐
expansin groups, where as δ‐expansins lack the amino‐terminals (Yi et al. 2003). γ‐ and δ‐expansins are also called expansin‐like A (EXPLA) and expansin‐like B (EXPLB) respectively. The polyphyletic group of non‐plant expansins is referred to as expansin‐
like family X (EXLX). The relationship of various groups of expansin‐like family X proteins with the plant expansins is unclear (Sampedro and Cosgrove, 2005). The conserved exon/intron organization among α‐, β‐, γ‐ and δ‐expansins led to the hypothesis that all these expansins were evolved from a common ancestral gene (Yi et al. 2003). Both α‐ and β‐expansins have a similar cleaved signal peptide at the amino terminus, a series of cysteines with characteristic spacing and conserved flanking sequences, an “HFD” (histidine, phenyalanine, glutamic acid) motif, and a series of tryptophans and other aromatic residues at the characteristic positions in the protein backbone (Cosgrove 2002). Sequence logo, a graphical representation of consensus sequence conservation, shows the sequences that are conserved within and between these two families. The two families also differ in the presence of N‐linked glycosylation motifs, which generally are absent in α‐ but present in β‐expansin sequences (Cosgrove 2002, Schneider and Stephens 1990). 25 Mature expansins contain two domains. Domain 1 has homology to family‐45 endoglucanases. This suggests that expansin has endoglucanase activity. However, experiments failed to establish any hydrolytic activities. Domain 2 has homology to a group of proteins found in grass pollen, called group‐2 grass pollen allergen. This allergen is supposed to be a polysaccharide binding domain (Barre and Rouge 2002, Cosgrove 2000, Cosgrove et al. 2002). An additional group of proteins homologous to expansin domain 2 has been reported from grasses. This group is supposed to be evolved from β‐expansin ancestors by the loss of domain 1. Similarly, a few other groups of plant proteins show some homology to expansin domain 1, but they lack domain 2. According to recent nomenclature rules, only proteins with homology to both expansin domains are designated as expansins (Sampedro and Cosgrove, 2005) The exact mechanism of the expansins action has not yet been confirmed. Expansins neither alter the viscosity of solutions of matrix polysaccharides nor cause progressive weakening of the walls, which rules out hydrolytic activity. Further, very low amounts of expansins in the growing cell walls suggest their catalytic activity (McQueen–Mason and Cosgrove, 1995). In contrast, protease activity of expansins was proposed by Grobe et al (Grobe et al. 1999, 2002). However, the protease activity of expansins was refuted by using five different protease assays (Li and Cosgrove, 2001). Expansins act very quickly. They induce rapid extension within seconds of addition to wall specimens, but they do not affect the plasticity or elasticity of the cell wall. In case of endoglucanase activity, it has long lag time and results in increased plasticity and 26 elasticity. This shows that the activity of expansins is different from that of hydrolytic enzymes (Sampedro and Cosgrove, 2005, Yuan et al. 2001). A non‐enzymatic mechanism is often suggested for expansin action. The expansin is thought to act like a zipper that enables microfibrils to move apart from each other by ungluing the chains that stick them together. (Whitney et al. 2000). Though a biochemical mode of action is unknown, expansin acts in catalytic amounts and stimulates wall creep without causing major covalent alternation of the cell wall (Cosgrove 2000, McQueen‐Mason and Cosgrove 1994, 1995, Sampedro and Cosgrove 2005). An increasing number of studies by different groups are revealing a wide array of biological functions of expansins. Expansins got their name because of their ability to induce wall extension. This function of expansins has been confirmed by several ectopic expressions in transgenic plants (Cosgrove et al. 2003). Ectopic expression of the Arabidopsis EXP 10 gene resulted in plants with longer petioles and larger leaf blades (Cho and Cosgrove 2000). Over expression of extensin gene OsEXPA4 in rice enhanced seedling growth and leaf formation, whereas downregulation resulted in reduced growth. Contrary to this, transgenic plants with strong expression of OsEXPA4 showed stunted growth with additional leaves (Choi et al. 2003). This bushy phenomenon might have been caused by the presence of expansins beyond an optimal concentration for stem growth (Choi et al. 2006). Expansins are also involved in growth and development of roots. In primary roots, expansins were predominantly expressed in the tip region, 27 particularly in the epidermis, in the differentiating vascular cylinder and around the pericycle. Developing adventitious roots and lateral root primordia also contained high levels of expansin mRNA (Cho and Kende, 1998). Expansins are also involved in other developmental process where wall loosening occurs. The tomato expansin gene, LeEXPA1, is expressed during fruit ripening (Rose et al. 1997). Transgenic tomato fruits with higher levels of LeEXPA1 gene expression were much softer than controls (Brummell et al. 1999) with more viscous tomato paste and juice with larger particle size (Kalamaki et al. 2003), whereas fruits with reduced LeEXP1 expression were firmer (Brummell et al. 1999). Other fruits such as cherry (Yoo et al. 2003), strawberry (Harrison et al. 2001), peach (Obenland et al. 2003) and banana (Trivedi and Nath, 2004) also showed higher level extensions expression during ripening. Expansins are involved in primary and secondary xylem formation (Gray‐Mitsumune et al. 2008, 2004), accumulate in leaf abscission zones and promote leaf shedding (Belfield et al. 2005), weaken endosperm during tomato seed germination to allow emergence of the root from the seed (Chen and Bradford, 2000), and help the pollen tube to penetrate the stigma and style (Pezzotti et al. 2002). Expansins are also known to play roles in symbiotic relationships between plants and micro‐organisms. Immunolabelling experiments revealed that during mycorrhizal interaction, expansins are involved in the formation and maintenance of the interface, and cell wall loosening agent required during the intercellular colonization. The presence of expansins in mycorrhizal cells suggests that fungus‐induced enlargement of 28 cortical cells is achieved through expansin activities (Balestrini et al. 2005, Choi et al. 2006). Similarly, expansins expressed during Prepenetration Apparatus (PPA) development can be considered as the host marker for successful mycorrhizal relationship (Siciliano et al. 2007). The expansin gene, MaEXP1, was upregulated in the process of nodule formation during the sweet clover‐Sinorhizobium interaction (Giordano and Hirsch, 2004). This finding suggests that expansins in legume roots may contribute to nodule formation by promoting enlargement of root cells (Choi et al. 2006). As in symbiotic relationships, expansins are also involved in the parasitic relationships. Striga asiatica, a hemiparasitic angiosperm, uses expansin mRNAs as molecular markers to develop haustoria (O’Malley and Lynn, 2000). Syncytia are feeding sites of cyst nematodes within the roots. Two expansin genes, LeEXPA4 and LeEXPA5 were involved in the formation of syncytia during potato cyst nematode‐
tomato interaction. One of the expansins was supposed to be involved in cell wall disassembly or relaxation and the other in enlargement of cells incorporated into syncytium (Fudali et al. 2008, Gal et al. 2006). Wieczorek et al. (2006) after studying Heterodera schachtii‐Arabidopsis thaliana interaction came to a similar conclusion. They concluded that syncytium formation involves the specific regulation of expansin genes which take part in cell growth and cell wall disassembly. Some literature also deals with expansins produced by organisms other than plants. The plant parasitic round worm Globodera rostochiensis, produces an expansin, 29 that loosens cell walls when invading plants. The ability of this nematode to disrupt covalent bonds in plant cell walls challenged the traditional concept that animals are genetically weak in capacity to degrade plant cell walls (Qin et al 2004). Expressed Sequence Tag (EST) data suggest that the other plant parasitic nematodes also have expansins (Kudla et al. 2005). Clavibacter michiganensis ssp. sepedonicus encodes a cellulase. This cellulase has an expansin‐like domain and plays a role in virulence (Laine et al 2000). Aspergillus nidulans has a gene called eglD which encodes an expansin‐like protein in conidial cell walls. This protein could be involved in cell wall remodeling during germination (Bouzarelous et al. 2008). Bacillus subtilis secretes a protein similar to plant β‐expansins. This protein has shown cell wall extension activity comparable to plant β‐expansin. Deletion of the gene encoding this protein has reduced the colonizing ability of the bacterium. Homologs of this protein have been found in a small but diverse set of plant pathogens, which emphasizes a role of this protein in plant‐bacterial interactions (Kerff et al. 2008). The slime mold Dictyostelium discoideum also has genes that resemble those encoding plant expansins but their function is still unclear (Darley et al. 2003). Swollenin is a protein first characterized in the saprophytic fungus Trichoderma reesei and has a C‐terminal domain similar to that of expansin. This protein disrupts the structure of the cell wall without producing detectable amounts of reducing sugars (Saloheimo et al. 2002, Brotman et al. 2008). Transgenic Trichoderma asperellum overexpressing swollenin has shown a remarkably increased ability to colonize 30 cucumber roots. The expansin like domain of this protein is capable of stimulating local defense responses in cucumber roots and leaves and to afford local protection toward Botrytis cinerea and Pseudomonas syringae pv lachrymans infection. This suggests that the expansin like domain of swollenin might be recognized by the plant as a microbe‐
associated molecular pattern (MAMP) in the Trichoderma‐plant interaction (Brotman et al. 2008). In this study we evaluated bio‐rational products for the control of diseases in high tunnel tomatoes. We evaluated a bio‐control fungus Trichoderma hamatum 382 and bio‐fumigant Muscodor albus singly and in combination; and copper compound ‘Kocide’ and commercial formulation of hydrogen peroxide ‘OxiDate’, along with composted dairy manure. We also assessed bio‐control activity of Trichoderma hamatum 382 on leaf spot disease of tomato (Xanthomonas euvesicatoria 110C) in greenhouse. We monitored the effect of T. hamatum 382 on periodic expression of defense genes extension, osmotin and expansin in tomato leaves in the presence and absence of T. hamatum 382 before and after inoculation with X. euvesicatoria 110C. . 31 REFERENCES Abad, L. R., D’Urzo, M. P., Narasimha, M. L., Reuveni, M., Zhu, J. K., Niu, X., Singh, N. K., Hasegawa, P. M., and Bressan, R. A. 1996. Antifungal activity of tobacco osmotin has specificity and involves plasma membrane permeabilization. Plant Sci. 118: 11‐23. Abbasi, P. A., Al‐Dahmani, J., Sahin, F., Hoitink, H. A. J., and Miller, S. A. 2001. Effect of compost amendments on disease severity and yield of tomato in conventional and organic production system. Plant Disease 86: 156‐161. Abbasi, P. A., Al‐Dahmani, J., Sahin, F., Hoitink, H. A., and Miller, S. A. 2002. Effect of disease severity and yield of tomato in conventional and organic production systems. Plant Dis. 86: 156‐161. Acquaah, G. 2002. Horticulture: Principles and Practices. New Jersey: Prentice Hall. Agrios, G. N. 1997. Plant Pathology. Hardcourt Academic Press. 635 pp. Ahn, J. H., Choi, Y., Kwon, Y. M., Kim, S. G., Choi, Y. D., and Lee, J. S. 1996. A novel extensin gene encoding a hydroxyproline‐rich glycoprotein requires sucrose for its wound‐inducible expression in transgenic plants. Plant Cell 8:1477‐1490. Alexopoulos, C. J., Mims, C. W, and Blackwell, W. 1996. Introductory Mycology. 4th Edition. Wiley, New York. Alfano, G., Lewis Ivey, M. L., Cakir, C., Bos, J. I. B., Miller, S. A., Madden, L. V., Kamoun, S., and Hoitink, H. A. J. 2007. Systemic modulation of gene expression in tomato by Trichoderma hamatum 382. Phytopathology 97: 429‐437. Anonymous. 2000. Hybrid round red tomato. Siegers Seed Company, http://www.siegers.com/shop/kind.asp?kind_id=TM7#940081 Anonymous. Lycopersicon – Garden Apple, Gold Apple, Love Apple, Pomo D’oro, Tomato. http://www.botany.com/lycopersicon.html Anzlovar, S. 2002. Analysis of gene for PR‐5 protein from flax. Ph.D. Thesis, Ljubljana, pp. 1‐143. Anzlovar, S., and dermastia, M. 2003. The comparative analysis of omsotins and osmotin‐like PR‐5 proteins. Plant biol. 5: 116‐124. 32 Balestrini, R., Cosgrove, D. J., and Bonfante, P. 2005. Differential location of α‐expansin proteins during the accommodation of root cells to an arbuscular mycorrhizal fungus. Planta 220: 889‐899. Barre, A., and Rouge, P. 2002. Homology modeling of the cellulose‐binding domain of a pollen allergen from rye grass: structural basis for the cellulose recognition and associated allergenic properties. Biochemical and Biophysical Research Communications 296: 1346‐1351. Bashan, Y. 1982. Bacterial diseases of tomato and pepper. Phytoparasitica 2(10):122. Basim, J. B., Jones, G., Minsavage, V., and Dickstein, E. R. 2004. Bacterial spot of tomato and pepper caused by Xanthomonas axonopodis pv. vesicatoria in the Western Mediterranean region of Turkey. Plant Disease 88 (1): 85. Baysal‐Gurel, F., and Miller, S. A. 2008. Efficacy of biopesticides and fungicides against pre‐ and post‐emergence damping off of vegetable seedlings by Pythium aphanidermatum. (Abstr.) Phytopathology 98:S19. Baysal‐Gurel, F., Mera, J. R., and Miller, S. A. 2007 Effects of Muscodor, serenade and conventional fungicide on rhizoctionia root and hypocotyl rot and clubroot of radish. (Abstr.) Phytopathology 97: S9. Beattie, G., and Lindow, S. E. 1995. The secret life of foliar bacterial pathogens on leaves. Annu. Rev. Phytopathol. 33: 145‐172. Belfield, E. J., Ruperti, B., Roberts, J. A., and McQueen‐Mason, S. 2005. Changes in expansin activity and gene expression during ethylene‐promoted leaflet abscission in Sambucus nigra. J. Exp. Bot. 56: 817‐823. Bisseett, J. 1984. A revision of the genus Trichoderma. I. Section Longibrachiatium sect. nov., Can. J. Bot., 62: 924. Bisseett, J. 1991. A revision of the genus Trichoderma. II. Infrageneric classification, Can. J. Bot., 69: 2357 Boehm, M. J., and Hoitink, H. A. J. 1992. Sustenance of microbial activity in planting mixes and its impact on severity of pythium root rot of poinsettia. Phytopathology 82: 259‐264. Bol, J. F., Linthorst, H. J. M., and Cornelissen, B. J. C. 1990. Plant pathogenesis‐related proteins induced by virus infection. Ann. Rev. Phytopathol. 28: 113‐138. 33 Borgmeyer, J. R., Smith, C. E., and Huynh, Q. K. 1992. Isolation and characterization of a 25 kda antifungal protein from flax seeds. Biochem. Bouzarelou, D., Billini, M., Roumelioti, K., and Sophianopoulou, V. 2008. EglD, a putative endoglucanase, with an expansin like domain is localized in the conidial cell wall of Aspergillus nidulans. Fungal Genet Biol. 45: 839‐50. Brotman, Y., Briff, E., Viterbo, A., and Chet, I. 2008. Role of swollenin, an expansin‐like protein from Trichoderma, in plant root colonization. Plant Physiol. 147: 779‐89. Brummell, D. A., Harpster, M. H., and Dunsmuir, P. 1999. Differential expression of expansin gene family members during growth and ripening of tomato fruit. Plant Mol. Biol. 39: 161‐169. Camp, A. R., Dillard, H. R., and Smart, C. D. 2008. Efficacy of Muscodor albus for the control of Phytophthora blight of sweet pepper and butternut squash. Plant Dis. 92: 1488‐1492. Candolle, A. P. de. 1884. Origin of cultivated plants. Capelli, N., Diogon, T., Greppin, H., and Somon, P. 1997. Isolation and characterization of cDNA clone encoding an osmotin‐like protein from Arabidopsis thaliana. Gene. 191: 51‐
56. Chen, F., and Bradford, K. J. 2000. Expression of an expansin is associated with endosperm weakening during tomato seed germination. Plant Physiol. 124: 1265‐1274. Chen, W., Hoitink, H. A. J., and Madden, L. V. 1988. Microbial activity and biomass in container media for predicting suppressiveness to damping‐off caused by Pythium ultimum. Phytopathology 78: 1447‐1450. Cheong, N. E., Choi. Y. O., Kim, W. Y., Bae, I. S., Hwang, I., Kim, J. W., and Lee, S. Y. 1997. Purification and characterization of an antifungal PR‐5 protein from pumpkin leaves. Mol. Cells. 7: 214‐219. Cheong, N. E., Choi. Y.O., Kim, W.Y., Kim, S.C., Cho, M. J., and Lee, S. Y. 1997. Purification of an antifungal PR‐5 protein from flower buds of Brassica campestris and cloning of its gene. Physiologia Plantarum 101: 583‐590. Cho, H. T., and Cosgrove, D. J. 2000. Altered expression of expansin modulates leaf growth and pedicel abscission in Arabidopsis thaliana. Proc. Nat'l Acad. Sci. 97: 9783‐
9788. 34 Cho, H. T., and Kende, H. 1997. Expansins and internodal growth of deepwater rice. Plant Physiol. 113: 1145‐1151. Choi, D. S., Lee, Y., Cho, H. T., and Kende, H. 2003. Regulation of expansin gene expression affects growth and development in transgenic rice plants. Plant Cell 15: 1386‐1398. Choi, D., Cho, H. T., and Lee, Y. 2006. Expansins: expanding importance in plant growth and development. Physiologia Plantarum 126: 511‐518. Chung, Y. R., and Hoitink, H. A. J. 1990. Interactions between thermophilic fungi and Trichoderma hamatum in suppression of Rhizoctoniadamping‐off in a bark compost‐
amended container medium. Phytopathology 80:73‐77. CIWMB, 2006. Compost: What is it?. http://www.ciwmb.ca.gov/Organics/CompostMulch/CompostIs.htm Cooper, J. B., Chen, J. A., van Holst, G. J., and Varner, J. E. 1987. Hydroxyproline‐rich glycoproteins of plant cell walls. Trends. Biochem. Sci. 12:24‐27. Cosgrove, D. J. 2000. Loosening of plant cell walls by expansins. Nature 407: 321‐326. Cosgrove, D. J., Li, L.‐C., Cho, H. T., Hoffmann‐Benning, S., Moore, R. C., and Blecker, D. 2002. The growing world of expansins. Plant & Cell Physiology 43: 1236‐1244. Craft, C. F., and Nelson, E. B. 1996. Microbial properties of composts that suppress damping off and root rot of creeping bentgrass caused by Pythium graminicola. Appl. Environ. Microbiol. 62: 1550‐1557. Dal Bello, G. M. 2000. First Report of Colletotrichum dematium on tomato in Argentina. Plant disease 84 (2): 198. Darley, C.P., Li, Y., Schaap, P., and McQueen‐Mason, S.J. 2003. Expression of a family of expansin‐like proteins during the development of Dictyostelium discoideum. FEBS Lett. 546: 416‐418. de A Campos , M. A., Silva, M. S., Magalhaes, C. P., Ribeiro, S. G., Sarto, R. P. D., Vieira, E. A., and Grossi, M. F. 2008. Expression in Escherichia coli, purification, refolding and antifungal activity of an osmotin from Solanum nigrum. Microbial Cell Factories 7:7. De Loose, M., Ghey, G., Tire, C., Gielen, J., Villarroel, R., Genetello, C., van Montagu, M., Depicker, A., and Inze, D. 1991. The extensin signal peptide allows secretion of a heterologous protein from protoplasts. Gene 99:95‐100. 35 De Meyer, G., Bigirimana, J., Elad, Y., and Hofte, M. 1998. Induced systemic resistance in Trichoderma harzianum T39 and biocontrol of Botrytis cinerea. Eur. J. Plant Pathol. 104:279‐286. Diver, S., Kuepper, G., and Born, H. 1999. Organic tomato production. Appropriate Technology Transfer for Rural Areas. 800‐346‐9140 Djonovic, S., Pozo, M. J., Dangott, L. J., Howell, C. R., and Kenerley, C. M. 2006. Sm1, a proteinaceous elicitor secreted by the biocontrol fungus Trichoderma virens induces plant defense responses and systemic resistance. Mol. Plant‐Microbe Interact. 19:838‐
853. Djonovic, S., Vittone, G., Mendoza‐Herrera, A., and Kenerley, C. M. 2007. Enhanced biocontrol activity of Trichoderma virens transformants constitutively coexpressing β‐
1,3‐ and β‐1,6‐ glucanase genes. Mol. Plant pthol. 8:469‐480. Elad, Y. 1996. Mechanisms involved in the biocontrol of Botrytis cinerea incited disease. Eur. J. Plant Pathol. 102: 719‐732. Elad, Y. 2000. Biological control of foliar pathogens by means of Trichoderma harzianum and potential modes of action. Crop Protection. 19:709‐714. Esposito, E., and da Silva, M. 1998. Systematics and environmental application of the genus Trichoderma. Critical Rev. in Microbiology, 24:89‐98. Fry, W. E., and Goodwin, S. B. 1997. Re‐emergence of potato and tomato late blight in the United States. Plant Disease 81 (12): 1349‐1357.
Fudali, S., Janakowski, S., Sobczak, M., Griesser, M., Grundler, F. M., and Golinowski, W. 2008. Two tomato alpha‐expansins show distinct spatial and temporal expression patterns during development of nematode‐induced syncytia. Physiol Plant. 132:370‐83. Gabler, F. M., Fassel, R., Mercier, J., and Smilanick, J. L. 2006. Influence of temperature, inoculation interval, and dosage on biofumigation with Muscodor albus to control postharvest gray mold on grapes. Plant Dis. 90: 1019‐1025. Gal, T.Z., Aussenberg, E. R., Burdman, S., Kapulnik, Y., and Koltai, H. 2006. Expression of a plant expansin is involved in the establishment of root knot nematode parasitism in tomato. Planta 224: 155‐162. Garcia‐Mas J., Messeguer, R., Arus, P., and Puigdomenech, P. 1992. The extensin from Purnus amygdalus. Plant Physiol. 100:1603‐1604. 36 Gentile, A., Deng, Z., La Malfa, S., Distefano, G., Domina, F., and Kenerley, C. M. 2007. Enhanced resistace to Phoma tracheiphila and Botrytis cinera in transgenic lemon plants expressing a Trichoderma harzianum chitinase gene. Plant Breeding 126:146‐151. Giordano, W., and Hirsch, A. M. 2004. The expression of MaEXP1, a Melilotus alba expansin gene, is upregulated during the sweetclover‐Sinorhizobium meliloti interaction. Mol Plant Microbe Interact. 17: 613‐22. Gitaitis, R. D. 2006. Bacterial canker. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: pp 25‐26. Gracia‐Casado, G., Collada, C., Allona, I., Soto, A., Casado, R., Rodriguez‐Cerezo, E., Gomez, L., and Aragoncillo, C. 2000. Characterization of an apoplastic basic thaumatin‐
like protein from recalcitrant chestnut seeds. Physiologia Plantarum 110: 172‐180. Graham, J. S., Burkhart, W., Xiong, J. and Gillikin, J. W. 1992. Complete amino acid sequence of soybean leaf P21. Plant physiol. 98: 163‐165. Gray‐Mitsumune, M., Blomquist, K., McQueen‐Mason, S., Teeri., T. T., Sundberg, B., Mellerowicz, E. J. 2008. Ectopic expression of a wood‐abundant expansin PttEXPA1 promotes cell expansion in primary and secondary tissues in aspen. Plant Biotechnol J. 6:62‐72. Gray‐Mitsumune, M., Mellerowicz, E. J., Abe, H., Schrader, J., Winzell, A., Sterky, F., Blomqvist, K., McQueen‐Mason, S., Teeri, T. T., and Sundberg, B. 2004. Expansins Abundant in Secondary Xylem Belong to Subgroup A of the {alpha}‐Expansin Gene Family. Plant Physiology 135: 1552‐1564. Grobe, K., and Petersen, A. 1999. Grass group I allergens (β‐expansins) are novel, papain related proteinases. European Journal of Biochemistry 263: 33‐40. Grobe, K., Poppelmann, M., Becker, W. M., and Petersen, A. 2002. Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases. European Journal of Biochemistry 269: 2083‐2092. Grogan, R. G., Kimble, K. A., and Misaghi, I. 1975. A stem canker disease of tomato caused by Alternaria alternata f. sp. lycopersici. Phytopathology 65: 880‐886. Guzman, N. A., Fuller, G. C., and Dixon, J. E. 1990. Hydroxyproline‐containing proteins and their hydroxylation by genetically distinct proly 4‐hydorsylase. Organization and assembly of plant and animal extracellular matrix. Academic press, San Diego, pp 301‐
356. 37 Hadar, Y. and Gorodecki, B. 1991. Suppression of germination of sclerotia of Sclerotium rolfsii in compost. Soil Biol. Biochem. 23: 303‐306. Handayanto, E., Cadisch, G., and Giller, K. E. 1997. Regulating N release from legume tree pruning by mixing residues of different quality. Soil. Biol. Biochem. 29: 1417‐1426. Harman, G. E. 2006. Overview of mechanisms and uses of Trichoderma spp. Phytopathology 96:190‐194. Harman, G. E., Howell, C. R., Viterbo, A., Chet, I., and Lorito, M. 2004. Trichoderma species‐opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2:43‐56. Harrison, E. P., McQueen‐Mason, S. J., and Manning, K. 2001. Expression of six expansin genes in relation to extension activity in developing strawberry fruit. J. Exp. Bot. 52: 1437‐46 Hawksworth, D. L., Kirk, P. M., Sutton, B. C., and Pegler, D. N. 1996. Ainsworth & Bisby’s dictionary of fungi, 8th ed., CAB International, Wallingford, 616. Hejgaard, J., Jacobsen, S. and Svendsen, J. 1991. Two antifungal thaumatin‐like proteins from barley grain. FEBS letters 291: 127‐131. Hightunnels.org, 2007. http://www.hightunnels.org/ForEducators/Introduction/What.htm Hirano, S. S., and Upper, C. D. 1991. Bacterial community dynamics. In Microbial Ecology of Leaves, ed. Andrews, J. H., and Hirano, S. S. pp. 271‐294. New York: Springer‐Verlag. Hoitink, H. A. J., Inbar, J., and Boehm, M. J. 1991. Status of compost amended planting mixes naturally suppressive to soil borne diseases of floricultural crops. Plant Dis. 75: 869‐873. Hoitink, H. A. J., Krause, M. S., and Han, D. Y. 2001. Spectrum and Mechanisms of plant disease control with composts. In Stoffella, P. J., and Kahn, B. A. 2001. Compost utilization in horticultural cropping systems. CRC press, pp. 263‐274. Hoitink, H. A. J., Madden, L. V., and Dorrance, A. E. 2006. Systemic resistance induced by Trichoderma spp: Interaction between the host, the pathogen, the biocontrol agent and soil organic matter quality. Phytopathology 96;186‐189. Horst, L. E., Locke, J., Krause, C. R., McMahon, R. W., Madden, L. V., and Hoitink, H. A. J. 2005. Suppression of Botrytis blight of begonia by Trichoderma hamatum 382 in peat and compost‐amended planting mixes. Plant Dis. 89:1195‐1200. 38 Howell, C. R. 2003. Mechanisms employed by Trichoderma species in the biological control of the plant diseases: The history and evaluation of current concepts. Plant Dis. 87:4‐10. Howell, C. R., and Stipanovic, R. D. 1983. Gliovirin, a new antibiotic from Gliocladium virens, and its role in the biological control of Pythium ultimum. Can. J. Microbiol. 29:321‐324. Iannotti, M. 2009. Compost. http:/gardening.about.com/od/gardenprimer/g/Compost.htm Ibeas, J. I., Lee, H., Damsz, B., Prasad, T. D., Pardo, J. M., Hasegawa, P. M., Bressan, R. A., and Narasimhan, M. L. 2000. Fungal cell wall phosphomannans facilitate the toxic activity of a plant PR‐5 protein. Plant J. 23: 375‐383. Jelev, Z. J., Bobey, S. G., Minz, D., Mavmon, M., and Freeman, S. 2009. Characterization of Colletotrichum Species Causing Strawberry Anthracnose in Bulgeria. Journal of Phytopathology 156: 668‐677. Jelev, Z. J., Bobey, S. G., Minz, D., Mavmon, M., and Freeman, S. 2008. First Report of Anthracnose Fruit Rot Caused by Colletotrichum acutatum on Pepper and Tomato in Bulgeria. Plant Disease 92 (1):172. Jenkins, J. A. 1948. The Origin of the Cultivated Tomato. Economic Botany. 2: 379‐392. Jett, L. W. 2006a. Production of tomatoes within a high tunnel. http://www.hightunnels.org/ForGrowers/WarmSeasonVegetables/warmseasonvegtom
prod.htm Jett, L. W. 2006b. Watering and fertilizing tomatoes in a high tunnel. Horticultural MU Guide. G6462 http://www.hightunnels.org/PDF/jettfertigation.pdf Jones, J. B., and Jones, J. P. 2006. Leaf Mold. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: p. 18. Jones, J. B., Lacy, G.H., Bouzar, H., Stall, R. E., and Schaad, N. W. 2004. Reclassification of the Xanthomonads associated with bacterial spot disease of tomato and pepper. System. Appl. Microbiol. 27: 755‐762. Jones, J. B., Stall, R. E., and Zitter, T. A. 1997. Compendium of Tomato Diseases. APS Press. Minnesota. USA: 73 p. 39 Jones, J. P.,2006. Early Blight. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: pp 13‐14. Kalamaki, M. S., Harpster, M. H., Palys, J. M., Labavitch, J. M., Reid, D, S., and Brummell, D. A. 2003. Simultaneous Transgenic Suppression of LePG and LeExp1 Influences Rheological Properties of Juice and Concentrates from a Processing Tomato Variety. J Agric Food Chem. 51: 7456‐7464. Keller, B., and Lamb, C. J. 1989. Specific expression of a novel cell wall hydroxyproline‐
rich glycoprotein gene in lateral root initiation. Genes Devel. 3:1639‐1646. Kerff, F., Amoroso, A., Herman, R., Sauvage, E., Petrella, S., Filée, P., Charlier, P., Joris, B., Tabuchi, A., Nikolaidis, N., and Cosgrove, D. J. 2008. Crystal structure and activity of Bacillus subtilis YoaJ (EXLX1), a bacterial expansin that promotes root colonization. Proc Natl Acad Sci U S A. 105: 16876‐81. Kettler, J. S. 1997. A pot study in investigating the relationship between tree mulch decomposition and nutrient element availability. Commun. Soil Sci. Plant Anal. 28: 1269‐
1284. Khan, J., Ooka, J. J., Miller, S. A., Madden, L. V., and Hoitink, H. A. J. 2004. Systematioc resistance induced by Trichoderma hamatum 382 in cucumber against Phytophthora crown rot and leaf blight. Plant Dis. 88:280‐286. Kieliszewski, M. J., and Lamport, D. T. A. 1994. Extensin repetitive motifs, functional sites, post‐translational codes, and phylogeny. Plant J. 5:157‐172. Kim, H., Mun, J. H., Byun, B. H., hwang, H. J., Kwon, Y. M., and Kim, S. G. 2002. Molecular cloning and characterization of the gene encoding osmotin protein in Petunia hybrid. Plant Science 162: 745‐752. Koike, S. T., Gladders, P., and Paulus, A. O. 2007.Vegetable Diseases. Manson Publishing Ltd. London. Koiwa, H., Kato, H., Nakatsu, T., Oda, J., Yamada, Y., and Sato, F. 1997. Purification and characterization of tobacco pathogenesis‐related protein PR‐5 d, an antifungal thaumatin‐like protein. Plant Cell Physiol. 38: 783‐791. Koiwa, H., Sato, F., and Yamada, Y. 1994. Characterization of accumulation of tobacco PR‐5 proteins by IEF‐immunoblot analysis. Plant Cell Physiol. 35: 821‐827. Kuc, J. 2001. Concepts and direction of induced systemic resistance in plants and its application. Eur. J. Plant Pathol. 107:7‐12. 40 Kudla, U., Qin, L., Milac, A., Kielak, A., Maissen, C., Overmars, H., Popeijus, H., Roze, E., Petrescu, A., Smant, G., Bakker, J., and Helder, J. 2005. Origin, distribution and 3D‐
modeling of Gr‐EXPB1, an expansin from the potato cyst nematode Globodera rostochiensis. FEBS Lett. 579:2451‐2457. Kwok, O. C. H., Fahy, P. C., Hoitink, H. A. J., and Kuter, G. A. 1987. Interactions between bacteria and Trichoderma hamatum in suppression of rhizoctonia damping‐off in bark compost media. Phytopathology 77: 1206‐1212. Laine, M. J., Haapalainen, M., Wahlroos, T., Kankare, K., Nissinen, R., Kassuwi, S., and Metzler, M. C. 2000. The cellulase encoded by the native plasmid of Clavibacter michiganensis ssp. sepedonicus plays a role in virulence and contains an expansin‐like domain. Physiological and Molecular Plant Pathology 57: 221‐233. LaRosa, P. C., Chen, Z., Nelson, D. E., Singh, N. K., Hasegawa, P. M., and Bresssa, R. A. 1992. Osmotin gene expression is post transcriptionally regulated. Plant Physiol. 100: 409‐415. Lee, Y., Choi, D., and Kende, H. 2001. Expansins: ever‐expanding numbers and functions. Curr. Opin. Plant Biol. 2001 4:527‐32. Li, L. C., and Cosgrove, D. J. 2001. Grass group I pollen allergens (beta‐expansins) lack proteinase activity and do not cause wall loosening via proteolysis. European Journal of Biochemistry 268: 4217‐4226. Li, Z. C., Durachko, and D. M., Cosgrove, D. J. 1993. An oat coleoptile wall protein that induces wall extension in vitro and that is antigenically related to a similar protein from cucumber hypocotyls. Planta 191: 349‐356. Liu, D., Kashchandra, G., Raghothama, G., Paul, M., Hasegawa, M., and Bressan, R.A. 1993. Osmotin overexpression in potato delays development of disease symptoms. Proc. Natl. Acad. Sci. 91: 1888‐1892. Mahesaniya, A., Souza‐Machado, V., Pitblado, R., Khan, A., and Cuppels, D. 2002. Efficacy of acibenzolar‐S‐methyl and paclobutrazol for the control of bacterial speck (Pseudomonas syringae pv tomato) in tomato plug transplants. Can. J. Plant Pathol. 24: 377‐378. McQueen‐Mason, S., and Cosgrove, D. J. 1995. Expansin mode of action on cell walls: Analysis of wall hydrolysis, stress relaxation, and binding. Plant Physiol. 107: 87‐100. McQueen‐Mason, S., Durachko, D. M., and Cosgrove, D. J. 1992. Two endogenous proteins that induce cell wall expansion in plants. Plant Cell 4: 1425‐1433. 41 Melchers, I. S., Sela‐Burlage, M. B., Vloemans, S. A., Woloshuk, C. P., Can Roekel, J. S. C., Pen, J., Van denElzen, P. J. M., and Cornelissen, B. J. C. 1993. Extracellular targeting of the vacuolar tobacco protein, AP24, chitinase and β‐ 1,3 glucanase in transgenic plants. Plant Mol. Biol. 21: 583‐593. Mellilo, J. M., Aber, J. D., and Muratore, J. F. 1982. Nitrogen and lignin control of hardwood leaf litter decomposition dynamics. Ecology 63: 621‐626. Menzies, J. G., and Jarvis, W. R. 1994a. Early blight (target spot), alternaria fruit rot. In Howard, R. J.; Garland, J. A., and Seaman, W. L. 1994. Diseases and Pests of Vegetable Crops in Canada. The Canadian Phytopathological Society and the Entomological Society of Canada: 346 pp. Menzies, J. G., and Jarvis, W. R. 1994b. Gray mold (ghost spot). In Howard, R. J.; Garland, J. A., and Seaman, W. L. 1994. Diseases and Pests of Vegetable Crops in Canada. The Canadian Phytopathological Society and the Entomological Society of Canada: 348‐349 pp. Mercier, J., and Jimenez, J. I. 2004. Control of fungal decay of apples and peaches by the biofumigant fungus Muscodor albus. Postharvest Biol. Technol. 31: 1‐8. Mercier, J., and Manker, D. C. 2005. Biocontrol of soil‐borne diseases and plant growth enhancement in greenhouse soilless mix by the volatile‐producing fungus Muscodor albus. Crop Prot. 24: 355‐365. Mercier, J., and Smilanick, J. L. 2005. Control of green mold and sour rot of stored lemon by biofumigation with Muscodor albus. Biol. Control 32: 401‐407. Merkouropoulos, G., Barnett, D. C., and Shirsat, A. H. 1999. The Arabidopsis extensin gene is developmentally regulated is induced by wounding, methyl jasmonate, abscisic and salicylic acid, and codes for a protein with unusual motifs. Planta 208:212‐219. Miller, S. 2006. Managing diseases of tomatoes in high tunnels. VegNet 13: 5 http://vegnet.osu.edu/news/currentvn05‐06.htm Mugendi, D. N., Nair, P. K. R., Mugwe, J. N., O’Neill, M. K., Swift, M. J., and Woomer, P. L. 1999. Alley cropping of maize with calliandra and leucaena in the sub humid highlands of Kenya: Part 2. Biomass decomposition, N mineralization, and N uptake by maize. Agroforestry Systems 46: 51‐64. Narasimhan, M. L., Damsz, B., Coca, M. A., Ibeas, J. I., Yun, D. J., Pardo, J. M., Hasegawa, P. M., and Bressan, R. A. 2001. A plant defense response effector induces microbial apoptosis. Mol. Cell. 8: 921‐930. 42 Nelson, D. E., Raghothama, K. G., Singh, N. K., Hasegawa, P. M., Bressan, R. A. 1992. Analysis of structure and transcriptional activation of an osmotin gene. Plant Mol Biol. 19: 577‐588. Nelson, E. B., and Craft, C. M. 1992. Suppression of dollar spot on creeping bentgrass and annual bluegrass turf with compost amended topdressings. Plant Dis. 76: 954. Nelson, E. B., Kuter, G. A., and Hoitink, H. A. J. 1983. Effects of fungal antagonists and compost age on suppression of rhizoctonia damping‐off in container media amended with composted hardwood bark. Phytopathology 73: 1457‐1462. Newton, S. S. and Duman, J.G. 2000. An osmotin‐like cryoprotective protein from the bittersweet nightshade Solanum dulcamara. Plant Mol. Biol. 44: 581‐589. NOSB. 2004. Compost tea task force report. April 6, 2004. http://www.ams.usda.gov/AMSv1.0/getfile?dDocName=STELPRDC5070290 Obenland, D. M., Crisosto, C. H., and Rose, J. K. C. 2003. Expansin protein levels decline with the development of mealiness in peaches. Postharvest Biology and Technology 29:11‐18. Ohio Vegetable Production Guide. 2008. Green House Tomatoes. The Ohio State University, Extension bulletin 672‐08. Ohio Vegetable Production Guide. 2008. Tomatoes: Fresh market and Processing. The Ohio State University, Extension bulletin 672‐08. O'Malley, R. C., and Lynn, D. G. 2000. Expansin message regulation in parasitic angiosperms: Marking time in development. Plant Cell 12: 1455‐1466. Paulus, A. O.,2006. Alternaria Stem Canker (Black Mold). In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: 9pp. Peet, M. 1995. Sustainable Practices for Vegetable Production in the South. Focus Publishing . Newburyport, MA Pieterse, C. M. J., Van Pelt, J. A., Ton, J., Parchmann, S., Muller, M. J., Buchala, A. J., Metraux, J. P., and Van Loon, L. C. 2000. Rhizobacteria mediated induced systemic resistance (ISR) in Arabidopsis requires sensitivity to jasmonate and ethylene but is not accompanied by an increase in their production. Physiol. Mol. Plant pathol. 57:123‐134. 43 Pieterse, C. M. J., Van Wees, S. C. M., Hoffland, E., Van Pelt, J. A., and Van Loon, L. C. 1996. Systemic resistance in Arabidopsis and pathogenesis‐related gene expression. Plant Cell 8:1225‐1237. Pieterse, C. M. J., Van Wees, S. C. M., Van Pelt, J. A., Knoester, M., Laan, R., Gerrits, H., Weisbeek, P. J., and Van Loon, L. C. 1998. A novel signaling pathway controlling induced systemic resistance in Arabidopsis. Plant Cell 10:1571‐1580. Precheur, R. 2005. Ohio Vegetable Production Guide, Bulletin 672‐04 http://ohioline.osu.edu/b672/ Pressey, R. 1997. Two isoforms of NP24, a thaumatin‐like protein in tomato fruit. Phytochemistry 44:1241‐1245. Qin, L., Kudla, U., Roze, E. H., Goverse, A., Popeijus, H., Nieuwland, J., Overmars, H., Jones, J. T., Schots, A., Smant, G., Bakker, J., Helder, J. 2004. Plant degradation: A nematode expansin acting on plants. Nature 427: 30. Rehner, S. A., and Samuels, G. J. 1994. Taxonomy and phylogeny of Gliocladium analyzed by large subunit ribosomal DNA sequences. Mycol. Res. 98:625‐634. Roberts, W. K. and Selitrennikoff, C. P. 1990. Zeamatin, an antifungal protein from maize with membrane‐permeabilizing activity. J. General Microbiol. 136: 1771‐1778. Rodrigo, I., Vera, P., Tornero, P., Hernandez‐Yago, J., and Conejero, V. 1993. cDNA cloning of viroid‐induced tomato pathogenesis‐related protein P23. Plant Physiol. 102: 939‐945. Romantschuck, M. 1992. Attachment of plant pathogenic bacteria to plant surfaces. Ann. Rev. Phytopathol. 30: 225‐243. Rose, J. K. C., Lee, H. H., and Bennett, A. B. 1997. Expression of a divergent expansin gene is fruit‐specific and ripening‐regulated. Proc. Natl. Acad. Sci. USA 94: 5955‐5960. Ryu, C. M., Murphy, J. F., Mysore, K. S. and Kloepper, J. W. 2004. Plant growth promoting Rhizobactoria systemically protect Arabidopsis thaliana against cucumber mosaic virus by a salicylic acid and NPR1‐independent and jasmonic acid dependent signaling pathway. The Plant Journal 39:381‐392. Sabine, J. 1819. On the love apple or tomato. Royal Hort. Soc. Trans. 3: 342‐354. Saloheimo, M., Paloheimo, M., Hakola, S., Pere, J., Swanson, B., Nyyssonen, E., Bhatia, A., Ward, M., and Penttila, M. 2002. Swollenin, a Trichoderma reesei protein with 44 sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials. European Journal of Biochemistry 269:4202‐4211. Salzman, R. A., Tikhonova, I., Bordelon, B. P., Hasegawa, P. M., and Bressan, R. A. 1998. Coordinate accumulation of antifungal proteins and hexoses constitutes a developmentally controlled defense response during fruit ripening in grape. Plant Physiol. 117: 465–472. Sampedro, J., and Cosgrove, D. J. 2005. The expansin superfamily. Genome Biol. 6:242. Sato, F., Kitajima, S., Koyama, T., Yamada, Y. 1996. Ethylene induced gene expression of osmotin like protein, a neutral isoform of tobacco PR‐5, is mediated by the AGCCGCC cis‐sequence. Plan Cell Physiol. 37:249‐255. Scheuerell, S. J., Sullivan, D. M., and Walter, F. M. 2005. Suppression of seedling damping off caused by Pythium ultimum, P. irregulare, and Rhizoctonia solani in container media amended with a diverse range of Pacific Northwest compost sources. Phytopathology 95: 306‐315. Schnabel, G., and Mercier, J. 2006. Use of a Muscodor albus pad delivery system for the management of brown rot of peach in shipping cartons. Postharvest Biol. Technol. 42: 121‐123. Schneider, T. D., and Stephens, R. M. 1990. Sequence logos: a new way to display consensus sequences. Nucl. Acids Res. 18: 6097‐6100. Shoresh, M., Yedida, I., and Chet, I. 2005. Involvement of jasmonic acid/ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T‐203. Phytopathology 95:76‐84. Showalter, A. M. 1993. Structure and function of plant cell wall proteins. Plant Cell 5:9‐
23. Siciliano, V., Genre, A., Balestrini, R., Cappellazzo, G., deWit, P. J., and Bonfante, P. 2007. Transcriptome analysis of arbuscular mycorrhizal roots during development of the prepenetration apparatus. Plant Physiol. 144:1455‐66. Singh, N. K., Bracker, C. A., Hasegawa, P. M., Handa, A. K., Buckel, S., Hermodson, M. A., Pfankoch, E., and Bressan, R. A. 1987. Characterization of osmotin. Plant Physiol. 85: 529‐536. Singh, N. K., Handa, A. K., Hasegawa, P. M., and Bressan, R. A. 1985. Protein associated with adaptation of cultured tobacco cells to NaCl. Plant Physiol. 79: 126‐137. 45 Singh, N. K., Nelson, D. E., Rosa, P. C., Bracker, C. E., Handa, A. K., Hasegawa, P. M., and Breaasn, R. A. 1989. Osmotin: A protein associated with osmotic stress adaptation in plant cells. Environmental stress in plants. Cherry, J.A., Ed. Heidglberg: Springer‐Verlag, pp. 67‐68. Smith, D. C., Beharee, V., and Jughes, J. C. 2001. The effect of compost produced by a simple procedure on the yields of swiss chard (Beta vulgaris L. var. flavescens) and common bean (Phaseolus vulgaris L. var. nanus). Scientia Horticulturae 91: 393‐406. Stall, R. E. 2006. Gray Mold. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: pp 16‐17. Stevenson, W. R., and Pohronezny, K. L. 2006. Anthracnose. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: pp 9‐10. Sticcher, L., Mauch‐Mani, B., and Metraux, J. P. 1997. Systemic acquired resistance. Annu. Rev. Phytopathol. 35:235‐270. Stinson, A. M., Zidack, N. K., Strobel, G. A., and Jacobsen, B. J. 2003 Mycofumigation with Muscodor albus and Muscodor roseus for control of seedling diseases of sugar beet and Verticillium wilt of eggplant. Plant Dis. 87: 1349‐1354. Strobel, G. 2006. Muscodor albus and its biological promise. J Ind Microbiol Biotechnol. 33: 514‐522. Strobel, G. A., Dirksie, E., Sears, J., and Markworth, C. 2001. Volatile antimicrobials from a novel endophytic fungus. Microbiology 147: 1943‐2950. Strobel, G.A., and Ezra, D. 2008. Application of Muscodor albus to control harmful microbes in human and animal wastes. United States Montana State University (Bozeman, MT, US) 7341862 http://www.freepatentsonline.com/7341862.html Tire, C., De Rycke, R., De Loose, M., Inze, D., Van Montagu, M., and Engler, G. 1994. Extensin gene expression is induced by mechanical stimuli leading to local cell wall strengthening in Nicotiana plumbaginifolia. Planta 195:175‐181. Trivedi, P. K., and Nath, P. 2004. MaEXP1, an ethylene‐induced expansin from ripening banana fruit. Plant Science 167: 1351‐1358. USDA, 2008. United States Department of Agriculture, National Agriculture Statistics. http://www.nass.usda.gov/QuickStats/PullData_US.jsp 46 Van Loon, L. C. and Van Kammen, A. 1970. Polyacrylamide disc electrophoresis of the soluble leaf proteins from Nicotiana tabacum var. “Samsun” and “Samsun NN” II. Changes in protein constitution after infection with tobacco mosaic virus. Virology 40: 199‐211. Van Loon, L. C. and Van Strien, E. A. 1999. The families of pathogenesis‐related proteins, their activities and comparative analysis of PR‐1 type proteins. Molecular Plant‐Microbe Interaction 4: 315‐323. Van Loon, L. C., Pierpoint, W. S., Boller, T., and Conejero, V. 1994. Recommendation for naming plant pathogenesis‐ related proteins. Plant Mol. Biol. Reporter 12, 245‐264. Vu, L. and Huynh, Q. K. (1994) Isolation and characterization of a 27 kDa antifungal protein from the fruits of Diospyros texana. Biochem. Biophys. Res. Communications. 202: 666‐672. Weindling, R. 1941. Experimental consideration of model toxin of Gliocladium and Trichoderma. Phytopathology 31:991‐1003. Wieczorek, K., Golecki, B., Gerdes, L., Heinen, P., Szakasits, D., Durachko, D. M., Cosgrove, D. J., Kreil, D. P., Puzio, P. S., Bohlmann, H., and Grundler, F. M. 2006. Expansins are involved in the formation of nematode‐induced syncytia in roots of Arabidopsis thaliana. Plant J. 48: 98‐112. Willis, J. L. 1924. A Flora of Economic Plants of California. Associated Student Store, Berkeley, California. Woo, S. L., Donzelli, B., Scala, F., Mach, R., Harman, G. E., Kubicek, C. P., Del Sorbo, G., and Lorito, M. 1999. Disruption of the ech 42 (endochitinase‐encoding) gene affects biocontrol activity in Trichoderma harzianum P1. Mol. Plant‐Microbe Interact. 12:419‐
429. Woo, S. L., Scala, F., Ruocco, M., and Lorito, M. 2006. The molecular biology of the interactions between Trichoderma spp., pathogenic fungi, and plants. Phytopathology 96:181‐185. Woropong, J., Strobel, G. A., Ford, F. J., Li, J. Y., Baird, G., and Hess, W. M. 2001. Muscodor albus anam. novel endophyte from Cinnamomum zeylanicum. Mycotaxon 79: 67‐79. Ye, X. Y., Wang, H. X., and Ng, T. B. 1999. First chromatographic isolation of an antifungal thaumatin‐like protein from French bean legumes and demonstration of its antifungal activity. Biochem. Biophys. Communications 263: 130‐134. 47 Yedida, I., Benhamou, N., Kapulenik, Y., and Chet, I. 2000. Induction and accumulation of PR proteins activity during early stages of root colonization by the mycoparasite Trichoderma harzianum strain T‐203. Plant Physiol. Biochem. 38:863‐873. Yedidia, I., Shoresh, M., Kerem, Z., Benhamon, N., Kapulnik, Y., and Chet, I. 2003. Concomitant induction of systemic resistance to Pseudomonas syringae Pv. Lachrymans in cucumber by Trichoderma asperelleum (T‐203) and accumulation of phytoalexins. Appl. Environ. Microbiol. 69:7343‐7353. Yi, L., Jones, L., and McQueen‐Mason, S. 2003. Expansins and cell growth. Current Opinion in Plant Biology 6: 603‐610. Yoo, S. D., Gao, Z. F., Cantini, C., Loescher,W. H., and van Nocker, S. 2003 Fruit ripening in sour cherry: Changes in expression of genes encoding expansins and other cell‐wall‐
modifying enzymes. Journal of the American Society for Horticultural Science 128: 16‐
22. Yuan, S., Wu, Y., and Cosgrove, D. J. 2001. A fungal endoglucanase with plant cell wall extension activity. Plant Physiol. 127: 324‐333. Zhu, B., Chen, T. H. H., Li, P. H. 1995. Activation of two osmotin like proteins in transgenic potato plants. Plant Physiol. 108: 929‐937. Zitter, T. A. 2007. In high tunnels, diseases are what you make them. Cornell University, Vegetable MD online . http://vegetableonline.ppath.cornell.edu/NewsArticles/HighTunn.htm 48 CHAPTER 2 USE OF BIORATIONAL PRODUCTS FOR THE CONTROL OF DISEASES IN HIGH TUNNEL TOMATOES 2.1 Introduction: Ohio is one of the leading producers of tomatoes in the United States with 2,387 hectares of processing tomatoes and 1,982 hectares of fresh market tomatoes (USDA, 2008). Disease is a limiting factor in the tomato production, of which approximately 200 biotic diseases have been reported in the United States (Jones et al. 2006). Yearly occurrence of these diseases results in significant economic loss due to reduction of plant growth and fruit yield. Besides, diseases also reduce aesthetic value of fresh market tomatoes and make mechanical peeling of processing tomatoes difficult. The most important diseases of field grown tomatoes in Ohio are early blight caused by Alternaria solani, Septoria leaf spot caused by Septoria lycopersici, and anthracnose caused by Colletotrichum gloeosporioides and C. coccodes. Control of these diseases is achieved by crop rotation, balanced nutrition, removal of infected leaves, 53 and eradication of weed or volunteer plants and the use of fungicides. Amistar 80WG, Bravo Weather Stik, Dithane M45, Tanos 50Df, Kocide 2000, Manzate 75DF, and Cabrio 20WG are commonly used fungicides against tomato diseases (Lewis Ivey et al. 2005; Jones, 2006; Menzies and Jarvis, 1994a; Menzies and Jarvis, 1994b; Lewis Ivey et al. 2005; Pitblado and Howard, 1994; Stevenson, 2006). Constant and regular use of fungicides may cause some tomato pathogens to develop resistance to some fungicides (Day et al. 2004; Grech, 1990; Yun, et al. 1999). For example, Phytophthora infestans isolates have developed resistance against metalaxyl (Day et al. 2004; Yun et al. 2004). Similarly, many isolates of Xanthomonas vesicatoria have developed a detoxification gene in their plasmids against copper bactericides (Canteros et al. 1995; Voloudakis et al. 2005). These plasmids are very diverse and transfer quickly among populations (Canteros et al. 1995). To reduce the utilization of hazardous chemicals into the environment and to decrease the rate of resistance development among pathogens, currently, several biological and biorational control options are being studied and some are being used (Song et al., 2008; Graves et al. 2000). Several species of the fungus Trichoderma have been used in the biological control of plant diseases. T. hamatum , T. harzianum, T. virens, and T. asperellum are the most studied species of Trichoderma (Esposito and de 53 Silva, 1998; Horst et al. 2005; De Meyer et al. 1998; Gentile et al. 2007; Djonovic et al. 2007; Yeddia et al. 2003). In many cases these fungi were as effective as fungicides in controlling plant diseases. For example, T. hamatum 382 and metalaxyl were equally effective against Phytophthora capsici in cucumber (Khan et al. 2004). Similarly, T. hamatum 382 provided a very high level of protection against powdery mildew and Botrytis blight of begonia (Horst et al. 2005), Phytophthora crown rot and leaf blight of cucumber (Khan et al. 2004), damping‐off of radish (Chung et al. 1990), and bacterial leaf spot of tomato, in greenhouse systems(Alfano et al. 2007). Muscodor albus is a recently discovered endophytic fungus (Strobel et al. 2001, Strobel and Ezra 2008) which produces highly active volatile compounds (VOCs) that have in‐vitro antibiotic effect against many plant pathogenic fungi and bacteria. They are also lethal to many human pathogens such as E. coli, Vibrio cholerea, Candida albicans and Aspergillus fumigatus (Strobel , 2006; Strobel and Ezra 2008). Due to the capacity of production of lethal VOCs, M. albus has been used as mycofumigation agent to control soil borne diseases caused by Rhizoctonia solani, Pythium ultimum, Pythium aphanidermatum, Aphanomyces cochlioides and Verticillium species (Stinson et al. 2003; Baysal et al. 2007; Gurel and Miller, 2008). Fungicides are a very important component of tomato production. Most all farmers use fungicide for processing tomato production in the north central production region (Precheur et al. 1992). Copper fungicides are widely used for the control of fungal and bacterial diseases. Copper is an essential element for growth and development of 53 prokaryotic cells and is also a cofactor of several enzymes (Voloudakis et al. 2005). When applied in excess it is toxic to cells. It forms free radicals which can irreversibly damage the DNA and lipid membrane (Canteros et al., 1995; Voloudakis et al. 2005). Hydrogen peroxide (hydrogen dioxide) is a well known disinfectant, which is now also approved for controlling fungal and bacterial diseases of indoor and outdoor crops. It can be used for fruits, nuts and vegetable diseases before and after harvest. It is generally diluted to 1% or less before use. Hydrogen peroxide disassociates rapidly into oxygen and water and does not cause adverse effects on humans or the environment, however, concentrated and un‐disassociated hydrogen peroxide is extremely corrosive and irritating to skin, eyes and mucous membrane (EPA, 2002). Compost is decomposed organic matter that improves soil quality in several ways. Besides supplying essential nutrients such as nitrogen, phosphorous, potassium, calcium, sulfur and micronutrients to plants, it also lowers the bulk density and increases the permeability and porosity of soil. Compost also adds beneficial microorganisms to soil (Kettler, 1997; Mellilo et al., 1982; CIWMB, 2006). Disease suppression is another benefit of compost. Several studies have shown that plants grown in compost amended soil have reduced severity of foliar, fruit and root diseases. Diseases such as Powdery mildew on small grains and anthracnose of cucumber (reviewed in Hoitink et al., 2001), anthracnose fruit rot in organic tomato and bacterial spots on fruits in conventional tomato production (Abbasi et al., 2001), and rots and 54 damping off caused by Rhizoctonia, Sclerotinia and Pythium (Hadar and Gorodecki, 1991; Chen et al.,1988) were significantly reduced by compost amendment. High tunnels are plastic covered structures that allow extension of the tomato growing season. Drip irrigation and plastic mulch systems are generally employed in high tunnels (Miller, 2006). Water deficiency during vegetative, flowering and fruiting stages results in 25, 52, and 43 percent yield reduction, respectively. Drip irrigation supplies water directly where it is needed and helps to reduce crop yield due to water deficiency (Rutledge et al. 1999). Plastic mulch controls weeds and reduces certain diseases, conserves moistures and increases the quality and quantity of yield (Rutledge et al. 1999). High tunnels also provide shade during summer, protect plants from wind and rain, and decrease incidence of pests and diseases (Hightunnels.org, 2007). Increased temperature in high tunnels allows Ohio farmers to plant and harvest tomatoes earlier in the season and harvest until late fall compared to open field production (Miller, 2006). Being a covered structure, high tunnels have higher moisture and temperature levels than open fields. Diseases such as timber rot (Sclerotinia sclerotiorum), Botrytis blight (Botrytis cinerea) and leaf mold (Fulvia fulva), which are not major problems in field grown tomatoes, can be very destructive in high tunnels (Miller, 2006). Hence the objective of this study was to evaluate different biological and bio‐rational products for the control of tomato diseases in high tunnels. It was hypothesized that T. hamatum 382, which suppresses diseases in the greenhouse, and M. albus, which reduces root 55 diseases in open fields, should also work under high tunnel conditions. Hydrogen peroxide, commonly used as disinfectant, also protects aerial parts of tomato from bacterial and fungal pathogens. We also hypothesized that copper fungicide/bactericide is effective against pathogens of tomato in high tunnels. Finally, we hypothesized that compost alone or in combination with other treatments (mentioned above) reduces disease severity and increases plant growth. 56 2.2 MATERIALS AND METHODS 2.2.1 Experimental Design This study was conducted during 2007 (experiment I) and 2008 (experiment II) at the Ohio Agriculture Research and Development Center (OARDC), Snyder Farm, Wooster, Ohio on Wooster silt loam soil. Experiments were carried out in a 120 ft x 30 ft high tunnel aligned north to south with rolling side walls on the east and west. The experiment was designed as a completely randomized split plot design with four replications (blocks) and six treatments (including an non‐treated control). Each block was split into two 12 ft x 30 ft plots, one amended with composted dairy manure (N‐P‐K, 4‐5‐15) and the other without. The compost was applied at the rate of 16.3 tons dry weight per acre (65.2 T wet wt./A or, 493 kg wet wt./plot). Raised beds, about 25 cm high, were prepared and single drip irrigation tape (Chapin Watermatics Inc., Watertown, NY) with drippers facing up were fitted 2 cm below the soil level. Flow rate of the tape was 1.9 L per minute per 30.5 m of the tape at 12 PSI. Drippers were spaced 30 cm apart. Plants were irrigated every other day for one hour. Raised beds were covered with black plastic mulch and the aisles between the beds were covered with landscape cloth. Each plot in a block had six rows, one for each treatment, and the rows were 4 ft (1.2 m) apart. Each row consisted of 8 plants spaced 1.5 ft (0.45 m) apart. Different treatments applied on compost amended or non amended plots were Trichoderma hamatum 382, Muscodor albus (QRD 300), Trichoderma hamatum 382 plus 57 Muscodor albus (QRD 300), copper fungicide Kocide 3000 (Kocide 2000 in the first experiment )(DuPont, Wilmington, Delaware), OxiDate (Hydrogen peroxide from by BioSafe Systems, Hartford, Connecticut) (Fig. 2.1) and non‐treated control (without any treatment). T. hamatum 382 was applied to seedling mix (2X105 conidia/gm dry wt.) 7 days before seeding. A barley seed formulation of Muscodor albus (QDR 300) was broadcasted and incorporated into beds 10 days before transplantation at the rate of 3.5 kg/15 m row, 40 cm wide, and 10 cm deep. Beds were covered with plastic mulch and irrigated for an hour immediately after the application of Muscodor. Kocide 3000 was applied at the rate of 580 g/A (Kocide 2000 at the rate of 900 g/A) and OxiDate was diluted 100 times with water and applied as foliar spray on 7‐10 day schedule using CO2 –pressurized backpack sprayer, calibrated to deliver 350 L/acre at 40 psi, until the foliage was wet. There were a total of nine applications starting from July 9, 2007 to October 26, 2007 in the first experiment and seven applications starting from August 1, 2008 to September 12, 2008 in the second experiment. Tomatoes were staked one month after transplanting using 1.5 m long, 2.5x2.5 cm wooden stakes. Eight stakes were inserted in each row, one for each plant. All eight stakes in a row were connected with three layers of twine. The twines were 25 cm apart from each other and the lower one was 1 foot above the ground level. Plants were tied with stakes and twines at different heights. All suckers and leaves below the first flower cluster were removed during the second experiment. Plants were fertilized with fish oil fertilizer LC‐12 (Neptune’s Harvest Fertilizer, Gloucester, MA) at the rate of 30 ml / 378 L 58 water through drip tape at six weeks schedule. Biological insecticides Diatect V (Diatect International Inc., Herber City, UT) at the rate of 3lb/A, and M‐trak bioinsecticide (Ecogen inc., Langhorne, PA) at the rate of 3 qt/A, were applied to control insects during the first experiment. DiPel PRO DF (Valent Bio Science Corporation, Libertyville, IL) was applied at the rate of 680 g/378 L during the second experiment. Insecticides were applied on a 7‐10 day schedule immediately after insect‐damaged fruits were noticed. 59 Figure 2.1. High tunnel. Compost amended and non‐amended plots(A). Rolling side wall of the high tunnel . Temperature and moisture of the high tunnel was regulated by rolling side walls up and down early in the morning and late evening respectively (B). Rows with different treatments. Plants in each row were supported with wooden stakes (C). 60 2.2.2 Preparation of Seedlings Tomato seeds cv. Mount Spring (Siegers Seed Co. Holland, MI) in the first experiment and cv . Florida 47 ( Siegers Seed Co. Holland, MI) in the second experiments were sown in 50 cell plug trays containing T. hamatum 382 amended or non‐amended planting mix. Planting mix was prepared according to Horst et al. (2005) with slight modifications: 14 L of Sunterra Peat Moss (Conrad Fafard, Inc., Agawam, MA) was mixed with 6 L coarse horticultural grade perlite (Ball Seed Co, West Chicago, IL). The mix was then amended with 18 g of potassium nitrate, 18 g of gypsum, and 18 g of super phosphate as starter fertilizer and 86 g of dolomitic lime and 56 g of calcium carbonate (‹0.15mm) to raise the pH to 5.5 to 6.0. The mixture was rotated in a cement mixer for 10 minutes with frequent sprays of water. The optimum moisture level of the mix was determined manually (mix remained together when compressed). 2.2.3 T. hamatum 382 inoculum preparation Inoculum of T. hamatum 382 was prepared according to Khan et al. (2004). Seven‐day‐old colonies of T. hamatum 382 grown on Trichoderma selective medium (Chung and Hoitink, 1990) was transferred onto DifcoTM Potato Dextrose Agar (PDA, Becton, Dickinson and Company, Sparks, MD) plates and incubated for 14 days under continuous light at room temperature. The plate culture was diced into a 250 ml conical flask containing 100 ml of sterilized distilled water. A drop of Tergitol NP10 (J. T. Baker 61 Chemical Co., Phillipsburg, NJ) was added to the flask and the suspension was shaken to dislodge conidia. This suspension was filtered through a double layer of cheese cloth. The concentration of conidia in the suspension was determined by using a hemacytometer (Hausser Scientific, Horsham, PA). The suspension was diluted 100 times to facilitate the conidia count. Conidia count was done according to Tuite (1969). As the conidia of Trichoderma are relatively small, the center square mm of the hemacytometer containing 25 groups of 16 small squares was used. Conidia were counted from four corner groups and the center one. The total count was multiplied by 50,000 and then by 100 (dilution factor) to calculate the number of conidia present in one ml of undiluted suspension. The spore suspension was blended into planting mix to obtain an initial inoculum density of 2x105 CFU/g of dry weight of mix. The planting mix was placed in a cement mixer and the Trichoderma spore suspension was sprayed onto the mix. The mix was rotated for about 10 minutes. Tomato seeds were hot water treated before seeding. Seeds were first pre soaked at 1000F for 10 minutes followed by 1220F for 25 minutes (Miller and Ivey, 2006). Seeded flats were maintained in greenhouse under natural light at 22‐ 240C. Seedlings were “hardened off” by gradually exposing them to the outdoor environment for 10 days before transplantation. Six‐ week‐old seedlings were manually transplanted into the high tunnel. 62 2.2.4 Preparation of Muscodor albus inoculum A barley seed‐based formulation of M. albus was prepared. M. albus growing on a PDA plate was used to make inoculum. Fifteen 5 mm diameter agar plugs were transferred into a 2‐liter conical flask containing one liter autoclaved potato dextrose broth (PDB). The flask was placed on a gyrotory water bath shaker (New Brunswick Scientific Co. INC.) for two weeks at 230C with constant shaking at 150 rpm. Three hundred gram barley seeds were placed in a 1 L conical flask along with 160 ml water and autoclaved for an hour. An additional 1 hr of autoclaving was done the next day. Sixty ml PDB shaken with Muscodor was added into the flask containing sterile barley seeds. The contents of the flask were mixed well and incubated at 230C for 3 weeks. After the seeds were colonized, they were dried in a hood (Pure Aire, Van Nuys, CA) for 48 hrs. Seeds were stored in a plastic bag at 40C until use. 2.2.5 Data collection and Statistical Analysis The severity of foliar diseases such as early blight (Alternaria spp.), Septoria leaf spot (S. lycopersici) and Fulvia leaf mold (F. fulvum) were assessed using a scale of 0‐100 percentage foliage affected. Botrytis gray mold incidence on inflorescences was evaluated by counting the number of infected flowers and expressed as percentage infected inflorescences. Disease severity evaluations of Botrytis gray mold (B. cinerea), early blight, Septoria leaf spot and Fulvia leaf mold were made on August 21, August 29, September 5, and October 3 respectively during the first experiment. During the second 63 experiment, Botrytis gray mold and Fulvia leaf mold were evaluated on a weekly basis beginning August 29 and ending September 18. There was no incidence of early blight or Septoria leaf spot in the second experiment. The area under the disease progress curve (AUDPC) was calculated according to the formula: Σ ([(xi+ xi‐1)/2] (t i‐ t i‐1)), where xi is the rating at each evaluation time and (t i‐ t i‐1) is the time between evaluations. Figure 2.2. Preparation of Muscodor albus inoculum. (A) Muscodor colony on PDA, (B) Flask containing Potato Dextrose Broth (PDB) and Muscodor plugs being shaken on a shaker, (C) Barley seed‐based formulation of Muscodor alba and (D) Beds incorporated with Muscodor and covered with plastic mulch. 64 Severity of tomato fruit diseases were assessed by harvesting all ripe fruits from all plants of each treatment row. Fruits were harvest on 10, 19, and 27 September and 10 October in Experiment I (2007); on 4, 11, 18 and 25 August and 3, 11 and 17 September in Experiment II (2008). Fruits were harvested manually into bulk bins containing labeled sticks and were classified in seven categories: marketable, anthracnose rot, botrytis rot (or ghost spots), “other” rots (fungal and oomycetes fruit rots), blossom end rot, insect damaged fruits and and healthy culls. Weights of fruits in each category were taken. Population of T. hamatum 382 in seedling mix, roots and soil was determined by dilution plating (as described in Chapter 3). The first and the second counts were done from seedling mix before seeding and transplantation. The third and the fourth counts were done from rhizosphere soil and roots 1 and 2 months after transplanting. Third count was done from the second and sixth plant and fourth count from third and seventh plant of each row. Soil and roots were collected 5 and 10 cm from the stem of each plant using soil augers in the first experiment. The plants were uprooted and rhizosphere soil and roots were used during the second experiment. Roots were chopped into small pieces and 1 gm was diluted into 9 ml of dilution buffer, vortexed and subjected to 10‐fold serial dilutions. Plants uprooted for T. hamatum 382 count in the second experiment were also used to evaluate root diseases. Roots were cleaned with tap water, excess water was removed by blotting with paper towels and air dried in a laminar flow hood. The area 65 covered by lesions (%) was evaluated visually. To find the percentage roots colonized by pathogenic fungi/oomycetes, lateral roots were randomly selected from each plant and excised into small (approximately 3 mm) pieces. Twenty pieces (10 per plate) of excised roots were plated onto PBNIC, PDA and acid PDA (39 gm PDA, 0.75 ml 85% lactic acid/L) media. Plates were incubated at room temperature and the numbers of roots colonized by different pathogenic fungi/oomycetes were counted 4 days later. The height of 3rd, 4th, and 5th plant of each row was measured from the soil level one month after transplanting in the first experiment and two months after transplanting in the second experiment. The general linear model (GLM) was used to perform Analysis of Variance (ANOVA) using SAS statistical software (SAS Institute, Cary, NC). Means were separated suing Fisher’s protected least significant difference test. 2.2.6 Weather Data: Experiment I: Average maximum temperatures for 28‐30 June, July, August, September, October, and 1‐2 November were 92.5, 97.4, 98.8, 94.2, 92.1, and 90.2 oF; average minimum temperature were 58.7, 58.3, 63.4, 53.6, 49.5, and 33.7 oF, respectively. Experiment II: Average maximum temperatures for 9‐31 May, June, July, August and 1‐18 September were 87.6, 79.1, 79.2, 80.0 and 78.9 oF; and average minimum temperatures were 52.2, 59.7, 60.8, 56.5, and 54.4 oF, respectively. 66 Figure 2.3. Fruit diseases. (A) Anthracnose, (B) Botrytis fruit rot, (C) Botrytis ghost spot on green fruit, (D) Blossom end rot (BER), (E) Other rots, (F) Insect‐damaged fruit. 67 Figure 2.4. Foliar diseases. (A) Fulvia leaf mold, (B) Botrytis gray mold (infected flower), (C) Early blight, (D) Septoria leaf spot. 68 2.3 RESULTS 2.3.1 Experiment I: Disease pressure was very low under high tunnel conditions early in the season. Severity of Fulvia leaf mold and Botrytis gray mold was increased towards the end of the season, probably due to high humidity and low temperature. The severity of Fulvia leaf mold was significantly reduced by all the treatments applied compared with the non‐
treated control (AUDPC, 454.8; foliage affected in the final evaluation, 16.6%) (Table 2.1). Kocide 2000 (AUDPC, 197.8) was the most effective, followed by OxiDate (AUDPC, 244.7). There was no significant reduction of Botrytis gray mold in treated plots compared to the non‐treated control plots (AUDPC, 884.6; percentage gray mold in the final evaluation, 16.9). However, there was numerical reduction of the disease by all the treatments other than Kocide 2000. The severity of early blight and Septoria leaf spot was very low and there were no significant differences among treatments and the non‐
treated control. Production of healthy and marketable fruits was not increased by any of the treatments compared with non‐treated control (Table 2.2). Plants treated with Kocide 2000 had a significantly lower proportion of marketable fruits (59.4%) than non‐treated plants (66.1%). The incidence of Botrytis (≤0.3 %) and anthracnose (≤1.9 %) fruit rots were low. Minor rots caused by other fungi/oomycetes (≤19.9 %) were relatively higher than the rots caused by Botrytis and anthracnose. There was no significant difference in 69 the severity of Botrytis, anthracnose and minor fruit rots among treated and non‐
treated control plants. Plant height was not affected by any of the treatments applied. The severity of Fulvia leaf mold in compost amended plots was lower (AUDPC, 257.2) compared to those grown in compost non‐amended plots (AUDPC, 353.5) (Table 2.3). Similarly, the compost amendment has reduced the incidence of ‘other’ rots (13.7% in compost amended plots versus 19.0% in non‐amended plots). Compost amendment increased the yield of marketable fruits (66.9% compost‐amended plots versus 63.4% non‐amended plots), severity of Botrytis gray mold (AUDPC, 916.9 compost‐amended plots versus AUDPC, 684.6 non‐amended plots), and plant height (46.73 cm compost‐amended plots versus 44.09 cm non‐amended plots). However, there was no effect of compost amendment on the incidenc of Botrytis fruit rot, anthracnose fruit rot, early blight and Septoria leaf spot. There was a significant interaction for compost and treatments for Botrytis gray mold (P=0.0001) and plant height (P=0.024). 70 Treatments AUDPC Fulvia leaf mold AUDPC AUDPC AUDPC Botrytis gray Septoria leaf Early blight
mold spot Plant height (cm) Non‐treated control 454.8 a 884.6 a 135.4 a 129.9 a 44.6 a Muscodor 309.8 bc 747.6 a
135.4 a
94.5 a 45.3 a
Trichoderma 284.7 cd 648.5 a
135.5 a
126.1 a 44.2 a
Muscodor + Trichoderma 340.2 b 838.0 a 148.1 a 126.7 a 45.0 a Kocide 3000 197.8 e 919.9 a
133.4 a
145.8 a 46.3 a
OxiDate 244.7 d 766.2 a
154.6 a
113.9 a 45.1 a
Mean 305.33 800.8
140.4
122.8 45.08
P‐Value P=0.0001 P=0.15
P= 0.91
P =0.41 P=0.15
F‐Value F=34.00 F=1.90 F=0.21 F=1.07 F=2.36 Table 2.1. Effect of treatments on foliar diseases and plant height in Experiment I. Disease rating and area under the disease progress curve (AUDPC) are based on the values of the scale of 0‐100 percentage foliage affected. AUDPC was calculated according to the formula: Σ ([(xi+ xi‐1)/2] (t i‐ t i‐1)), where xi is the rating at each evaluation time and (t i‐ t i‐1) is the time between evaluations. Heights of the 3rd, 4th and 5th plants within each plot were measured 1 month after transplanting. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. 71 % % Healthy fruit Marketable fruit Non‐treated control 68.1 ab Muscodor Treatments % Anthracnose
% % fruit rot Botrytis fruit rot Other Rots 66.1 a 1.4 a 0.2 a 15.5 a 68.1 ab 66.5 a 1.4 a 0.3 a 16.6 a Trichoderma 67.3 ab 65.1 ab 0.9 a 0.2 a 15.3 a Muscodor + Trichoderma 71.4 a 69.5 a 1.1 a 0.2 a 15.5 a Kocide 3000 61.9 b 59.4 b 1.4 a 0.2 a 19.9 a OxiDate 67.1 ab 64.4 ab 1.9 a 0.2 a 15.1 a Mean 67.3 65.1 1.35 0.21 16.3 P=0.11 P=0.08 P=0.16 P=0.91 P=0.54 F=2.17 F=2.46 F=1.83 F=0.28 F=0.84 P‐Value Table 2.2. Effect of treatments on fruit health in Experiment I. Fruits were harvested into bulk bins and were classified in different categories and weighed. There was no bacterial disease on fruits. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. 72 AUDPC Botrytis gray mold AUDPC Early blight AUDPC Septoria leaf spots Yes 257.2 b 916.9 a 134.6 a 132.4 a 66.9 a No 353.5 a 684.6 b 146.2 a 113.3 a 63.4 b Mean 305.3 800.7 140.4 122.8 65.15 P‐value P=0.002 P=0.006 P= 0.34 P=0.12 P=0.08 F‐value F=84.43 F=47.57 F=1.22 F=4.38 F=2.46 P‐value P=0.0001 P=0.75 P=0.93 P=0.42 P=0.02 F‐value F=31.92 F=0.57 F=0.24 F=1.05 F=18.67 Compost Amendment Compost x Treatment % AUDPC Fulvia leaf mold Marketable fruits % Healthy fruit % Other rots % Anthracnosefrui
t rot % Botrytis fruit rot Plant height (cm) Yes 69.0 a 13.7 b 1.4 a 0.2 a 46.73 a No 66.0 b 19.0 a 1.9 a 0.2 a 44.0 b Mean 67.5 16.3 1.65 0.2 45.3 P‐value P=0.35 P=0.06 P=0.55 P=0.83 P=0.0006 F‐value F=13.19 F=8.53 F=0.43 F=0.05 F=9.36 P‐value P=0.97 P=0.15 P=0.81 P=0.05 P=0.02 F‐value F=0.17 F=1.89 F=0.45 F=2.90 F=7.71 Compost Amendment Compost x Treatment Table 2.3. Effect of compost and compost x treatment interaction on foliar diseases, fruit diseases and plant height in Experiment I. Disease rating and area under the disease progress curve (AUDPC) are based on the values of the scale of 0‐100 percentage foliage affected. The AUDPC was calculated according to the formula: Σ ([(xi+ xi‐1)/2] (t i‐ t i‐1)), where xi is the rating at each evaluation time and (t i‐ t i‐1) is the time between evaluations. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. 73 2.3.2 Experiment II: As in the first experiment, natural disease pressure was low until high humidity and temperatures resulted in increased Fulvia leaf mold and Botrytis gray mold at the end of the season. There was numerical reduction in the severity of Fulvia leaf mold by all the treatments compared with the non‐treated control (AUDPC, 235.9; foliage affected in the final evaluation, 16.6%) (Table 2.4). However, only Kocide 3000 (AUDPC, 137.8) and OxiDate (AUDPC, 122.5) reduced the disease significantly. The severity of Fulvia leaf mold in OxiDate‐treated plants was also significantly lower than in those produced in with Trichoderma‐amended planting mix (AUDPC, 220.3), and in Muscodor‐
treated soil and Trichoderma‐amended planting mix (AUDPC, 212.3). Botrytis grey mold was significantly lower in plants treated with OxiDate (AUDPC, 469.1) compared with non‐treated plants (AUDPC, 678.1; percentage gray mold in the final evaluation, 33.1) and plants produced in Trichoderma‐amended planting mix (AUDPC, 694.4). The yield of marketable fruits was not affected by any of the treatments applied compared with the non‐treated control. As in the first experiment, the incidence of Botrytis fruit rot (ghost spots) (≤ 0.1%) and anthracnose fruit rot (≤0.03%) was low. There was no difference among the treatments and with the non‐treated control in the incidence of anthracnose fruit rots. Botrytis fruit rot (and ghost spots) was higher in Trichoderma (0.1%), and Muscodor plus Trichoderma (0.1%) treated plots compared with other treatments (0.0%) and the non‐treated control (0.0%). No difference was observed in the amount of ‘other rots’, regardless of the treatments. Fruits from all 74 treatments and the non‐treated control received similar (not significantly different) amounts of insect damage. Fruits with blossom end rot were found in all treatments and there was no effect of treatments on the incidence of blossom end rot. Similarly, none of the treatments had any effect on the plant height compared with the non‐treated control. During the first evaluation (Aug 21, 2008), plants from plots treated with Muscodor (8.9%) alone or in the presence of Trichoderma (7.4%) (Table 2.5) had significantly reduced the root lesion percentage compared with other treatments and the non‐treated control (15.9%). There was no difference in the percentage of root covered by lesions among treatments and the non‐treated control (16.3 %) at the second evaluation (Sep 18, 2008). The percentage roots colonized by Pythium was low in plants grown on Muscodor‐fumigated soil either in presence (0.9 and 1.1 %) or absence (1.1 and 0.6 %) of Trichoderma, compared with non‐treated control ( 3.1 and 3.4 %) in both evaluations. There was no difference among treatments and the non‐
treated control in the percentage of roots colonized by Fusarium during the first evaluation. It was reduced by Muscodor (3.5%) and OxiDate (4.5 %) compared with the non‐treated control (7.0 %) during the second evaluation. The incidence of Botrytis gray mold was less among the plants grown in compost amended soil (AUDPC, 457.5)(Table 2.6) than those grown on non‐amended soil (AUDPC, 684.8). The severity of Fulvia leaf mold, and incidence Botrytis fruit rot, anthracnose fruit rot, ‘other’ fruit rots, blossom end rot and insect damage were not 75 affected by compost amendment. Similarly, yield of marketable fruits and percentage of roots colonized by Pythium and Fusarium were not affected by compost amendment. The incidence of Botrytis gray mold was less in compost amended plots (AUDPC, 457.5) than in non‐amended plots (AUDPC, 684.8). Plants grown on compost amended soil (106 cm)(Table 2.7) were taller than the plants grown on compost non‐amended soil (99.3 cm). The root area covered by lesions was less among the plants grown on compost amended than non‐amended plots during the second evaluation (Sep 18, 2008), however, no difference was observed during the first evaluation (Aug 21, 2008). None of the parameters measured showed significant interaction of treatments with compost amendment. 76 Treatments Fulvia Leaf mold (AUDPC) Botrytis gray mold Marketable fruits Anthracnose fruit rot Botrytis fruit rot Other rots Blossom end rot (AUDPC) (%) (%) (%) (%) (%) Insect‐
damaged fruits (%) Non‐treated control 235.9 a 678.1 a 77.3 ab 0.1 a 0.0 b 0.0 a 1.3 a 1.6 a Muscodor 164.3 abc 547.8 ab 75.0 b 0.2 a 0.0 b 0.0 a 1.4 a 1.6 a Trichoderma 220.3 a 694.4 a 77.5 ab 0.1 a 0.1 a 0.0 a 0.9 a 1.6 a Muscodor + Trichoderma 212.3 ab 520.0 ab 80.3 a 0.2 a 0.1 a 0.0 a 1.0 a 1.0 a Kocide 3000 137.8 bc 517.5 ab 78.3 a 0.3 a 0.0 b 0.0 a 0.7 a 1.9 a OxiDate 122.5 c 469.1 b 79.3 a 0.3 a 0.0 b 0.0 a 1.1 a 1.4 a Mean 182.1 571.15 77.95 0.2 0.03 0.0 1.06 1.52 P‐value P=0.02 P=0.14 P=0.05 P=0.97 P=0.002 P=0.45 P=0.36 P=0.32 F‐value F=3.52 F=1.96 F=2.84 F=0.17 F=6.17 F=1.00 F=1.18 F=1.28 Table 2.4. Effect of treatments on foliar and fruit diseases in Experiment II. Disease rating and area under the disease progress curve (AUDPC) are based on the values of the scale of 0‐100 percentage foliage affected. The AUDPC was calculated according to the formula: Σ ([(xi+ xi‐1)/2] (t i‐ t i‐1)), where xi is the rating at each evaluation time and (t i‐ t i‐1) is the time between evaluations. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. 77 Area Area Roots Roots Roots Roots covered colonized by colonized by colonized by colonized by covered by by root root lesions Fusarium Fusarium Pythium Pythium lesions (21‐Aug) (18‐Sep.) (21‐Aug) (18‐Sep.) (21‐Aug) (18‐Sep.) (%) (%) (%) (%) (%) (%) Treatments Plant height (cm) Non‐treated control 99.8 a 3.4 a 3.4 a 2.6 a 7.0 a 15.9 a 16.3 a Muscodor 102.9 a 1.1 b 0.6 a 1.7 a 3.5 c 8.9 b 12.5 a Trichoderma 106.9 a 1.9 ab 1.1 bc 2.2 a 6.3 ab 10.3 ab 13.4 a Muscodor + Trichoderma 101.4 a 0.9 b 1.1 bc 2.0 a 3.9 bc 7.4 b 8.8 a Kocide 3000 102.9 a 1.9 ab 2.9 ab 2.6 a 5.6 abc 10.5 ab 10.7 a OxiDate 103.9 a 1.7 ab 1.1 bc 2.6 a 4.5 bc 10.5 ab 12.5 a Mean 102.9 1.8 1.7 2.2 5.1 10.5 12.3 P=0.86 P=0.08 P=0.89 P=0.04 P=0.102 P=0.31 F=0.04 F=2.46 F=0.32 F=3.06 F=2.06 F=1.30 P‐value P=0.67 F=0.64 F‐value Table 2.5: Effect of treatments on root diseases and plant height in Experiment II. Disease rating are based on the values of the scale of 0‐100 percentage root area affected. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. 78 Botrytis Gray Mold AUDPC Yes 190.0 a
457.5 b
77.9 a
0.2 a 0.0 a
1.5 a
0.1 a
1.0 a
No 174.3 a
684.8 a
77.9 a
0.2 a 0.0 a
1.6 a
0.1 a
1.0 a
Mean 182.1
571.1
77.9
0.2 0.0
1.55
0.1
1.0
P‐value P=0.04
P=0.95
P=0.44 F=11.40 F=0.00 F=0.79 P=0.39 F=1.00 P=0.73 F=0.14 P=0.77
F‐value P=0.32 F=1.39 F=0.10 P=0.29 F=0.15 P‐value P=0.28
P=0.35
P=0.37
P=0.65 P=0.45
P=0.98
P=0.72
P=0.77
F‐value F=1.37 F=1.19 F=1.16 F=0.67 F=0.10 F=0.23 F=0.56 F=0.49 Compost Amendment Compost x Treatments Insect‐
Blossom Botrytis damaged end rot fruit rot fruits (%) (%) (%) Leaf Mold AUDPC Marketable Anthracnose Other fruits fruit rot rots (%) (%) (%) Table 2.6. Effect of compost and compost x treatment interaction on foliar and fruit diseases in Experiment. Disease rating and area under the disease progress curve (AUDPC) are based on the values of the scale of 0‐100 percentage foliage affected. The AUDPC was calculated according to the formula: Σ ([(xi+ xi‐1)/2] (t i‐ t i‐1)), where xi is the rating at each evaluation time and (t i‐ t i‐1) is the time between evaluations. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. 79 Plant height (cm) Compost Amendment Compost x Treatments Roots Roots Roots Roots colonized colonized colonized colonized by by by Pythium by Pythium Fusarium Fusarium (21‐Aug) (18‐Sep.) (21‐Aug) (18‐Sep.) (%) (%) (%) (%) Area Area covered covered by root by root lesions lesions (21‐Aug) (18‐Sep.) (%) (%) Yes 106.4 a
1.8 a
1.6 a
1.9 a
5.0 a
9.8 a
10.5 b
No 99.3 b
1.9 a
1.8 a
2.7 a
5.3 a
10.4 a
14.2 a
Mean 102.8
1.85
1.7
2.3
5.15
10.1
12.35
P‐ value P=0.86
P=0.63
P=0.35
P=0.73
P=0.56
F‐value P=0.04 F=10.67 F=0.04 F=0.29 F=1.19 F=0.13 F=0.42 P=0.08 F=6.65 P‐ value P=0.70
P=0.85
P=0.04
P=0.25
P=0.73
P=0.86
P=0.11
F‐value F=0.60 F=0.38 F=2.94 F=1.19 F=0.55 F=0.37 F=2.12 Table 2.7: Effect of compost and compost‐treatments interaction on root diseases and plant height in Experiment II. Disease rating are based on the values of the scale of 0‐100 percentage root area affected. Values are the means of four replicate plots. Treatments followed by the same letter within a column are not significantly different at p≤0.1. 80 Population of Trichoderma hamatum 382: In the first experiment, planting mix was amended with of 5X105 spores/gm of dry planting mix. There were no detectable colony forming units of T. hamatum 382 in tomato rhizosphere soil and roots 4 and 8 weeks after transplanting. In the second experiment, there were 7.8X105 CFU /gm dry planting mix just before seeding. Four weeks later, just before transplanting, the population of T. hamatum 382 was 4.4X105 CFU /gm of dry planting mix. No colony forming units of T. hamatum 382 were detected 4 and 8 weeks after transplanting from root and rhizosphere of tomato plants grown in compost‐amended and non‐amended plots. Trichoderma‐like colonies grown on Trichoderma specific media (Chung, 1990) were tested by PCR with T. hamatum 382 specific primers (Abbasi et al. 1999). 83 ND: CFU not detected Figure 2.5: Trends of Trichoderma hamatum 382 populations in Experiment I (A) and II (B). Population count at 0 and 4 weeks after T. hamatum 382 amendment were done from planting mix, and at 8 and 12 weeks after amendment were done from rhizosphere soil and roots of tomato plants growing in compost‐amended and non‐amended plots. Population of T. hamatum 382 is expressed as Log Colony Forming Units (CFU) per gram of dry weight of planting mix/soil. 84 2.4 DISCUSSION High tunnels are gaining popularity among midwest tomato growers because they allow extension of the growing season and protection of crop from wind, rain, and incidence of many pests and diseases. Incidence of air and rain‐splash‐borne disease are low in high tunnels. However, due to higher relative humidity, diseases such as Botrytis gray mold and Fulvia leaf mold can be very destructive in high tunnel tomatoes. Growers mostly rely on fungicides to manage these diseases. However, bio‐rational products, which are relatively non‐toxic and have few ecological side effects (Grubinger, 1999), can be alternative disease management tools for high tunnel tomatoes. The primary goal of this study was to evaluate the effect of bio‐rational products for the control of high tunnel tomato diseases. Two microbial bio‐rational products, Trichoderma hamatum 382 and Muscodor albus, singly and combined; and two inorganic bio‐rational products, hydrogen peroxide (OxiDate) and copper hydroxide (Kocide 2000 or Kocide 3000) were compared in the presence or absence of compost; which in and of itself may improve resistance of tomatoes to foliar diseases (Zhang et al., 1998; Abbasi et al., 2002; Al‐Dahmani et al., 2003). OxiDate (hydrogen peroxide) reduced the severity of Fulvia leaf mold in both experiments and was the most effective treatment in Experiment I. None of the treatments were effective against Botrytis gray mold in Experiment I, although OxiDate reduced the incidence of this disease during Experiment II. Similar results were observed 85 by Hsiang and Tian (2007) against dollar spot of turf grass. In their study peroxide reduced the disease by 38% compared to the non‐treated control. As peroxide is not stable after application, protection of plant by OxiDate is supposed to be due to temporary sterilization of foliar surface (Hsiang and Tian, 2007). Kocide (Kocide 2000 in Experiment I and Kocide 3000 in Experiment II) reduced the severity of Fulvia leaf mold in both experiments. It also reduced the incidence of Botrytis gray mold and increased the yield of marketable and healthy fruits in Experiment I but there was no effect of Kocide application on yield in Experiment II. Several studies showed that M. albus suppresses root diseases by the production of active volatile organic compounds (VOCs) (Strobel et al. 2001; Strobel and Ezra, 2008; Mercier and Smilanick, 2005). In this study, the effect of M. albus alone or in combination with T. hamatum 382 was not consistent. It reduced the percentage root colonization by Pythium spp. and area covered by root lesions in the first evaluation of Experiment II but there were no effects in the second evaluation. Likewise, the percentage of roots colonized by Fusarium spp. was reduced in the second evaluation. Strobel (2006) found that Fusarium solani, the only Fusarium spp. tested, was alive after three days of exposure to M. albus culture, while most of the fungal and bacterial pathogens tested were dead. Interestingly, M. albus reduced the severity of Fulvia leaf mold singly and in combination with T. hamatum 382 in Experiment I. To my knowledge, no study has been reported so far where the application of M. albus in soil suppressed foliar diseases. 86 The severity of Fulvia leaf mold in Experiment I and percentage root colonization by Pythium spp. in the first evaluation of Experiment II were reduced by T. hamatum 382. Unlike several greenhouse trials where T. hamatum 382 suppressed diseases of several hosts (Alfano et al., 2007; Horst et al., 2005; Khan et al., 2004), none of the diseases evaluated were consistently suppressed in our study. This observation may be attributed to the population of T. hamatum 382 on roots and in rhizosphere soil. The population threshold of T. hamatum for bio‐control activity is 1x105 CFU/gm of growing medium (Chung and Hoitink, 1990; Elad et al., 1981; Aziz et al., 1997). In this study, the population of T. hamatum 382 was maintained above the threshold in the planting mix. However, the population dropped dramatically after transplantation of tomato seedlings into field soil. T. hamatum 382 was not isolated from rhizosphere soil or roots a month after transplanting into compost‐amended or non‐amended plots. The inability of T. hamatum 382 to colonize field soil has also been reported by Leandro et al (2007), where, with one exception, they failed to re‐isolate T. hamatum 382 from soil inoculated with T. hamatum 382 spores. They also observed that T. harziamum, a bio‐
control agent, and other native (of soil) species of Trichoderma were good soil colonizers. Contrary to this, carrying capacity of compost amended soil in the study carried out by Leandro et al (2007) was 1x103 CFU/gm, which is clearly below the population threshold to execute bio‐control activity. Many Trichoderma species are indigenous to soil. However, T. hamatum 382 was originally isolated from peat mix (H. 87 A. J. Hoitink, personal communication), which may be the reason for inability of T. hamatum 382 to colonize soil. During this study plants grown in compost‐amended plots were taller than those grown in non‐amended plots. This finding agrees with those of several previous studies (Curtis and Claassen, 2009; Keeling et al., 2003; Chen and Inbar, 1993), but contradicts results of a few (Gamliel and Stapleton, 1993; DeBriot Alvarez et al., 1995). Positive impact of compost on plant growth might be due to improved soil quality and supply of additional nutrients. Severity of ‘other’ rots was reduced by compost in our study but there was no impact on the incidence of anthracnose and botrytis fruit rots which were very low in this study. Abbasi et al (2002) found that compost reduced the incidence of processing tomato fruit diseases including anthracnose fruit rots. Fruit rots are more common in processing than fresh market tomato and disease incidence was much higher in this study than we observed in fresh market tomatoes. The yield of healthy and marketable fruits was increased by compost amendment in Experiment I but there was no such increase in Experiment II. In this study we planted ‘Mountain Spring’ in Experiment I and ‘Florida 47’ in Experiment II. Such varietal response of compost regarding fruit yield was also observed by Abbasi et al (2002), where compost increased the total fruit yield of OH 8245 but not Peto 696. In the present study the incidence of Botrytis gray mold was increased in Experiment I and decreased in Experimental II in tomatoes grown in compost‐amended plots. This unusual observation might be due to a difference in pruning in the two years of the study. Compost‐amended plots produced 88 larger plants with dense canopies in both experiments; however, all plants were pruned in Experiment II to reduce canopy density. In the absence of pruning, relative humidity increases due to reduced air flow through the canopy, which might have favored the disease in Experiment I. Another difference observed in these experiments was in the incidence of blossom end rot (BER). BER was completely absent in Experiment I; however, the disorder appear appeared in all plots, regardless of treatment, in Experiment II. This difference might have resulted from varietal response or variation in irrigation schedules. Plants were irrigated for one hour every other day during Experiment I, and for one and half hour twice a week during Experiment II. The irrigation schedule of Experiment II probably caused more variation of moisture levels in the soil than the schedule employed in Experiment I, which is the main cause of blossom end rot (Miller et al., 1996; Precheur, 2005). In conclusion, natural disease pressure was low in high tunnel conditions. Both OxiDate and Kocide successfully suppressed the severity of Fulvia leaf mold. None of the treatments used in this study reduced the incidence of Botrytis gray mold; however, compost amendment reduced the disease pressure when plants were pruned. Plants grown in compost amended plots had better growth and the severity of ‘other’ rots was low compared to those grown in non‐amended plots. This study also emphasizes the importance of proper irrigation to manage the incidence of blossom end rots in high tunnel tomatoes. Most importantly, this study revealed the inability of the bio‐control 89 agent T. hamatum 382 to survive in high tunnel soil, and highlights the importance for research to find ways to stabilize the fungus in soil. 90 2.5 REFERENCES Abbasi, A. P., Al‐Dahmani, J., Sahin, F., Hoitink, H. A. J., and Miller, S. A. 2001. Effect of compost amendments on disease severity and yield of tomato in conventional and organic production system. Plant Disease 86: 156‐161. Abbasi, A. P., Miller, S. A., Meulia, T., Hoitink, H. A. J., and Kim, J. M. 1999. Precise detection and tracing of Trichoderma hamatum 382 in compost‐amended planting mixes by using molecular markers. Appl. Al‐Dahmani, J. H., Abbasi, P. A., Miller, S. A., and Hoitink, H. A. J. 2003. Suppression of bacterial spot of tomato with foliar sprays of compost extracts under greenhouse and field conditions.Plant Dis. 87:913‐919. Baysal‐Gurel, F. and Miller, S. A. 2008. Efficacy of biopesticides and fungicides against pre‐ and post‐emergence damping off of vegetable seedlings by Pythium aphanidermatum. (Abstr.) Phytopathology 98:S19. Baysal‐Gurel, F., Mera, J. R., and Miller, S. A. 2007 Effects of Muscodor, serenade and conventional fungicide on rhizoctionia root and hypocotyl rot and clubroot of radish. (Abstr.) Phytopathology 97: S9. Canteros, B. I., Minsavage, G. B., Jones, J. B., and Stall, R. E. 1995. Diversity of plasmids in Xanthomonas capestris pr. vesicatoria. Phytopathology 85: 1482‐1486. Chen, W., Hoitink, H. A. J., and Madden, L. V. 1988. Microbial activity and biomass in container mendia for predicting suppressiveness to damping‐off caused by Pythium ultimum. Phytopathology 78: 1447‐1450. Chen, Y., and Inbar, Y. 1993. Chemical and spectroscopical analyses of organic matter transformations during composting in relation to compost maturity. In: Science and Engineering of Composting: Design, Environmental, Microbiological, and Utilization Aspects. H. A. J. Hoitink and H. M. Keener, eds. Renaissance Publications, Worthington, OH. Chung, Y. R., and Hoitink, H. A. J. 1990. Interactions between thermophilic fungi and Trichoderma hamatum in suppression of Rhizoctoniadamping‐off in a bark compost‐
amended container medium. Phytopathology 80:73‐77. CIWMB. 2006. Compost: What is it?. http://www.ciwmb.ca.gov/Organics/CompostMulch/CompostIs.htm Curtis, M. J., and Claassen, V. P. 2009. Regeneration topsoil functionality in four drastically disturbed soil types by compost incorporation. Restoration Ecology 17: 24‐32. 91 Day, J. P., Wattier, R. A. M., Shaw, D. S., and Shattock, R. C. 2004. Phenotypic and genotypic diversity in Phytophthora infestans on potato in Great Britain, 1995‐98. Plant Pathology. 53: 303‐315. De Meyer, G., Bigirimana, J., Elad, Y., and Hofte, M. 1998. Induced systemic resistance in Trichoderma harzianum T39 and biocontrol of Botrytis cinerea. Eur. J. Plant Pathol. 104:279‐286. DeBriot Alvarez, M. A., Gagne, S., and Antoun, H. 1995. Effect of compost on Rhizosphere microflora of tomato and on the incidence of plant growth‐promoting rhizobacteria. App. Env. Mocrob. 61: 194‐199. Djonovic, S., Vittone, G., Mendoza‐Herrera, A., and Kenerley, C. M. 2007. Enhanced biocontrol activity of Trichoderma virens transformants constitutively coexpressing β‐
1,3‐ and β‐1,6‐ glucanase genes. Mol. Plant pthol. 8:469‐480. Environ. Microbiol. 65:5421‐5426. EPA, 2002. Hydrogen perodixe (Hydrogen dioxide)(000595)Fact Sheet. U.S. Environmental Protection Agency. http://www.epa.gov/pesticides/biopesticides/ingredients/factsheets/_000595.htm#des
cription Esposito, E., and da Silva, M. 1998. Systematics and environmental application of the genus Trichoderma. Critical Rev. in Microbiology, 24:89‐98. Gamliel, A., and Stapleton, J. J. 1993. Effect of chicken compost or ammonium phosphate and solarization on pathogen control, rhizosphere microorganism, and lettuce growth. Plant Dis. 7:886‐891. Gentile, A., Deng, Z., La Malfa, S., Distefano, G., Domina, F., and Kenerley, C. M. 2007. Enhanced resistace to Phoma tracheiphila and Botrytis cinera in transgenic lemon plants expressing a Trichoderma harzianum chitinase gene. Plant Breeding 126:146‐151. Graves, A. S., and Alexander, S. A. 2000. Alternatives to copper for bacterial disease control in staked tomatoes. Phytopathology 90: S132. Grech, N. M. 1990. Fungicide resistance in plant pathogenic fungi: the problems and ways to cope. Calif‐Grow 14: 36‐37. Grubinger, V. 1999. Bio‐rational pesticides. University of Vermont Extension. http://www.uvm.edu/vtvegandberry/factsheets/biorationals.html Hadar, Y. and Gorodecki, B. 1991. Suppression of germination of sclerotia of Sclerotium rolfsii in compost. Soil Biol. Biochem. 23: 303‐306. 92 Hightunnels.org, 2007. http://www.hightunnels.org/ForEducators/Introduction/What.htm Hoitink, H. A. J., Krause, M. S., and Han, D. Y. 2001. Spectrum and Mechanisms of plant disease control with composts. In Stoffella, P. J., and Kahn, B. A. 2001. Compost utilization in horticultural cropping systems. CRC press, pp. 263‐274. Horst, L. E., Locke, J., Krause, C. R., McMahon, R. W., Madden, L. V., and Hoitink, H. A. J. 2005. Suppression of Botrytis blight of begonia by Trichoderma hamatum 382 in peat and compost‐amended planting mixes. Plant Dis. 89:1195‐1200. Hsiang, T., and Tian, L. 2007. Control of Dollar spot with molasses and hydrogen peroxide. GTI Annual Research Report 2007. http://www.uoguelph.ca/GTI/07anrep/155‐156.pdf Jett, L. W. 2006. Production of tomatoes within a high tunnel. http://www.hightunnels.org/ForGrowers/WarmSeasonVegetables/warmseasonvegtom
prod.htm Jones, 2006. Early blight. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Diseases. APS press. Minnesota. USA: 13 p. Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Diseases. APS press. Minnesota. USA. Keeling, A. A., McCallum, K. R., Beckwith, C.P. 2003. Mature green waste compost enhances growth and nitrogen uptake in wheat (Triticum aestivum L.) and oilseed rape (Brassica napus L.) through the action of water‐extractable factors. Bioresour. Technol. 90, 127–132. Kettler, J. S. 1997. A pot study in investigating the relationship between tree mulch decomposition and nutrient element availability. Commun. Soil Sci. Plant Anal. 28: 1269‐
1284. Khan, J., Ooka, J. J., Miller, S. A., Madden, L. V., and Hoitink, H. A. J. 2004. Systematioc resistance induced by Trichoderma hamatum 382 in cucumber against Phytophthora crown rot and leaf blight. Plant Dis. 88:280‐286. Leandro, L. F. S., Guzman, T., Ferguson, L. M., and Louws, F. S. 2007. Population dynamics of Trichoderma in fumigated and compost‐amended soil and on strawberry roots. Applied Soil Ecology 35: 237‐246. Lewis Ivey, M. L., Mera, J. R., and Miller, S. A.2005. Evaluation of fungicides and bactericides for the control of foliar and fruit diseases of processing tomatoes. 93 Vegetable disease management research reports. Plant Pathology series No. 126. The Ohio State University. 4 p. Manzies, J. G. and Jarvis, W. R. 1994a. Early blight. In Howard, R. J., Garland, J. A. and Seaman, W. L. 1994. Diseases and pest of vegetable crops in Canada. The Canadian Phytopathological Society. Entomological Society of Canada. Canada: 346 pp. Manzies, J. G. and Jarvis, W. R. 1994b. Early blight. In Howard, R. J., Garland, J. A. and Seaman, W. L. 1994. Diseases and pest of vegetable crops in Canada. The Canadian Phytopathological Society. Entomological Society of Canada. Canada: 350 pp. Mc Coy, C. W., Nigg, H. N., Timmer, L. W., and Futch, S. H. 2003. Use of pesticides in citrus IPM. In: Timmer, L. W. 2003. Florida citrus pest management guide, University of Florida Cooperative Extension Service, Institute of Food and Agricultural Services. Mellilo, J. M., Aber, J. D., and Muratore, J. F. 1982. Nitrogen and lignin control of hardwood leaf litter decomposition dynamics. Ecology 63: 621‐626. Miller, S. 2006. Managing diseases of tomatoes in high tunnels. VegNet 13: 5 http://vegnet.osu.edu/news/currentvn05‐06.htm Miller, S. A., and Ivey, M. L. L. 2006. Hot water and chlorine treatment of vegetable seeds to eradicate bacterial plant pathogens. Vegetable isease management Research Reports, OSU extension. Miller, S. A., Rowe, R. C., and Riedel, R. M. 1996. Blossom‐end rot of tomato, pepper, and eggplant. Extension Fact Sheet, The Ohio State University. HYG‐3117‐96. http://ohioline.osu.edu/hyg‐fact/3000/pdf/3117.pdf Pitblado, R. E., and Howard, R. J. 1994. Early blight. In Howard, R. J., Garland, J. A. and Seaman, W. L. 1994. Diseases and pest of vegetable crops in Canada. The Canadian Phytopathological Society. Entomological Society of Canada. Canada: 274 pp. Precheur, R. J., Bennett, M. A., Riedel, R. M, Wiese, K. L., and Dudek, J. 1992. Management of fungicide residues on processing tomatoes. Plant Dis. 76: 700‐702. Song, W. G., Li, B. J., Ye, Z. H., Zhao, Z. H., and Shi, Y. X. 2008. Concentration Prediction of Pesticides with Different Transformation Fate in Agricultural Soil Environment. J. Agro‐Environ. Sci. 27: 1574‐1581. Stevenson, W. R. 2006. Septoria leaf spot. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Diseases. APS press. Minnesota. USA: 22 p. 94 Stinson, A. M., Zidack, N. K., Strobel, G. A., and Jacobsen, B. J. 2003 Mycofumigation with Muscodor albus and Muscodor roseus for control of seedling diseases of sugar beet and Verticillium wilt of eggplant. Plant Dis. 87: 1349‐1354. Strobel, G. A., Dirksie, E., Sears, J., and Markworth, C. (2001) Volatile antimicrobials from a novel endophytic fungus. Microbiology 147: 1943‐2950. Strobel, G.A., and Ezra, D. (2008) Application of Muscodor albus to control harmful microbes in human and animal wastes. United States Montana State University (Bozeman, MT, US) 7341862 Tuite, J. 1969. Plant pathological methods fungi and bacteria. Burgess publishing company. pp 183‐184. USDA, 2008. United States Department of Agriculture, National Agriculture Statistics. http://www.nass.usda.gov/QuickStats/PullData_US.jsp Voloudakis, A. E., Reignier, T. M., and Cooksey, D. A.2005. Regulation of resistance to copper in Xanthomonas axonopodis pv. vesicatoria. Appl. Environ. Microbiol. 71: 782‐
789. Yedidia, I., Shoresh, M., Kerem, Z., Benhamon, N., Kapulnik, Y., and Chet, I. 2003. Concomitant induction of systemic resistance to Pseudomonas syringae Pv. Lachrymans in cucumber by Trichoderma asperelleum (T‐203) and accumulation of phytoalexins. Appl. Environ. Microbiol. 69:7343‐7353. Yun, L. T., Mizubuti, E., and Fry, W. E. 1999.Genetics of metalaxyl resistance in Phytophthora infestans. Fungal Genetics and Biology 26: 118‐130. Zhang, W., Han, D. Y., Dick, W. A., Davis, K. R., and Hoitink, H. A. J.1998. Compost and compost water extract‐induced systemic acquired resistance in cucumber and Arabidopsis. Phytopathology 88:450‐455. 95 CHAPTER 3 INDUCTION OF CERTAIN DEFENSE GENES IN TOMATO BY TRICHODERMA HAMATUM 382 3.1 INTRODUCTION Biological control is the utilization of living organisms, other than a resistant host, to suppress the activities and populations of plant pathogens (Pal and McSpadden Gardener, 2006). Bio‐control agents help to minimize the hazardous impact of chemicals on the environment either by replacing traditional fungicides/bactericides or by reducing their rate of application (Song et al., 2008; Chet and Inbar et al., 1994). Several plant growth promoting rhizobacteria (PGPR) and fungi have been intensively studied for their ability to suppress plant diseases (Pal and McSpadden Gardener, 2006; Meera et al., 1994; Pieterse et al.,1996). Amongst these, Trichoderma species are the most studied fungi (Harman et al., 2004). In addition to protection of plants from diseases, Trichoderma spp. also has been shown to improve overall plant health. Trichoderma spp. enhances the rate of photosynthesis by increasing the greenness of leaves (Harman, 2006). They also activate carbohydrate metabolism resulting in improved root 96 and shoot growth (Shoresh and Harman, 2008). Wilson et al (2008) reported that Trichoderma spp. also help to reduce malformed and green‐colored potato tubers. Mycoparasitism, antibiosis and competition are the basic mechanisms of disease control by Trichoderma where both bio‐control agents and pathogens interact directly with each other (Elad, 1996; Chet et al., 1990; Harman et al., 2004). Several studies, however, showed that Trichoderma can also protect plants from diseases without coming in direct contact with pathogens (Alfano et al., 2007; Shoresh et al., 2005). This reveals the role of Trichoderma in the induction of disease resistance. Resistance induced in plants has been described as either systemic acquired resistance (SAR) or induced systemic resistance (ISR). SAR is induced by necrotizing or avirulent pathogens; salicylic acid is accumulated in plants and detectable amounts of pathogenesis‐ related proteins (PR Proteins) are expressed (Glazebrook, 2005; Sticher et al. 1997). Unlike SAR, ISR is induced by root colonizing rhizobacteria and requires components of jasmonic acid and ethylene signaling pathways (Glazebrook, 2005; Bakker et al. 2003, Pieterse et al., 1998). Lipoxygenase (Lox) and phenylalanine ammonia lyase (PAL) are marker genes of ISR (Gallou et al., 2009; Yedidia et al., 2003). Several studies have indicated that the host plant resistance induced by Trichoderma and other root colonizing fungi follows the ISR pathway (Djonovic et al., 2007; Shoresh et al., 2005; Van Wee et al., 2008; Shoresh and Harman, 2008). Contrary 97 to this, Yedida et al. (2000) observed the increased level of SAR markers in plants colonized by Trichoderma. Gallou et al. (2009) noticed that the marker genes for both SAR (PR 1) and ISR (PAL) were induced by Trichoderma in potato. From these recent findings we can conclude that the mechanism of resistance induction by Trichoderma is vague and still unclear. Regardless of the pathway, a growing number of researchers believe “priming” to be the principle mechanism of resistance induction by beneficial microbes (Van Wees et al., 2008; Conrath et al. 2006). When a plant is colonized by a pathogen or some beneficial microorganisms, it develops a unique physiological property by which it can “recall” such infection or colonization in the future. Such physiological state is called a “primed” state and the plant is called a “Primed” plant. Primed plants respond more rapidly and effectively against pathogens resulting in enhanced resistance (Goellner and Conrath, 2008; Conrath et al., 2006). Arabidopsis plants previously treated with avirulent Pseudomonas syringae pv tomato DC 3000 showed enhanced activation of defense genes PAL, PR‐1, PR‐2, and others only after subsequent attack by pathogens. Similarly, a low dose of SA did not affect the regulation of defense genes; however, upon subsequent challenge with pathogen, defense genes were activated (Mur et al. 1996). Similar observations were found when plants were colonized by beneficial organisms. More defense genes were expressed in tomato plants colonized by the mycorrhizal fungus Glomus mossae than in the plants that were not colonized by the mycorrhizal fungus, when challenged with Phytophthora parasitica (Cordier et al., 1998; 98 Pozo et al., 2002). Challenge with Pseudomonas syringae pv. lachrymans resulted the increased activity of defense genes in cucumber plants pre‐inoculated with Trichoderma compared with plants not inoculated with Trichoderma (Shoresh et al., 2005). These microorganisms also induce structural changes in plants, Bacillus pumilus SE34 modified the chemical and physical structure of root cell walls to prevent penetration by pathogens (Benhamou et al., 1996). Colonization of tomato roots by mycorrhizal fungi resulted in pectin and callose deposition on the cell wall during pathogen attack (Cordier et al., 1998; Pozo et al., 2002). Using microarrays, Alfano et al. (2007) found that genes encoding cell wall proteins were activated in the leaves of 5‐
week old tomato plants grown on Trichoderma amended planting mix compared with those grown on non‐amended planting mix. Extensin was upregulated and expansin was down regulated in the walls of tomato leaves. Though the main markers of SAR and ISR were not induced, osmotin like (PR‐5) protein was upregulated by Trichoderma. Extensin is a protein that forms intra and inter‐cross‐links in plant cell walls (Showalter, 1993; Kieliszewski and Lamport, 1994). It is expressed throughout plant development in parts such as roots, nodes and vascular tissues that bear pressure (Merkouropoulous and Shirsat, 2003; Kellar and Lamb, 1998; Tire et al., 1994). Expression of extension by pathogen attack, wounding, exogenously supplied salicylic acid, methyl jasmonate, auxins and brassinosteroids strengthens the cell wall and discourages penetration by pathogens (Showalter et al., 1985; Merkouropoulous and Shirsat, 2003). 99 Expansins are a group of cell wall proteins involved in cell wall expansion (McQueen‐Mason et al., 1992; Li et al., 1993). Expansin is involved in developmental process such as cell growth, cell division, root and shoot growth, fruit ripening, abscission, pollen germination and seed germination; during which cell wall loosening occurs (Cosgrove et al., 2002; Cho and Kende, 1998; Brummell et al., 1999; Belfield et al., 2005). Expansin works in catalytic amounts and stimulates wall creep without causing covalent alteration of the cell wall (Cosgrove, 2000; Mc Queen‐Mason and Cosgrove, 1994; Sampedro and Cosgrove, 2005). Expansin is supposed to behave like a zipper that enables cell wall microfibrils to move apart from each other by ungluing the chains that bind them together (Whitney et al., 2000). Recent studies have shown that plant pathogens use expansins for invasion and colonization of plant tissue (Brotman et al., 2008; Kerff et al., 2008; Wieczorek et al., 2006; Qin et al., 2004). Osmotin and osmotin like proteins are members of pathogenesis‐related protein 5 (PR‐5) which are generally expressed in desiccated cells (LaRosa et al., 1992; Anzlovar and Dermastia, 2003). They are acidic proteins induced in plants by several biotic and abiotic stresses (Anzlovar and Dermastia, 2003; Kim et al., 2002). Expression of osmotin in plants inhibits hyphal growth and spore germination, and reduce viability of germinated spores (Abad et al., 1996; Newton and duman, 2000). The goal of this study was to elucidate the expression of individual resistance genes in tomato plants exposed to Trichoderma hamatum 382 and subsequently inoculated with the bacterial spot pathogen Xanthomonas euvesicatoria 110C. We 100 monitored the expression of extensin, osmotin and expansin genes in tomato leaves in the presence and absence of T. hamatum 382 before and after inoculation with X. euvesicatoria 110C. We hypothesized that T. hamatum 382 primes tomato for rapid and effective activation or deactivation of extensin, osmotin and expansin in the presence of X. euvesicatoria 110C. Upregulation of extensin and down regulation of expansin provide mechanical strength to cell walls (Schnabelrauch et al., 1996; Samperdo and Cosgrove 2005). Up‐regulation of osmotin in tomato cells make them toxic to invading pathogens (Abad et al., 1996; Newton and Duman, 2000). 101 3.2 MATERIALS AND METHOD 3.2.1 Preparation of planting mix Planting mix was prepared according to Horst et al. (2005). Twelve liter light fibrous (H2‐3 on the Von Post decomposition scale) sphagnum peat (Sungro; Horticulture Canada, Ltd., Lamaque, N.B., Canada) was mixed with 8 L coarse horticultural grade perlite (Ball Seed Co, West Chicago, IL). The mix was then amended with 18 g of potassium nitrate, 18 g of gypsum, and 18 g of super phosphate as starter fertilizer and 86 g of dolomitic lime and 56 g of calcium carbonate (‹0.15mm) to raise the pH to 5.5 to 6.0. The mixture was rotated in a cement mixer for 10 minutes with frequent sprays of water. The optimum moisture level of the mix was determined manually (mix remained together when compressed). Planting mix thus prepared was collected in a black plastic trash bag and stored at ‐700C. To determine the pH, 20 g of the mix was added to 40 ml double distilled water and measured with a pH meter (ThermoOrin model 410, Orin Research, Inc., Beverly, MA). pH of the mix were 6.01 and 5.8 in the first and second experiments, respectively. Ten gram of the mix was dried in an oven at 550C for 7 days to calculate moisture content. Planting mix was amended with T. hamatum 382 spores as described in Chapter 2 (Page 50). We added 34 ml of spore suspension (3x107 spores/ml) in 8.5 kg wet (5.11 kg dry) weight of planting mix in Experiment I, and 60.14 ml of spore suspension 102 (2.7x107 spores/ml) in 12.5 kg wet (8.12 kg dry) weight of planting mix in Experiment II to obtain 2x105 CFU/g dry wt. of planting mix. 3.2.2 Irrigation and Fertilization Two seeds of tomato (Ohio 8245) were placed 2 cm deep into 400 ml styrofoam cups, each with two holes in the bottom to drain water (Fig. 3.1). Seedlings were thinned to one per cup after 7 days. Plants were fertilized every other day with modified Hoaglan’s solution (Hoagland and Arono, 1950) (Table 3.1). To ensure uniform delivery of water and nutrients a siphon delivery system was used as described by Nava‐Diaz (2006). Tubing 3m long with an internal diameter of 1.6 mm and external diameter of 3.2 mm (Tygon, Saint Gobain, Akron, OH) was used to siphon water/nutrients from a reservoir (opaque water bucket) to plants. The reservoir and cups were placed on the same bench in a green house. All cups and reservoir were adjusted exactly at the same vertical height to ensure uniform distribution of water and nutrients. The reservoirs were refilled daily at 12:00‐ 14:00, alternating water with nutrient solution. 103 Figure 3.1. Tomatoes grown in styrofoam cups fitted with siphon delivery systems. Tomatoes in four tables representing four blocks before Xanthomonas euvesicatoria 110C inoculation (A), Single line serving each cup (B). 3.2.3 Population of Trichoderma hamatum 382 The population of Trichoderma hamatum 382 in planting mix was determined by dilution plating on Chung’s Trichoderma selective medium (Chung and Hoitink, 1990)(Fig. 3.2), immediately after seeding and weekly thereafter. Planting mix (initially 10g, 1 g was used later for weekly counts) was blended with 90 ml (9 ml for weekly counts) of sterile dilution buffer (7 g K 2HPO4, 3 g KH2PO4, 1.5 g agar, 1L distilled water), and 1 ml of the solution was diluted up to 10‐5 dilution and plated (three plates per dilution) on Chung’s medium. A 10g sample of the planting mix was placed in oven at 55 o
C for 10 days, and then weighed. Colony forming units (CFU) per gram dry weight of planting mix was calculated by applying the following formula: CFU/gm of dry mix = Mean of colonies in three plates X dilution factor X wet wt. of mix Dry wt. of mix 104 Figure 3.2. Colonies of Trichoderma hamatum 382 growing on Chung’s medium (Chung and Hoitink, 1990) during dilution planting. (A) Front view of a plate, (B) Rear view of the plate.
105 Volume Amount (g) Stock conc Component Mol. Formula MW (g/mol) (ml)/L per L Stock in M nutrient solution solution Potassiumphosphate monobasic KH2PO4 136.0 1.00 136.0 0.50 Potassium nitrate KNO3 101.1 1.00 101.1 2.50 Calcium nitrate Ca(NO3)2 164.1 1.00 164.1 2.50 Magnesium sulfate MgSO4 120.3 1.00 120.3 1.00 Fe‐DTPA 490.1 0.07 34.7 1.00 Manganese(II) Chloride MnCl2 125.8 0.01 1.2 0.90 Copper(II) chloride CuCl2 134.4 0.01 1.3 0.15 Zinc chloride ZnCl2 136.3 0.01 1.3 0.15 Boric acid H3BO3 61.8 0.10 6.1 0.45 Sodium molybdate MoNa2O4 205.9 0.001 0.2 0.10 Diethylenetriaminepentaacetic acid iron Table 3.1. Composition of modified Hoagland’s solution. Table shows the molecular formula, molecular weight, amount of ingredients required to make 1L stock solution, and the volume of stock solution required to make a liter of nutrient solution. 3.2.4 Trichoderma hamatum 382 colonization of tomato plants The presence of Trichoderma hamatum 382 in stem and roots was determined at the end of each experiment. Thoroughly rinsed roots were chopped into pieces, approximately 3 mm long, and plated onto Trichoderma selective medium. Stem 106 sections, 1‐2 mm thick, were cut 5 and 15 cm above the soil level and plated onto the medium. Plant materials were plated with and without surface sterilization. Surface sterilization was done by immersing the plant materials in 0.5% sodium hypochloride solution for 30 seconds followed by two rinses in sterile double‐distilled water. Plates were incubated at room temperature for 7 days. The identity of Trichoderma hamatum 382 isolated from planting mix, roots and stems was verified by observing the fungus microscopically and by Polymerase Chain Reaction (PCR) with Trichoderma hamatum 382 specific primer sets (Abbasi et al. 1999). The PCR reaction mixture was prepared by adding 12.5 µl green master mix (Promega, Madison, WI), 9.0 µl nuclease free water (Promega, Madison, WI), 1.25 µl forward (10µM) and 1.25 µl reverse primers (10 µM). Mycelia were used directly as template. For this, barely visible amount of mycelia grown on PDA were taken by sterile pointed toothpick and added to the tubes containing PCR reaction mix. Condition for amplification was set as 35 cycles of 35 s at 94oC, 35 s at 55oC, and 55 s at 72oC, with a final extension step of 7 min at 72oC. The amplified product was loaded on to a 1.5% agarose gel (Invitrogen, Carlsbad, CA) and run at 90 V for 50 min with 0.5X TBE buffer (Bio‐Rad laboratories, Hercules, CA). The gel was stained with dilute ethidium bromide solution (2 µg/ml) and the image was captured using Kodak EDAS 290 system (Kodak, Rochester, NY). 107 3.2.5 Bacterial inoculum Bacterial inoculum was prepared according to Alfano et al. (2007). Xanthomonas euvesicatoria 110C cultured on YDC for 48 hr at 280C was washed from the plate with sterilized distilled water. The bacterial suspension was diluted to about 1x108 CFU/ml (optical density at 600nm ≈0.2). The concentration of X. euvesicatoria 110C was verified by dilution plating on CKTM medium. The entire above ground portion of plants were sprayed to run‐off with this suspension 5 weeks after seeding. Plants were misted for 2 hrs before inoculating them with X. euvesicatoria 110C. Control plants were sprayed with sterilized distilled water. 3.2.6 Bacterial leaf spot bioassay The severity of Xanthomonas leaf spot (Fig. 3.3) was evaluated by counting the water soaked spots produced on the ventral surface of of all leaflets of the 3rd, 4th, 5th, 6th and 7th leaves from the bottom of each plant 9, 11, and 13 days after inoculation. The spots counted were confirmed to be caused by X. euvesicatoria 110C by PCR (Obradovic et al. 2004). For this, symptomatic leaves were surface sterilized with 0.5 % sodium hypochloride for 30 sec and air dried in a laminar flow hood. About 0.2 gm of leaf tissue was cut through the spots, put into a 125 ml conical flask containing 15 ml of potassium phosphate buffer, pH 7.4 (KPB; 8.02 ml K2HPO4 1M, 1.9 ml KH2PO4 1M, 990 ml distilled water), and shaken at 150 rpm for 30 min at room temperature. The suspension (without leaf tissue) was transferred to a centrifuge tube and spun at 10,000 108 rpm for 10 minutes. Supernatant was discarded the pellet was resuspended in 1 ml sterile distilled water and was subjected to ten‐fold serial dilutions upto 10‐5. An aliquot (100 µl) from each dilution was spread on CKTM medium and incubated for 7 days at 28oC. The colonies grown on CKTM were confirmed by PCR (Obradovic et al., 2004). Figure 3.3. Bacterial leaf spots caused by Xanthomonas euvesicatoria 110C on the lower surface of tomato leaflets after thirteen days of inoculation. 3.2.7 Leaf sampling for RNA extraction Leaves were sampled at four different time points: one day before inoculation with X. euvesicatoria 110C, and 2, 5 and 8 days after inoculation. The fourth leaf from the top was removed and immediately frozen in liquid nitrogen and stored at ‐800C. Each plant in a block was only sampled once. 109 3.2.8 RNA extraction RNA was extracted from sampled leaves by using RNeasy Plant Mini Kit (Quiagen Sciences, Germantown, MD) according to the manufacturer’s instructions. Leaf tissue (0.1 g) stored at ‐800C was ground in liquid nitrogen. This step was done quickly to avoid thawing of the leaf. 450 µl RLT buffer containing β‐mercaptoethanol was added to the tissue and vortexed vigorously. Lysate was transferred to a quiashredder spin column and centrifuged for 2 min at 10,000 rpm. The supernatant was transferred to a 1.5 ml centrifuge tube without disturbing the cell‐debris pellet. Half volume of 95% ethanol was added to the lysate and mixed by pipetting. The mixed lysate was transferred to an RNeasy spin column placed in a 2 ml collection tube and briefly centrifuged (15 s at 10, 000 rpm). The flow‐through was discarded and the column was washed with 700 µl RW1 buffer once, followed by 500 µl RPE buffer twice. The first two washes were done for 15 s at 10,000 rpm and the last one for 2 min at 10,000. The RNeasy spin column was placed in a new 1.5 ml centrifuge tube and RNA was eluted in 50 µl RNase free water by spinning for 1 min at 10,000 rpm. RNA thus extracted was quantified using ND‐1000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE). 3.2.9 Preparation of DNA free RNA DNA contamination, if any, was removed from 10 µg total RNA by using Ambion DNA free kit (Ambion Inc., Austin, TX) according to manufacturer’s instructions. Reaction mixtures (50 µl) were prepared in 0.5 ml tubes. Each reaction mixture contained 1 µl 110 rDNase I, 4 µl 10X DNase I buffer, 10 µg total RNA, and nuclease free water to make a final volume of 50 µl. The reaction mixture was incubated at 37oC for 30 min. DNase inactivation reagent (4 µl) was added to the reaction and mixed well by pipetting. The reaction mixture was incubated at room temperature for two minutes, mixed two times during incubation. Finally, the reaction mixture was centrifuged for 1.5 min at 10,000 x g and the supernatant was transferred to a new nuclease free 1.5 ml tube. The concentration of RNA in the solution was determined by using a ND‐1000 spectrophotometer. To confirm that the cleaned RNA had no DNA contamination, 1 µl of cleaned RNA was taken as a template and a segment of the housekeeping gene β‐tubulin was amplified for 40 cycles. Primers and the amplification conditions were adjusted according to Alfano et al. (2007). To check whether the purified RNA was degraded, 3 µl of purified RNA was mixed with 6 µl of 3X blue loading dye and run on 1.5% agarose gel with 0.5X TBE buffer for 30 min at 80V. The gel was stained with ethidium bromide solution and visualized under UV‐light. All the apparatus such as gel rig, comb, mould, staining and destaining boxes were presoaked in 1% SDS to denature protein and rinsed twice with sterile distilled water before use. Degraded RNA produces a smear on gel where as the undegraded RNA produces two distinct bands. For highly intact RNA the upper band (28S ribosomal RNA) is more or less two times thicker than the lower band (18S ribosomal RNA). 111 3.2.10 Preparation of cDNA ThermoScript RT‐PCR system (Invitrogen, Carlsbad, CA) was used to prepare cDNA from total RNA according to manufacturer’s instructions. The RNA mixture was prepared by mixing 1.5µg of total RNA with 1µl of 50µM oligo (dT)20 primer and 2µl of 10mM dNTP. The mixture was incubated at 650C for five minutes to denature RNA and primers, and placed immediately onto ice. An 8µl of cDNA synthesis mix (4µl 5X buffer, 1µl DDT (0.1M), 1µl water, 1µ RnaseOUTTM and 1µl ThermoScriptTMRT) was mixed with each of the RNA mixture. The reaction was subjected to 500C for 60 min for cDNA synthesis. The synthesis reaction was stopped by incubating at 850C for five minutes. RNA present in the sample was removed by treating the mixture with 1µl Rnase H at 37oC for 20 minutes. 3.2.11 Quantitative PCR Expression of defense genes was quantified by using a real‐time PCR assay. Real‐
time PCR was performed in an iQ5 cycler (Bio‐Rad, Hercules, CA) using 20 µl reaction mixtures containing 10 µl 2X iQ SYBR Green (Quanta biosciences, Gaithersburg, MD) 8 µl nuclease free water, 0.5 µl forward primer(50 µM), 0.5 µl reverse primer(50 µM) and 1 µl cDNA. Reaction mixture without cDNA was used as negative control. Amplification conditions were set for initial denaturation at 95oC for 3 min, followed by 40 cycles of 950C for 10 s and 58oC for 45 s, with final extension of 72oC for 45 s. To obtain a melting curve temperature profile (Fig, 3.4), the reaction was heated at 95oC after the final 112 extension cycle and cooled to 55oC, and slowly heated to 95oC at 0.5oC every 10 s with continuous measurement of fluorescence at 520 nm. In this study we used the primer sets for extensin (5’ to 3’, forward CACTATGTTTACTCCTCTCCC, reverse TTCGTCTGATCTTCTGTAAG), osmotin‐like protein (5’ to 3’, forward TTGGTGCCAGACCG, reverse AGTACTTGTTGGATCGTC) and expansin (5’ to 3’, forward GTATCGTCCCTGTATCTTTTCG, reverse CCTACTCACCCCTTTTATGCC ) genes developed by Alfano et al. (2007). As these primer sets were developed for conventional PCR we confirmed that these primers do not form primer dimers and non‐specific binding by determining the melting curve temperature profile (as described above) before using them for quantitative PCR. 3.2.12 Experimental Design The experimental set up was a completely randomized block design with four blocks and four treatments (including non‐treated control). There were 16 plants in each block, eight of which were grown in T. hamatum 382‐amended (T+) and the remaining 8 in non‐amended (T‐) planting mix. Xanthomonas euvesicatoria 110C was inoculated to half of the Trichoderma‐amended and non‐amended plants in each block during the fifth week after seeding. At this stage there were four treatments in each block as: 1. Plants grown in Trichoderma amended planting mix and inoculated with Xanthomonas: T+X+ 113 2. Plants grown in Trichoderma amended planting mix and not inoculated with Xanthomonas: T+X‐ 3. Plants grown in Trichoderma non amended planting mix and inoculated with Xanthomonas: T‐X+ 4. Plants grown in Trichoderma non amended planting mix and not inoculated with Xanthomonas: T‐X‐ 114 Figure 3.4. Melting curve chart (fluorescence vs temperature). (A) Extensin, (B) Osmotin, and (C) Extensin genes. Only one peak, at the temperature above 800C, rules out primer‐dimers and non‐specific binding by the primer sets. 115 3.3 RESULTS 3.3.1 T. hamatum 382 colonization of plants Fungal colonies resembling Trichoderma sp. were recovered from non‐surface sterilized roots from Trichoderma‐amended (T+) and non‐amended (T‐) planting mixes (Figure 3.5 A‐B). Only the colonies recovered from T+ roots were determined to be T. hamatum 382 by PCR using T. hamatum 382 specific primers. No colonies were recovered from roots (Figure 3.5 C), or stem (Figure 3.5 D) sections of T+ and T‐ plants that were surface sterilized prior to plating. Colonies recovered from non‐surface sterilized stems (Figure 3.5 E) were negative for T. hamatum 382 by PCR. 3.3.2 T. hamatum 382 Population in planting mixes In Experiment I, the mean population of T. hamatum 382 in T. hamatum 382‐
amended planting mix was 1.2 x 106 CFU/g dry wt. of planting mix 1 week after amendment (Figure 3.6). This population was maintained throughout the experiment with little variation among replicates. Non‐amended planting mix was completely free of T. hamatum 382 contamination. Similar results were observed for T. hamatum 382‐
amended and non‐amended planting mix in Experiment II. 3.3.3 Effect of T. hamatum 382 on bacterial leaf spot development In Experiment I, very few leaf spots developed and the numbers of spots were not different among the plants regardless of T. hamatum 382 treatment (data not 116 shown). In Experiment II, disease pressure was higher and water‐soaked spots developed on the ventral surface of leaves of plants inoculated with X. euvesicatoria 110C (T+X+ and T‐X+). No symptoms (leaf spots) developed in plants not inoculated with X. euvesicatoria 110C. Plants grown in T. hamatum 382‐amended planting mix had significantly fewer (P≤0.036) leaf spots than plants grown in non‐amended planting mix at all evaluation dates post‐inoculation during Experiment II (Table 3.2). 117 Figure 3.5: Roots and stem sections of tomato on Trichoderma selective medium. Roots of tomato plants grown on (A)Trichoderma hamatum 382‐amended (T+) and (B) non‐amended (T‐) planting mix without surface sterilization (C) T+ roots after surface sterilization, (D) T‐ stem disc from 15 cm above the soil line without surface sterilization, (E) T+ stem section from 5cm above the soil line without surface sterilization. 118 Log CFU/g dry wt. of planting mix
7
6
5
4
3
Experiment I
2
Experiment II
1
0
1
2
3
4
5
6
7
Weeks after T. hamatum 382 amendment
Figure 3.6: Trichoderma hamatum 382 populations in planting mix amended with T. hamatum 382 spores. Weekly population counts of T. hamatum 382 are expressed as log colony forming units (CFU) per gram dry weight of planting mix. The first population count was done one week after T. hamatum 382 amendment. Number of Leaf Spots Treatment 9 Days PIc
11 Days PI 13 Days PI T+X+a 678.3 a 830.7 a 869.4 a T‐X+b 1102.7 b 1361.3 b 1381.4 b P value P=0.019 P=0.036 P=0.02 F value F=7.33 F=5.53 F=6.29 a
Tomatoes grown in T.hamatum 382‐amended planting mix and inoculated with X. euvesicatoria 110C Tomatoes grown in non‐amended planting mix and inoculated with X. euvesicatoria 110C c Post‐inoculation b
Table 3.2. Numbers of leaf spots produced by Xanthomonas euvesicatoria 110C on tomato plants (Experiment II). Leaf spots were counted 9, 11 and 13 days post‐
inoculation (PI) by X. euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 119 3.3.4 Effect of T. hamatum 382 on plant growth Plants grown on T. hamatum 382‐amended (T+) and non‐amended planting mix (T‐) were not significantly different in dry weight (Table 3.3). Plant
dry wt (g)
Treatment
Experiment I
Experiment II
T+
10.80 a
11.09 a
T-
10.41 a
10.48 a
P value
0.18
0.19
Table 3.3. Dry weight of above ground parts of tomato plants grown in Trichoderma hamatum 382‐amended (T+) and non‐amended (T‐) planting mix. Means followed by the same letter are not significantly different (p‐value < 0.05). 3.3.5 Expression of plant defense genes Expression of extensin, osmotin and expansin is presented in terms of qPCR Ct value. The threshold cycle (Ct) value is the number of cycles at which the fluorescence emission of the PCR amplification can be distinguished from the background (Silvar et al. 2005). The lower the Ct value, the higher the amount of cDNA present in the sample. Expression of all defense genes was monitored prior to X. euvesicatoria 110C inoculation and, after inoculation, prior to symptom development. 120 3.3.5.1 Extensin expression 3.3.5.1.1 Pre‐inoculation of X. euvesicatorai 110C: Differences in extensin expression prior to X. euvesicatoria 110C inoculation were small but statistically significant for plants grown in T. hamatum 382‐amended and non‐amended planting mixes (Figure 3.7). The mean Ct value for extensin expression in plants grown in Trichoderma‐amended planting mix (T+) was higher (31.90) in Experiment I and lower (35.83) in Experiment II than for those grown in non‐amended planting mix (T‐, Ct values 30.83 and 36.39 in the first and second experiments respectively); indicating slight comparative down‐regulation of the gene in Experiment I and up‐regulation in Experiment II by Trichoderma amendment. 3.3.5.1.2 Two days after inoculation of X. euvesicatoria 110C: All X. euvesicatoria 110C plants and non‐inoculated plants grown in T+ medium (T+X+, T+X‐ and T‐X+) had higher amounts of extensin transcripts (lower Ct values) than the uninoculated, non‐amended control (T‐X‐) in both experiments (Figure 3.8 and Figure 3.9). The expression level was not different among these treatments in Experiment I, however, extension gene transcripts were less abundant in non inoculated, amended (T+X‐) plants than in inoculated, non‐amended plants (T‐X+) in Experiment II. Ct values for extensin expression for T+X+, T+X‐, T‐X+ and T‐X‐ were 27.79 and 37.07, 27.60 and 36.88, 28.02 and 37.43, 29.64 and 38.00 in Experiments I and II respectively. 121 3.3.5.1.3 Five days after inoculation of X. euvesicatoria 110C: Extensin was up‐
regulated in inoculated plants [ T+X+ (Ct value 27.11) and T‐X+ (Ct value 28.02)] compared with non‐inoculated plants [T‐X‐ (Ct value 32.4) and T+X‐ (Ct value 31.5)] regardless of amendment with T. hamatum 382 in Experiment I. In Experiment II, the gene was up‐regulated in amended, non‐inoculated [T+X‐ (Ct value 33.77)] and non‐
amended, inoculated [T‐X+ (Ct value 34.21)] plants compared with non‐amended, non‐
inoculated [ T‐X‐ (Ct value 35.61)] control plants. Expression of extensin in amended, inoculated [T+X+ (Ct Value 35.84)] plants was not significantly different from that in control [T‐X‐ (Ct Value 35.61) plants. 3.3.5.1.4 Eight days after inoculation of X. euvesicatoria 110C: Compared with the non‐amended, non‐inoculated control (T‐X‐, Ct value 30.13) none of the treatments (T+X+, Ct value 30.17; T+X‐, Ct value 31.86; and T‐X+, Ct value 29.53) showed up‐
regulation of extensin in Experiment I. Extensin expression was significantly lower in amended, non‐inoculated plants than in other treatments and the non‐treated control. In Experiment II, extensin was up‐regulated in plants inoculated with Xanthomonas (T+X+, Ct value 32.95 and T‐X+, Ct value 32.35) compared with non‐inoculated plants (T+X‐, Ct value 34.5 and T‐X‐, Ct value 33.98). 122 Experiment I
b
36.0
34.0
CT Value
32.0
a
b
a
30.0
T+
28.0
T‐
26.0
a
a
24.0
22.0
Extensin
Osmotin
Expansin
Experiment II
36.0
b
a
a
a
CT Value
34.0
b
32.0
a
30.0
28.0
T+
26.0
T‐
24.0
22.0
Extensin
Osmotin
Expansin
Genes
Figure 3.7. Threshold cycle (Ct) values for extensin, osmotin and expansin genes in tomatoes grown in Trichoderma hamatum 382‐amended (T+) and non‐amended (T‐) planting mix before the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 123 37.0
35.0
33.0
31.0
2 days PI 29.0
27.0
25.0
CT Value
T+X+
37.0
35.0
33.0
31.0
29.0
27.0
25.0
T+X‐
T‐X+
T‐X‐
a
a
b
T+X+
5 days PI b
T+X‐
T‐X+
T‐X‐
CT Value
Treatments
35.0
b
a
a
a
30.0
8 days PI
25.0
T+X+
T+X‐
T‐X+
T‐X‐
Experiments
T+X+: tomatoes grown in T.hamatum 382 amended planting mix and inoculated with X. euvesicatoria 110C T+X‐: tomatoes grown in T.hamatum 382 amended planting mix but not inoculated with X. euvesicatoria 110C T‐X+: tomatoes grown in T.hamatum 382 non‐amended planting mix and inoculated with X. euvesicatoria 110C T‐X‐: tomatoes grown in T. hamatum 382 non‐amended planting mix and not inoculated with X. euvesicatoria 110C Figure 3.8. Extensin expression in Experiment I: Pattern of tomato extensin gene expressed in terms of Threshold Cycle (Ct) values 2, 5 and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 124 CT Value
bc
37.0
35.0
33.0
31.0
29.0
27.0
25.0
2 days PI T+X+
T+X‐
T‐X+
Treatments
a
CT Values
a
b
c
a
b
b
35.0
T‐X‐
30.0
5 days PI
25.0
T+X+
T+X‐
T‐X+
T‐X‐
CT Value
Treatments
35.0
b
a
a
b
30.0
8 days PI
25.0
T+X+
T+X‐
T‐X+
T‐X‐
Treatments
T+X+: tomatoes grown in T.hamatum 382 amended planting mix and inoculated with X. euvesicatoria 110C T+X‐: tomatoes grown in T.hamatum 382 amended planting mix but not inoculated with X. euvesicatoria 110C T‐X+: tomatoes grown in T.hamatum 382 non‐amended planting mix and inoculated with X. euvesicatoria 110C T‐X‐: tomatoes grown in T. hamatum 382 non‐amended planting mix and not inoculated with X. euvesicatoria 110C Figure 3.9. Extensin expression in Experiment II: Pattern of tomato extensin gene expressed in terms of Threshold Cycle (Ct) values on 2, 5 and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 125 3.3.5.2 Osmotin expression 3.3.5.2.1 Pre‐inoculation by X. euvesicatoria 110C: Although the differences were small, osmotin transcripts were less abundant in plants grown in Trichoderma‐
amended planting mix (T+, Ct value 36.28) before X. euvesicatoria 110C inoculation, than those grown in non‐amended planting mix (T‐, Ct value 35.65) in Experiment I (Figure 3.7). The transcript amounts were not significantly different among plants grown in Trichoderma‐amended (T+, Ct value 36.32) and non‐amended mixes (T‐, Ct value36.20) in Experiment II. 3.3.5.2.2 Two days after inoculation of X. euvesicatoria 110C: Expression of osmotin was not affected by any of the treatments applied in either experiment (Figure 3.10 and Figure 3.11). Ct values for T+X+, T+X‐, T‐X+ and T‐X‐ were 36.17 and 36.36, 36.52 and 36.52, 36.77 and 36.77, and 36.44 and 36.37 in the first and second experiments respectively. 3.3.5.2.3 Five days after inoculation of X. euvesicatoria 110C: Osmotin was up‐
regulated in plants by the inoculation of X. euvesicatoria 110C. Xanthomonas inoculated plants (T+X+, and T‐X+) had higher amounts of osmotin transcript than the plants that were not inoculated with Xanthomonas (T+X‐ and T‐X‐), in both experiments. Expression of osmotin was not affected by Trichoderma amendment of the planting mix in either experiment. Ct values for T+X+, T+X‐, T‐X+ and T‐X‐ were 31.36 and 30.48, 34.84 and 126 34.25, 31.37 and 30.22, and 34.04 and34.38 in the first and second experiments respectively. 3.3.5.2.4 Eight days after inoculation of X. euvesicatoria 110C: The expression pattern of the osmotin gene at 8 days of Xanthomonas inoculation remained similar to the expression pattern at 5 days. Plants inoculated with Xanthomonas (T+X+, and T‐X+) had higher amounts of the osmotin gene expressed than in non‐inoculated plants (T+X‐ and T‐X‐). Trichoderma amendment did not have any effect on osmotin gene expression in Experiment II. In Experiment I, Trichoderma did not have any effect in absence of Xanthomonas (T‐X‐ and T+X‐), however, expression of osmotin was comparatively down‐regulated by Trichoderma in presence of Xanthomonas (T+X+ and T+X‐). Ct values for T+X+, T+X‐, T‐X+ and T‐X‐ were 35.50 and 35.48, 36.71 and 36.71, 35.1 and 35.08, and 37.13 and 37.12 in the first and second experiments respectively. 127 CT Value
37.0
a
a
a
a
35.0
33.0
31.0
2 days PI
29.0
T+X+
T+X‐
T‐X+
T‐X‐
Treatments
CT Value
37.0
a
35.0
33.0
a
b
b
31.0
5 days PI
29.0
T+X+
T+X‐
T‐X+
T‐X‐
Treatments
CT Value
37.0
a
a
b
c
35.0
33.0
31.0
8 days PI
29.0
T+X+
T+X‐
T‐X+
T‐X‐
Treatments
T+X+: tomatoes grown in T.hamatum 382 amended planting mix and inoculated with X. euvesicatoria 110C T+X‐: tomatoes grown in T.hamatum 382 amended planting mix but not inoculated with X. euvesicatoria 110C T‐X+: tomatoes grown in T.hamatum 382 non‐amended planting mix and inoculated with X. euvesicatoria 110C T‐X‐: tomatoes grown in T. hamatum 382 non‐amended planting mix and not inoculated with X. euvesicatoria 110C Figure 3.10. Osmotin expression in Experiment I: Pattern of tomato osmotin gene expressed in terms of Threshold Cycle (Ct) values 2, 5 and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 128 CT Value
37.0
a
a
a
a
35.0
33.0
31.0
2 days PI 29.0
T+X+
T+X‐
T‐X+
T‐X‐
Treatments
CT Value
37.0
a
a
35.0
33.0
31.0
b
b
5 days PI
29.0
T+X+
T+X‐
T‐X+
T‐X‐
Treatments
CT Value
37.0
a
a
b
b
35.0
33.0
8 days PI
31.0
29.0
T+X+
T+X‐
T‐X+
T‐X‐
Treatments
T+X+: tomatoes grown in T.hamatum 382 amended planting mix and inoculated with X. euvesicatoria 110C T+X‐: tomatoes grown in T.hamatum 382 amended planting mix but not inoculated with X. euvesicatoria 110C T‐X+: tomatoes grown in T.hamatum 382 non‐amended planting mix and inoculated with X. euvesicatoria 110C T‐X‐: tomatoes grown in T. hamatum 382 non‐amended planting mix and not inoculated with X. euvesicatoria 110C Figure 3.11: Osmotin expression in Experiment II: Pattern of tomato osmotin gene expressed in terms of Threshold Cycle (Ct) values 2, 5, and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 129 3.3.5.3 Expansin expression 3.3.5.3.1 Pre‐inoculation of X. euvesicatoria 110C: Before the inoculation of Xanthomonas, expression of expansin was not affected by amendment of planting mix with Trichoderma in Experiment I. Ct values for T+ and T‐ plants were 24.92 and 24.77 respectively. In Experiment II, expression of osmotin was lower in the plants grown in Trichoderma amended planting mix (T+, Ct value 31.62) compared to those grown in non‐amended planting mix (T‐, Ct value 30.81). 3.3.5.3.2 Two days after X. euvesicatoria 110C inoculation: Similar patterns of expansin gene expression were found in Experiments I and II (Figure 3.12, Figure 3.13). Expansin was down regulated among Xanthomonas‐treated plants (T+X+ and T‐X+) compared with the plants that were not inoculated with Xanthomonas (T+X‐ and T‐X‐). There was no effect of Trichoderma amendment of planting mix on expansin gene expression. 3.3.5.3.3 Five days after X. euvesicatoria 110C inoculation: In Experiment I, expansin was down regulated by Trichoderma either in the presence (T+X+, Ct value 26.79) or absence (T+X‐, Ct value 27.41) of Xanthomonas compared with the non‐
treated control (T‐X‐, Ct value 24.97). Expression of expansin was not different in non‐
amended, inoculated (T‐X+) plants than in the non‐amended, non‐inoculated control (T‐
X‐) and amended, inoculated (T+X+) plants. In Experiment II, all treatments (T+X+, Ct value 28.40; T+X‐, Ct value 28.55 and T‐X+, Ct value 27.92) resulted in down‐regulation 130 of the expansin gene compared with the non‐treated control (T‐X‐, Ct value 26.88). There were no differences among the treatments (T+X+, T+X‐ and T‐X+). 3.3.5.3.4 Eight days after X. euvesicatoria 110C inoculation: Expression patterns of expansin gene expression among the treatments were the same in both experiments. Expansin was down regulated in T. hamatum 382‐amended, and inoculated (T+X+) plants compared with amended, non‐inoculated (T+X‐ ), and non‐amended, inoculated or non‐inoculated ( T‐X+ and T‐X‐ )plants. The expression level of was not different among these plants. 131 CT Value
28.5
27.5
26.5
25.5
24.5
23.5
22.5
b
b
a
a
2 days PI
T+X+
T+X‐
T‐X+
T‐X‐
CT Value
Treatments
28.5
27.5
26.5
25.5
24.5
23.5
22.5
bc
c
ab
a
5 days PI
T+X+
T+X‐
T‐X+
T‐X‐
CT Value
Treatments
28.5
27.5
26.5
25.5
24.5
23.5
22.5
b
T+X+
a
a
a
T+X‐
T‐X+
T‐X‐
8 days PI
Treatments
T+X+: tomatoes grown in T.hamatum 382 amended planting mix and inoculated with X. euvesicatoria 110C T+X‐: tomatoes grown in T.hamatum 382 amended planting mix but not inoculated with X. euvesicatoria 110C T‐X+: tomatoes grown in T.hamatum 382 non‐amended planting mix and inoculated with X. euvesicatoria 110C T‐X‐: tomatoes grown in T. hamatum 382 non‐amended planting mix and not inoculated with X. euvesicatoria 110C Figure 3.12. Expansin expression in Experiment I: Pattern of tomato expansin gene expressed in terms of Threshold Cycle (Ct) values 2, 5, and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 132 CT Value
28.5
27.5
26.5
25.5
24.5
23.5
22.5
b
b
a
a
2 days PI
T+X+
T+X‐
T‐X+
T‐X‐
Treatments
CT Value
28.5
b
b
b
a
26.5
24.5
5 days PI
22.5
T+X+
T+X‐
T‐X+
T‐X‐
CT Value
Treatments
28.5
27.5
26.5
25.5
24.5
23.5
22.5
b
a
a
a
8 days PI
T+X+
T+X‐
T‐X+
T‐X‐
Treatments
T+X+: tomatoes grown in T.hamatum 382 amended planting mix and inoculated with X. euvesicatoria 110C T+X‐: tomatoes grown in T.hamatum 382 amended planting mix but not inoculated with X. euvesicatoria 110C T‐X+: tomatoes grown in T.hamatum 382 non‐amended planting mix and inoculated with X. euvesicatoria 110C T‐X‐: tomatoes grown in T. hamatum 382 non‐amended planting mix and not inoculated with X. euvesicatoria 110C Figure 3.13: Expansin expression in Experiment II: Pattern of tomato expansin gene expressed in terms of Threshold Cycle (Ct) values 2, 5, and 8 days after the plants were inoculated with Xanthomonas euvesicatoria 110C. Means followed by the same letter are not significantly different (p‐value < 0.05). 133 3.4 DISCUSSION Trichoderma spp. are widely studied for their ability to suppress plant diseases as potential bio‐control agents (Harman et al., 2004). Besides directly antagonizing pathogens by mycoparasitism, and antibiosis and competing for ecological niches they also induce systemic or localized resistance in plants. In such responses, Trichoderma acts as an elicitor of defense reactions and regulates the expression of plant defense genes (Shoresh et al., 2006; Shoresh et al., 2005). Though the exact mechanism of regulation of defense genes is not clear several researchers believe that Trichoderma primes the host plant for effective regulation of these genes (Van Wees et al., 2008; Conrath et al. 2006; Mur et al. 1996). In this study we evaluated the efficacy of T. hamatum 382 to reduce the severity of bacterial spot disease caused by Xanthomonas euvesicatoria 110C in tomato seedlings. We also examined the effect of T. hamatum 382 and X. euvesicatoria on the expression of the defense genes extensin, osmotin and expansin in tomato leaves. The severity of bacterial leaf spot was very low and T. hamatum 382 amendment did not affect disease severity in Experiment I. This might have been due to low humidity inside the greenhouse. At low humidity bacterial leaf spot is not manifested even though the pathogen is already present on plant surfaces (Pfleger and Gould, 2009). Hence plants were misted for four days after X. euvesicatoria 110C inoculation in Experiment II, which resulted in increased disease pressure. The disease severity in this experiment was lower among plants grown in T. hamatum 382‐amended planting mix 134 than among those grown in non‐amended mix, which is in agreement with previous findings (Alfano et al., 2007; Horst et al., 2005; Al‐Dahmani, et al., 2005). The population of T. hamatum 382 was maintained well above 1x105 CFU/g dry wt. of planting mix throughout the experiment. Non‐amended planting mix was completely free of T. hamatum 382 colonization. Further, T. hamatum 382 was not recovered from shoots of tomato plants grown on T. hamatum 382‐amended planting mix. These findings suggest that the leaf spot disease was suppressed due to the systemic induction of disease resistance by T. hamatum 382 growing on plant roots. We consistently recovered T. hamatum 382 from non‐surface‐sterilized roots but failed to recover the fungus from surface‐sterilized roots. This suggests that T. hamatum 382 colonized the outer surface of roots, which contradicts the finding of Yedidia et al (1999) where T. harziamum colonized the root epidermis and outer cortical layer of cucumber plants to induce systemic resistance. Biocontrol agents that colonize plant roots to induce resistance are associated with enhanced plant growth (Kannan and Sureendar, 2009; Bloemberg and Lugtenberg, 2001; Dobbelaere et al., 2003). Several Trichoderma spp. involved in biocontrol are also found to have similar impacts on plant growth (Shoresh and Harman, 2008; Harman, 2006). In this study no changes in plant weight were detected among plants produced in T. hamatum 382‐amended planting mix. This result is in agreement with previous studies where T. hamatum 382 protected plants from diseases without affecting plant growth (Alfano et al., 2007; Khan et al., 2004; Krause, et al., 2003). Varying results 135 concerning Trichoderma activity on plant growth may be due to differences in gene expression in the plants. Trichoderma harzianum T22 enhanced plant growth by up‐
regulating carbohydrate metabolism and photosynthesis related genes (Shoresh and Harman, 2008). Likewise, T. hamatum 382 did not affect plant growth as it did not activate metabolism and photosynthesis related genes. (Alfano et al., 2007). To reveal the expression pattern of the defense genes extensin, osmotin and expansin, we examined mRNA levels of these proteins in tomato leaves before and after the inoculation of tomato plants with X. euvesicatoria 110C. These genes were shown previously to be involved in T. hamatum 382‐mediated disease resistance (Alfano et al., 2007). In this study extensin and osmotin were up‐regulated, and expansin was down‐
regulated in 5‐week‐old tomato plants grown in T. hamatum 382‐amended planting mix (Alfano et al., 2007). In this study no consistent changes in expression of these genes were observed in tomato leaves regardless of T. hamatum 382 treatment before X. euvesicatoria 110C inoculation. Shoresh and Harman (2008) noticed that defense genes were activated by T. harzianum T22 in shoots of maize, 5 days after T. harzianum T22 application. Similarly T. asperellum T230 up‐regulated the defense genes hydroxyperoxide lyase (HPL) and phenylalanine ammonia lyase (PAL) in cucumber leaves. These genes were expressed to the highest level at 24 and 48 hours respectively after T. asperellum T230 application (Yedidia et al., 2003). Expression of mitogen‐
activated protein kinase (MAPK) was up‐regulated by T. asperellum in cucumber leaves at 24 hours post inoculation, but the expression level of the gene returned to normal 136 (similar to the non‐treated control) thereafter (Shoresh et al., 2006). These studies show that Trichoderma activates defense genes within a few days of its application. However, in agreement with our observation, there are several studies that showed that root‐ colonizing beneficial micro‐organisms and inducers of SAR or ISR do not cause significant activation of defense genes before pathogen attack (Mur et al., 1996; Pieterse et al., 2002; Kochler et al., 2002; Herman et al. 2008). After X. euvesicatoria 110C inoculation, expression of expansin was up‐regulated by both T. hamatum 382 and X. euvesicatoria 110C compared to the non‐treated, non‐
inoculated control at 2 days post inoculation (dpi) of X. euvesicatoria 110C. T+X+ plants did not differ from T+X‐ plants at this point. There was no consistent regulation of this gene in any treatment thereafter. In a previous study, the defense gene phenylalanine ammonia lyase was up‐regulated 70‐fold in cucumber plants treated with T. asperellum 24 hour after pathogen challenge. Expression of the gene was reduced subsequently (Yedidia et al., 2003). We did not monitor gene expression at 1 day post inoculation (dpi) of X. euvesicatoria 110C. Hence it is possible that extensin was up‐regulated in T. hamatum 382‐treated plants (T+X+) compared to non‐treated plants (T‐X+) around 1 dpi, or the tomato plants were not primed by T. hamatum 382 for extensin expression. Osmotin, a member of the PR‐5 protein family, is expressed in plants after pathogen attack or by the application of SAR inducers (Ryals et al., 1996; Uknes et al., 1992). In our study, osmotin was consistently up‐regulated by X. euvesicatoria 110C 5 and 8 days after X. euvesicatoria 110C inoculation. Plants grown in T. hamatum 382‐
137 amended planting mix did not have higher expression of the gene compared to those grown in non‐amended planting mix after X. euvesicatorai 110C inoculation. Similar results were observed by Shoresh and Harman (2008), where T. harzianum T22 did not affect the expression of PR‐proteins in maize plants. Contrary to our result, pre‐
inoculation of plants with T. asperellum T203 increased the expression of PR genes after pathogen inoculation (Shoresh et al., 2005). This shows that unlike T. asperellum 203, T. hamatum 382 does not prime plants for activation of osmotin, a marker of SAR, after pathogen challenge. Expression of expansin, which weakens cell walls by moving microfibrils apart, was not affected by T. hamatum 382 amendment 2 dpi by X. euvesicatoria 110C; however, the gene was down‐regulated at this time point in plants inoculated with X. euvesicatoria 110C. Eight days after pathogen challenge, expansin was highly down regulated in plants grown in T. hamatum 382‐amended planting mix compared to those grown in non‐amended planting mix. This result is in agreement with several previous studies where pre‐inoculation of plants with biocontrol agents modulated the expression of defense genes following pathogen attack. Defense genes hydroxyperoxide lyase (HPL) and phenylalanine ammonia lyase (PAL) were activated to the highest level in leaves of Trichoderma pre‐treated plants compared to those of non‐treated plants after pathogen inoculation (Yedidia et al., 2003). Tomatoes pre‐treated with plant growth‐promoting rhizobacteria (PGPR) were primed to express Pin2, a wound‐induced signaling component, after an attack of leaf spot pathogens (Herman et al., 2008). 138 To summarize, colonization of roots by T. hamatum 382 protected tomato plants from bacterial leaf spot disease without affecting the growth of the plants. Defense genes extensin, osmotin, and expansin were not consistently activated in tomato leaves by T. hamatum 382 before X. euvesicatoria 110C inoculation. After X. euvesicatoria 110C inoculation, extensin was up‐regulated by both T. hamatum 382 and X. euvesicatoria 110C. Osmotin was up‐regulated only by X. euvesicatoria 110C. T. hamatum 382 had no impact on osmotin expression. Expansin was initially down‐regulated by X. euvesicatoria 110C regardless of T. hamatum 382 treatment; however, expression of the gene remained low over time only in X. euvesicatoria 110C inoculated, T. hamatum 382‐
amended (T+X+) plants. This suggests that the protection provided by T. hamatum 382 was through priming tomato plants to down‐regulate expansin gene expression upon pathogen attack. T. hamatum 382 had no effect on expression of the PR protein osmotin. This implies that the resistance induced by T. hamatum 382 may be different from SAR. 139 3.5 REFERENCES Abad, L. R., D’Urzo, M. P., Narasimha, M. L., Reuveni, M., Zhu, J. K., Niu, X., Singh, N. K., Hasegawa, P. M., and Bressan, R. A. 1996. Antifungal activity of tobacco osmotin has specificity and involves plasma membrane permeabilization. Plant Sci. 118: 11‐23. Al‐Dahmani, J. H., Abbasi, P. A., Sahin, F., Hoitink, H. A. J., and Miller, S. A. 2005. Reduction of bacterial leaf spot severity on radish, lettuce, and tomato plants grown in compost‐amended planting mixes. Can. J. Plant Pathol. 27:186‐193. Alfano, G., Lewis Ivey, M. L., Cakir, C., Bos, J. I. B., Miller, S. A., Madden, L. V., Kamoun, S., and Hoitink, H. A. J. 2007. Systemic modulation of gene expression in tomato by Trichoderma hamatum 382. Phytopathology 97: 429‐437. Anzlovar, S., and dermastia, M. 2003. The comparative analysis of omsotins and osmotin‐like PR‐5 proteins. Plant biol. 5: 116‐124. Belfield, E. J., Ruperti, B., Roberts, J. A., and McQueen‐Mason, S. 2005. Changes in expansin activity and gene expression during ethylene‐promoted leaflet abscission in Sambucus nigra. J. Exp. Bot. 56: 817‐823. Benhamou, N., Kloepper, J. W., Quadt‐Hallman, A., and Tuzun, S. 1996. Induction of defense‐related ultrastructural modification in pea root tissues inoculated with endophytic bacteria. Plant Physol. 112: 919‐929. Bloemberg, G. V., and B. J. J. Lugtenberg. 2001. Molecular basis of plant growth promotion and biocontrol by rhizobacteria. Curr. Opin. Plant Biol. 4: 343‐350 Brotman, Y., Briff, E., Viterbo, A., and Chet, I. 2008. Role of swollenin, an expansin‐like protein from Trichoderma, in plant root colonization. Plant Physiol. 147: 779‐89. Brummell, D. A., Harpster, M. H., and Dunsmuir, P. 1999. Differential expression of expansin gene family members during growth and ripening of tomato fruit. Plant Mol. Biol. 39: 161‐169. Chet, I., and Inbar, J. 1994. Biological control of fungal pathogens. Appl. Biochem. and Biotech. 48: 37‐43. Cho, H. T., and Kende, H. 1998. Expansins and internodal growth of deepwater rice. Plant Physiol. 113: 1145‐1151. 140 Chung, Y. R., and Hoitink, H. A. J. 1990. Interactions between thermophilic fungi and Trichoderma hamatum in suppression of Rhizoctonia damping‐off in bark compost‐
amended container medium. Phytopathology 80: 73‐77. Cordier, C., Pozo, M. J., Barea, J. M., Gianinazzi, S., and Gianinazzi‐Pearson, V. 1998. Cell defense responses associated with localized and systemic resistance to Phytophthora induced in tomato by an arbuscular mycorrhizal fungus. Mol. Plant‐Microbe Interact. 11: 1017‐1028. Cosgrove, D. J. 2000. Loosening of plant cell walls by expansins. Nature 407: 321‐326. Cosgrove, D. J., Li, L.‐C., Cho, H. T., Hoffmann‐Benning, S., Moore, R. C., and Blecker, D. 2002. The growing world of expansins. Plant & Cell Physiology 43: 1236‐1244. Djonovic, S., Vittone, G., Mendoza‐Herrera, A., and Kenerley, C. M. 2007. Enhanced biocontrol activity of Trichoderma virens transformants constitutively coexpressing β‐
1,3‐ and β‐1,6‐ glucanase genes. Mol. Plant pthol. 8:469‐480. Dobbelaere, S., J. Vanderleyden, and Y. Okon. 2003. Plant growth‐promoting effects of diazotrophs in the rhizosphere. Crit. Rev. Plant Sci. 22: 107‐149 Elad, Y. 1996. Mechanisms involved in the biocontrol of Botrytis cinerea incited disease. Eur. J. Plant Pathol. 102: 719‐732. Gallou, A., Cranenbrouck, S., and Declerck, S. 2009. Trichoderma harzianum elicits defence response genes in roots of potato plantlets challenged by Rhizoctonia solani. Eur. J. Plant Pathol. 124: 219‐230. Glazebrook, J. 2005. Constrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 43: 205‐227. Harman, G. E. 2006. Overview of mechanisms and uses of Trichoderma spp.. Phytopathology 96:190‐194. Harman, G. E., Howell, C. R., Viterbo, A., Chet, I., and Lorito, M. 2004. Trichoderma species‐opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2:43‐56. Herman, M. A. B., Davidson, J. K., and Smart, C. D. 2008. Induction of plant defense gene expression by plant activators and Pseudomonas syringae pv. tomato in greenhouse‐
grown tomatoes. Phytopathology 98:1226‐1232. Hoagland, D. R., and Arnon, D. I. 1950. The water culture method for growing plants without soil. In: Circular 347. California Agricultural Experiment Station, College of Agriculture, University of California,Berkeley. 141 Inbar, J., Abramsky, M., Cohen, D., and Chet, I. 1994. Plant growth enhancement and disease control by Trichoderma harzianum in vegetable seedlings grown under commercial conditions. Eur. J. Plant Pathol. 100: 337‐346. Kannan, V., and Surrendar, R. 2009. Synergistic effect of beneficial rhizosphere microflora in biocontrol and plant growth promotion. Journal of Basic Microbiology 49: 158‐164. Kerff, F., Amoroso, A., Herman, R., Sauvage, E., Petrella, S., Filée, P., Charlier, P., Joris, B., Tabuchi, A., Nikolaidis, N., and Cosgrove, D. J. 2008. Crystal structure and activity of Bacillus subtilis YoaJ (EXLX1), a bacterial expansin that promotes root colonization. Proc Natl Acad Sci U S A. 105: 16876‐81. Khan, J., Olka, J. J., Miller, S. A., Madden, L. V., and Hoitink, H. A. J. 2004. Systemic resistance induced by Trichoderma hamatum 382 in cucumber against Phytophthora crown rot and leaf blight. Plant Dis. 88: 280‐286. Kim, H., Mun, J. H., Byun, B. H., hwang, H. J., Kwon, Y. M., and Kim, S. G. 2002. Molecular cloning and characterization of the gene encoding osmotin protein in Petunia hybrid. Plant Science 162: 745‐752. Kochler, A., Schwinding, S., and Conrath, U. 2002. Benzothiadiazole‐induced priming for potentiated response to pathogen infection, wounding and infiltration of water into leaves requires the NPR1/NIM1 gene in Arabidopsis. Plant Physiol. 128: 1046‐1056. Krause, M. S., De Ceuster, T. J. J., Tiquia, S. M., Michel, F. C., Jr., Madden, L. V., and Hoitink, H. A. J. 2003. Isolation and characterization of rhizobacteria from compost that suppress the severity of bacterial leaf spot of radish. Phytopathology 93:1292‐1300. LaRosa, P. C., Chen, Z., Nelson, D. E., Singh, N. K., Hasegawa, P. M., and Bresssa, R. A. 1992. Osmotin gene expression is post transcriptionally regulated. Plant Physiol. 100: 409‐415. Li, Z. –C., Durachko, and D. M., Cosgrove, D. J. 1993. An oat coleoptile wall protein that induces wall extension in vitro and that is antigenically related to a similar protein from cucumber hypocotyls. Planta 191: 349‐356. McQueen‐Mason, S., Durachko, D. M., and Cosgrove, D. J. 1992. Two endogenous proteins that induce cell wall expansion in plants. Plant Cell 4: 1425‐1433. Meera, M. S., Shivannan, M. B., Kageyama, K., and Hyakumachi, M. 1994. Plant growth promoting fungi from Zoysiagrass rhizosphere as potential inducers of systemic resistance in cucumber. Phtopathology 84: 1399‐1406. 142 Mur, L. A. J., Naylor, G., Warner, S. A. J., Sugars, J. M., White, R. F., and Draper, J. 1996. Salicylic acid potentiates defense gene expression in tissue exhibiting acquired resistance to pathogen attack. Plant Journal 9: 559‐571. Nava‐Diaz, C. 2006. Role of plant growth promoting Rhizobacteria in integrated disease management and productivity of tomato. Ph. D. thesis. The Ohio State University. pp 153‐184. Newton, S. S. and Duman, J.G. 2000. An osmotin‐like cryoprotective protein from the bittersweet nightshade Solanum dulcamara. Plant Mol. Biol. 44: 581‐589. Obradovic, A., Mavridis, A., Rudolph, K., Janse, J. D., Arsenijevic, M., Jones, J. B., Minsavages, G. V., and Wang, J. 2004. Characterization and PCR‐based typing of Xanthomonas campestris pv. Vesicatoria from peppers and tomatoes in Serbia. European Journal of Plant Pathology 110: 285‐292. Pal, K. K. and B. McSpadden Gardener, 2006. Biological Control of Plant Pathogens. The Plant Health Instructor DOI: 10.1094/PHI‐A‐2006‐1117‐02. Pieterse, C. M. J., van Wees, S. C. M., Hoffland, E., van Pelt, J. A., and van Loon, L. C. 1996. Systemic resistance in Arabidopsis induced by biocontrol bacteria is independent of salicylic acid accumulation and pathogenesis related gene expression. Plant Cell 8: 1225‐1237. Pieterse, C. M. J., Van Wees, S. C. M., Van Pelt, J. A., Knoester, M., Laan, R., Gerrits, H., Weisbeek, P. J., and Van Loon, L. C. 1998. A novel signaling pathway controlling induced systemic resistance in Arabidopsis. Plant Cell 10:1571‐1580. Pozo, M. J., Cordier, C., Dumas‐Gaudot, E., Gianinazzi, S., Barea, J. M., and Azcon‐
Aguilar, C. 2002. Localized vs. systemic effect of arbuscular mycorrhizal fungi on defense responses to Phytophthora infection in tomato plants. J. Exp. Bot. 53: 525‐534. Qin, L., Kudla, U., Roze, E. H., Goverse, A., Popeijus, H., Nieuwland, J., Overmars, H., Jones, J. T., Schots, A., Smant, G., Bakker, J., Helder, J. 2004. Plant degradation: A nematode expansin acting on plants. Nature 427: 30. Ryals, J. A., Neuenschwander, U. H., Willits, M. G., Molina, A., Steiner, H. Y., and Hunt, M. D. 1996. Systemic acquired resistance. Plant Cell 8: 1809–19. Sampedro, J., and Cosgrove, D. J. 2005. The expansin superfamily. Genome Biol. 6:242. Shoresh, M., and Harman, E. 2008. The molecular basis of shoot responses of maize seedlings to Trichoderma harzianum T22 inoculation of the root: A proteomic approach. Plant Physiology 147: 2147‐2163. 143 Shoresh, M., Yedida, I., and Chet, I. 2005. Involvement of jasmonic acid/ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T‐203. Phytopathology 95:76‐84. Silvar, C., Diaz, J., and Merino, F. 2005. Real‐time polymerase chain reaction quantification of phytophthora capsici in different pepper genotypes. Phytopathology 95: 1423‐1429. Song, W. G., Li, B. J., Ye, Z. H., Zhao, Z. H., and Shi, Y. X. 2008. Concentration prediction of pesticides with different transformation fate in agricultural soil environment. J. Agro‐
Environ. Sci. 27: 1574‐1581. Sticcher, L., Mauch‐Mani, B., and Metraux, J. P. 1997. Systemic acquired resistance. Annu. Rev. Phytopathol. 35:235‐270. Tuite, J. 1969. Plant pathological methods fungi and bacteria. Burgess publishing company. pp 183‐184. Uknes, S., Mauch‐Mani, B., Moyer, M., Potter, S., Williams, S., and Dicher, S. 1992. Acquired resistance in Arabidopsis. Plant Cell 4: 645–56. Van Wees, S. C. M., Van der Ent, S., and Pieterse, C. M. J. 2008. Plant immune responses triggered by beneficial microbes. Current Opinion in Plant Biology 11: 443‐448. Wieczorek, K., Golecki, B., Gerdes, L., Heinen, P., Szakasits, D., Durachko, D. M., Cosgrove, D. J., Kreil, D. P., Puzio, P. S., Bohlmann, H., and Grundler, F. M. 2006. Expansins are involved in the formation of nematode‐induced syncytia in roots of Arabidopsis thaliana. Plant J. 48: 98‐112. Wilson, P. S., Ketola, E. O., Ahvenniemi, P. M., Lehtonen, M. J., and Valkonen, J. P. T. 2008. Dynamics of soilborne Rhizoctonia solani in the presence of Trichoderma harziamun: effects on stem canker, black scurf and progeny tubers. Plant Pathol. 57: 152‐161. Yedida, I., Benhamou, N., Kapulenik, Y., and Chet, I. 2000. Induction and accumulation of PR proteins activity during early stages of root colonization by the mycoparasite Trichoderma harzianum strain T‐203. Plant Physiol. Biochem. 38:863‐873. Yedidia, I., Shoresh, M., Kerem, Z., Benhamon, N., Kapulnik, Y., and Chet, I. 2003. Concomitant induction of systemic resistance to Pseudomonas syringae Pv. Lachrymans in cucumber by Trichoderma asperelleum (T‐203) and accumulation of phytoalexins. Appl. Environ. Microbiol. 69:7343‐7353. 144 BIBLIOGRAPHY Abad, L. R., D’Urzo, M. P., Narasimha, M. L., Reuveni, M., Zhu, J. K., Niu, X., Singh, N. K., Hasegawa, P. M., and Bressan, R. A. 1996. Antifungal activity of tobacco osmotin has specificity and involves plasma membrane permeabilization. Plant Sci. 118: 11‐23. Abbasi, A. P., Miller, S. A., Meulia, T., Hoitink, H. A. J., and Kim, J. M. 1999. Precise detection and tracing of Trichoderma hamatum 382 in compost‐amended planting mixes by using molecular markers. Appl. Abbasi, P. A., Al‐Dahmani, J., Sahin, F., Hoitink, H. A. J., and Miller, S. A. 2002. Effect of compost amendments on disease severity and yield of tomato in organic and conventional production systems. Plant Dis. 86: 156‐161. Acquaah, G. 2002. Horticulture: Principles and Practices. New Jersey: Prentice Hall. Agrios, G. N. 1997. Plant Pathology. Hardcourt Academic Press. 635 pp. Ahn, J. H., Choi, Y., Kwon, Y. M., Kim, S. G., Choi, Y. D., and Lee, J. S. 1996. A novel extensin gene encoding a hydroxyproline‐rich glycoprotein requires sucrose for its wound‐inducible expression in transgenic plants. Plant Cell 8:1477‐1490. Al‐Dahmani, J. H., Abbasi, P. A., Miller, S. A., and Hoitink, H. A. J. 2003. Suppression of bacterial spot of tomato with foliar sprays of compost extracts under greenhouse and field conditions.Plant Dis. 87:913‐919. Al‐Dahmani, J. H., Abbasi, P. A., Sahin, F., Hoitink, H. A. J., and Miller, S. A. 2005. Reduction of bacterial leaf spot severity on radish, lettuce, and tomato plants grown in compost‐amended planting mixes. Can. J. Plant Pathol. 27:186‐193. Alexopoulos, C. J., Mims, C. W, and Blackwell, W. 1996. Introductory Mycology. 4th Edition. Wiley, New York. Alfano, G., Lewis Ivey, M. L., Cakir, C., Bos, J. I. B., Miller, S. A., Madden, L. V., Kamoun, S., and Hoitink, H. A. J. 2007. Systemic modulation of gene expression in tomato by Trichoderma hamatum 382. Phytopathology 97: 429‐437. 147 Anonymous. 2000. Hybrid round red tomato. Siegers Seed Company, http://www.siegers.com/shop/kind.asp?kind_id=TM7#940081 Anonymous. Lycopersicon – Garden Apple, Gold Apple, Love Apple, Pomo D’oro, Tomato. http://www.botany.com/lycopersicon.html Anzlovar, S. 2002. Analysis of gene for PR‐5 protein from flax. Ph.D. Thesis, Ljubljana, pp. 1‐143. Anzlovar, S., and dermastia, M. 2003. The comparative analysis of omsotins and osmotin‐like PR‐5 proteins. Plant biol. 5: 116‐124. Balestrini, R., Cosgrove, D. J., and Bonfante, P. 2005. Differential location of α‐expansin proteins during the accommodation of root cells to an arbuscular mycorrhizal fungus. Planta 220: 889‐899. Barre, A., and Rouge, P. 2002. Homology modeling of the cellulose‐binding domain of a pollen allergen from rye grass: structural basis for the cellulose recognition and associated allergenic properties. Biochemical and Biophysical Research Communications 296: 1346‐1351. Bashan, Y. 1982. Bacterial diseases of tomato and pepper. Phytoparasitica 2(10):122. Basim, J. B., Jones, G., Minsavage, V., and Dickstein, E. R. 2004. Bacterial spot of tomato and pepper caused by Xanthomonas axonopodis pv. vesicatoria in the Western Mediterranean region of Turkey. Plant Disease 88 (1): 85. Baysal‐Gurel, F. and Miller, S. A. 2008. Efficacy of biopesticides and fungicides against pre‐ and post‐emergence damping off of vegetable seedlings by Pythium aphanidermatum. (Abstr.) Phytopathology 98:S19. Baysal‐Gurel, F., Mera, J. R., and Miller, S. A. 2007 Effects of Muscodor, serenade and conventional fungicide on rhizoctionia root and hypocotyl rot and clubroot of radish. (Abstr.) Phytopathology 97: S9. Beattie, G., and Lindow, S. E. 1995. The secret life of foliar bacterial pathogens on leaves. Annu. Rev. Phytopathol. 33: 145‐172. Belfield, E. J., Ruperti, B., Roberts, J. A., and McQueen‐Mason, S. 2005. Changes in expansin activity and gene expression during ethylene‐promoted leaflet abscission in Sambucus nigra. J. Exp. Bot. 56: 817‐823. 148 Benhamou, N., Kloepper, J. W., Quadt‐Hallman, A., and Tuzun, S. 1996. Induction of defense‐related ultrastructural modification in pea root tissues inoculated with endophytic bacteria. Plant Physol. 112: 919‐929. Bisseett, J. 1984. A revision of the genus Trichoderma. I. Section Longibrachiatium sect. nov., Can. J. Bot., 62: 924. Bisseett, J. 1991. A revision of the genus Trichoderma. II. Infrageneric classification, Can. J. Bot., 69: 2357 Bloemberg, G. V., and B. J. J. Lugtenberg. 2001. Molecular basis of plant growth promotion and biocontrol by rhizobacteria. Curr. Opin. Plant Biol. 4: 343‐350 Boehm, M. J., and Hoitink, H. A. J. 1992. Sustenance of microbial activity in planting mixes and its impact on severity of pythium root rot of poinsettia. Phytopathology 82: 259‐264. Bol, J. F., Linthorst, H. J. M., and Cornelissen, B. J. C. 1990. Plant pathogenesis‐related proteins induced by virus infection. Ann. Rev. Phytopathol. 28: 113‐138. Borgmeyer, J. R., Smith, C. E., and Huynh, Q. K. 1992. Isolation and characterization of a 25 kda antifungal protein from flax seeds. Biochem. Bouzarelou, D., Billini, M., Roumelioti, K., and Sophianopoulou, V. 2008. EglD, a putative endoglucanase, with an expansin like domain is localized in the conidial cell wall of Aspergillus nidulans. Fungal Genet Biol. 45: 839‐50. Brotman, Y., Briff, E., Viterbo, A., and Chet, I. 2008. Role of swollenin, an expansin‐like protein from Trichoderma, in plant root colonization. Plant Physiol. 147: 779‐89. Brummell, D. A., Harpster, M. H., and Dunsmuir, P. 1999. Differential expression of expansin gene family members during growth and ripening of tomato fruit. Plant Mol. Biol. 39: 161‐169. Camp, A. R., Dillard, H. R., and Smart, C. D. 2008. Efficacy of Muscodor albus for the control of Phytophthora blight of sweet pepper and butternut squash. Plant Dis. 92: 1488‐1492. Candolle, A. P. de. 1884. Origin of cultivated plants. Canteros, B. I., Minsavage, G. B., Jones, J. B., and Stall, R. E. 1995. Diversity of plasmids in Xanthomonas capestris pr. vesicatoria. Phytopathology 85: 1482‐1486. 149 Capelli, N., Diogon, T., Greppin, H., and Somon, P. 1997. Isolation and characterization of cDNA clone encoding an osmotin‐like protein from Arabidopsis thaliana. Gene. 191: 51‐
56. Chen, F., and Bradford, K. J. 2000. Expression of an expansin is associated with endosperm weakening during tomato seed germination. Plant Physiol. 124: 1265‐1274. Chen, W., Hoitink, H. A. J., and Madden, L. V. 1988. Microbial activity and biomass in container media for predicting suppressiveness to damping‐off caused by Pythium ultimum. Phytopathology 78: 1447‐1450. Chen, Y., and Inbar, Y. 1993. Chemical and spectroscopical analyses of organic matter transformations during composting in relation to compost maturity. In: Science and Engineering of Composting: Design, Environmental, Microbiological, and Utilization Aspects. H. A. J. Hoitink and H. M. Keener, eds. Renaissance Publications, Worthington, OH. Cheong, N. E., Choi. Y. O., Kim, W. Y., Bae, I. S., Hwang, I., Kim, J. W., and Lee, S. Y. 1997. Purification and characterization of an antifungal PR‐5 protein from pumpkin leaves. Mol. Cells. 7: 214‐219. Cheong, N. E., Choi. Y.O., Kim, W.Y., Kim, S.C., Cho, M. J., and Lee, S. Y. 1997. Purification of an antifungal PR‐5 protein from flower buds of Brassica campestris and cloning of its gene. Physiologia Plantarum 101: 583‐590. Chet, I., and Inbar, J. 1994. Biological control of fungal pathogens. Appl. Biochem. and Biotech. 48: 37‐43. Cho, H. T., and Cosgrove, D. J. 2000. Altered expression of expansin modulates leaf growth and pedicel abscission in Arabidopsis thaliana. Proc. Nat'l Acad. Sci. 97: 9783‐
9788. Cho, H. T., and Kende, H. 1997. Expansins and internodal growth of deepwater rice. Plant Physiol. 113: 1145‐1151. Choi, D. S., Lee, Y., Cho, H. T., and Kende, H. 2003. Regulation of expansin gene expression affects growth and development in transgenic rice plants. Plant Cell 15: 1386‐1398. Choi, D., Cho, H. T., and Lee, Y. 2006. Expansins: expanding importance in plant growth and development. Physiologia Plantarum 126: 511‐518. 150 Chung, Y. R., and Hoitink, H. A. J. 1990. Interactions between thermophilic fungi and Trichoderma hamatum in suppression of Rhizoctoniadamping‐off in a bark compost‐
amended container medium. Phytopathology 80:73‐77. CIWMB. 2006. Compost: What is it?. http://www.ciwmb.ca.gov/Organics/CompostMulch/CompostIs.htm Cooper, J. B., Chen, J. A., van Holst, G. J., and Varner, J. E. 1987. Hydroxyproline‐rich glycoproteins of plant cell walls. Trends. Biochem. Sci. 12:24‐27. Cordier, C., Pozo, M. J., Barea, J. M., Gianinazzi, S., and Gianinazzi‐Pearson, V. 1998. Cell defense responses associated with localized and systemic resistance to Phytophthora induced in tomato by an arbuscular mycorrhizal fungus. Mol. Plant‐Microbe Interact. 11: 1017‐1028. Cosgrove, D. J. 2000. Loosening of plant cell walls by expansins. Nature 407: 321‐326. Cosgrove, D. J., Li, L.‐C., Cho, H. T., Hoffmann‐Benning, S., Moore, R. C., and Blecker, D. 2002. The growing world of expansins. Plant & Cell Physiology 43: 1236‐1244. Craft, C. F., and Nelson, E. B. 1996. Microbial properties of composts that suppress damping off and root rot of creeping bentgrass caused by Pythium graminicola. Appl. Environ. Microbiol. 62: 1550‐1557. Curtis, M. J., and Claassen, V. P. 2009. Regeneration topsoil functionality in four drastically disturbed soil types by compost incorporation. Restoration Ecology 17: 24‐32. Dal Bello, G. M. 2000. First Report of Colletotrichum dematium on tomato in Argentina. Plant disease 84 (2): 198. Darley, C.P., Li, Y., Schaap, P., and McQueen‐Mason, S.J. 2003. Expression of a family of expansin‐like proteins during the development of Dictyostelium discoideum. FEBS Lett. 546: 416‐418. Day, J. P., Wattier, R. A. M., Shaw, D. S., and Shattock, R. C. 2004. Phenotypic and genotypic diversity in Phytophthora infestans on potato in Great Britain, 1995‐98. Plant Pathology. 53: 303‐315. de A Campos , M. A., Silva, M. S., Magalhaes, C. P., Ribeiro, S. G., Sarto, R. P. D., Vieira, E. A., and Grossi, M. F. 2008. Expression in Escherichia coli, purification, refolding and antifungal activity of an osmotin from Solanum nigrum. Microbial Cell Factories 7:7. 151 De Loose, M., Ghey, G., Tire, C., Gielen, J., Villarroel, R., Genetello, C., van Montagu, M., Depicker, A., and Inze, D. 1991. The extensin signal peptide allows secretion of a heterologous protein from protoplasts. Gene 99:95‐100. De Meyer, G., Bigirimana, J., Elad, Y., and Hofte, M. 1998. Induced systemic resistance in Trichoderma harzianum T39 and biocontrol of Botrytis cinerea. Eur. J. Plant Pathol. 104:279‐286. DeBriot Alvarez, M. A., Gagne, S., and Antoun, H. 1995. Effect of compost on Rhizosphere microflora of tomato and on the incidence of plant growth‐promoting rhizobacteria. App. Env. Mocrob. 61: 194‐199. Diver, S., Kuepper, G., and Born, H. 1999. Organic tomato production. Appropriate Technology Transfer for Rural Areas. 800‐346‐9140 Djonovic, S., Pozo, M. J., Dangott, L. J., Howell, C. R., and Kenerley, C. M. 2006. Sm1, a proteinaceous elicitor secreted by the biocontrol fungus Trichoderma virens induces plant defense responses and systemic resistance. Mol. Plant‐Microbe Interact. 19:838‐
853. Djonovic, S., Vittone, G., Mendoza‐Herrera, A., and Kenerley, C. M. 2007. Enhanced biocontrol activity of Trichoderma virens transformants constitutively coexpressing β‐
1,3‐ and β‐1,6‐ glucanase genes. Mol. Plant pthol. 8:469‐480. Dobbelaere, S., J. Vanderleyden, and Y. Okon. 2003. Plant growth‐promoting effects of diazotrophs in the rhizosphere. Crit. Rev. Plant Sci. 22: 107‐149 Elad, Y. 1996. Mechanisms involved in the biocontrol of Botrytis cinerea incited disease. Eur. J. Plant Pathol. 102: 719‐732. Elad, Y. 2000. Biological control of foliar pathogens by means of Trichoderma harzianum and potential modes of action. Crop Protection. 19:709‐714. EPA, 2002. Hydrogen perodixe (Hydrogen dioxide)(000595)Fact Sheet. U.S. Environmental Protection Agency. http://www.epa.gov/pesticides/biopesticides/ingredients/factsheets/_000595.htm#des
cription Esposito, E., and da Silva, M. 1998. Systematics and environmental application of the genus Trichoderma. Critical Rev. in Microbiology, 24:89‐98. Fry, W. E., and Goodwin, S. B. 1997. Re‐emergence of potato and tomato late blight in the United States. Plant Disease 81 (12): 1349‐1357. 152 Fudali, S., Janakowski, S., Sobczak, M., Griesser, M., Grundler, F. M., and Golinowski, W. 2008. Two tomato alpha‐expansins show distinct spatial and temporal expression patterns during development of nematode‐induced syncytia. Physiol Plant. 132:370‐83. Gabler, F. M., Fassel, R., Mercier, J., and Smilanick, J. L. 2006. Influence of temperature, inoculation interval, and dosage on biofumigation with Muscodor albus to control postharvest gray mold on grapes. Plant Dis. 90: 1019‐1025. Gal, T.Z., Aussenberg, E. R., Burdman, S., Kapulnik, Y., and Koltai, H. 2006. Expression of a plant expansin is involved in the establishment of root knot nematode parasitism in tomato. Planta 224: 155‐162. Gallou, A., Cranenbrouck, S., and Declerck, S. 2009. Trichoderma harzianum elicits defence response genes in roots of potato plantlets challenged by Rhizoctonia solani. Eur. J. Plant Pathol. 124: 219‐230. Gamliel, A., and Stapleton, J. J. 1993. Effect of chicken compost or ammonium phosphate and solarization on pathogen control, rhizosphere microorganism, and lettuce growth. Plant Dis. 7:886‐891. Garcia‐Mas J., Messeguer, R., Arus, P., and Puigdomenech, P. 1992. The extensin from Purnus amygdalus. Plant Physiol. 100:1603‐1604. Gentile, A., Deng, Z., La Malfa, S., Distefano, G., Domina, F., and Kenerley, C. M. 2007. Enhanced resistace to Phoma tracheiphila and Botrytis cinera in transgenic lemon plants expressing a Trichoderma harzianum chitinase gene. Plant Breeding 126:146‐151. Giordano, W., and Hirsch, A. M. 2004. The expression of MaEXP1, a Melilotus alba expansin gene, is upregulated during the sweetclover‐Sinorhizobium meliloti interaction. Mol Plant Microbe Interact. 17: 613‐22. Gitaitis, R. D. 2006. Bacterial canker. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: pp 25‐26. Glazebrook, J. 2005. Constrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 43: 205‐227. Gracia‐Casado, G., Collada, C., Allona, I., Soto, A., Casado, R., Rodriguez‐Cerezo, E., Gomez, L., and Aragoncillo, C. 2000. Characterization of an apoplastic basic thaumatin‐
like protein from recalcitrant chestnut seeds. Physiologia Plantarum 110: 172‐180. Graham, J. S., Burkhart, W., Xiong, J. and Gillikin, J. W. 1992. Complete amino acid sequence of soybean leaf P21. Plant physiol. 98: 163‐165. 153 Graves, A. S., and Alexander, S. A. 2000. Alternatives to copper for bacterial disease control in staked tomatoes. Phytopathology 90: S132. Gray‐Mitsumune, M., Blomquist, K., McQueen‐Mason, S., Teeri., T. T., Sundberg, B., Mellerowicz, E. J. 2008. Ectopic expression of a wood‐abundant expansin PttEXPA1 promotes cell expansion in primary and secondary tissues in aspen. Plant Biotechnol J. 6:62‐72. Gray‐Mitsumune, M., Mellerowicz, E. J., Abe, H., Schrader, J., Winzell, A., Sterky, F., Blomqvist, K., McQueen‐Mason, S., Teeri, T. T., and Sundberg, B. 2004. Expansins Abundant in Secondary Xylem Belong to Subgroup A of the {alpha}‐Expansin Gene Family. Plant Physiology 135: 1552‐1564. Grech, N. M. 1990. Fungicide resistance in plant pathogenic fungi: the problems and ways to cope. Calif‐Grow 14: 36‐37. Grobe, K., and Petersen, A. 1999. Grass group I allergens (β‐expansins) are novel, papain related proteinases. European Journal of Biochemistry 263: 33‐40. Grobe, K., Poppelmann, M., Becker, W. M., and Petersen, A. 2002. Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases. European Journal of Biochemistry 269: 2083‐2092. Grogan, R. G., Kimble, K. A., and Misaghi, I. 1975. A stem canker disease of tomato caused by Alternaria alternata f. sp. lycopersici. Phytopathology 65: 880‐886. Grubinger, V. 1999. Bio‐rational pesticides. University of Vermont Extension. http://www.uvm.edu/vtvegandberry/factsheets/biorationals.html Guzman, N. A., Fuller, G. C., and Dixon, J. E. 1990. Hydroxyproline‐containing proteins and their hydroxylation by genetically distinct proly 4‐hydorsylase. Organization and assembly of plant and animal extracellular matrix. Academic press, San Diego, pp 301‐
356. Hadar, Y. and Gorodecki, B. 1991. Suppression of germination of sclerotia of Sclerotium rolfsii in compost. Soil Biol. Biochem. 23: 303‐306. Handayanto, E., Cadisch, G., and Giller, K. E. 1997. Regulating N release from legume tree pruning by mixing residues of different quality. Soil. Biol. Biochem. 29: 1417‐1426. Harman, G. E. 2006. Overview of mechanisms and uses of Trichoderma spp. Phytopathology 96:190‐194. 154 Harman, G. E., Howell, C. R., Viterbo, A., Chet, I., and Lorito, M. 2004. Trichoderma species‐opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2:43‐56. Harrison, E. P., McQueen‐Mason, S. J., and Manning, K. 2001. Expression of six expansin genes in relation to extension activity in developing strawberry fruit. J. Exp. Bot. 52: 1437‐46 Hawksworth, D. L., Kirk, P. M., Sutton, B. C., and Pegler, D. N. 1996. Ainsworth & Bisby’s dictionary of fungi, 8th ed., CAB International, Wallingford, 616. Hejgaard, J., Jacobsen, S. and Svendsen, J. 1991. Two antifungal thaumatin‐like proteins from barley grain. FEBS letters 291: 127‐131. Herman, M. A. B., Davidson, J. K., and Smart, C. D. 2008. Induction of plant defense gene expression by plant activators and Pseudomonas syringae pv. tomato in greenhouse‐
grown tomatoes. Phytopathology 98:1226‐1232. Hightunnels.org, 2007. http://www.hightunnels.org/ForEducators/Introduction/What.htm Hirano, S. S., and Upper, C. D. 1991. Bacterial community dynamics. In Microbial Ecology of Leaves, ed. Andrews, J. H., and Hirano, S. S. pp. 271‐294. New York: Springer‐Verlag. Hoagland, D. R., and Arnon, D. I. 1950. The water culture method for growing plants without soil. In: Circular 347. California Agricultural Experiment Station, College of Agriculture, University of California,Berkeley. Hoitink, H. A. J., Inbar, J., and Boehm, M. J. 1991. Status of compost amended planting mixes naturally suppressive to soil borne diseases of floricultural crops. Plant Dis. 75: 869‐873. Hoitink, H. A. J., Krause, M. S., and Han, D. Y. 2001. Spectrum and Mechanisms of plant disease control with composts. In Stoffella, P. J., and Kahn, B. A. 2001. Compost utilization in horticultural cropping systems. CRC press, pp. 263‐274. Hoitink, H. A. J., Madden, L. V., and Dorrance, A. E. 2006. Systemic resistance induced by Trichoderma spp: Interaction between the host, the pathogen, the biocontrol agent and soil organic matter quality. Phytopathology 96;186‐189. Horst, L. E., Locke, J., Krause, C. R., McMahon, R. W., Madden, L. V., and Hoitink, H. A. J. 2005. Suppression of Botrytis blight of begonia by Trichoderma hamatum 382 in peat and compost‐amended planting mixes. Plant Dis. 89:1195‐1200. 155 Howell, C. R. 2003. Mechanisms employed by Trichoderma species in the biological control of the plant diseases: The history and evaluation of current concepts. Plant Dis. 87:4‐10. Howell, C. R., and Stipanovic, R. D. 1983. Gliovirin, a new antibiotic from Gliocladium virens, and its role in the biological control of Pythium ultimum. Can. J. Microbiol. 29:321‐324. Hsiang, T., and Tian, L. 2007. Control of Dollar spot with molasses and hydrogen peroxide. GTI Annual Research Report 2007. http://www.uoguelph.ca/GTI/07anrep/155‐156.pdf Iannotti, M. 2009. Compost. http:/gardening.about.com/od/gardenprimer/g/Compost.htm Ibeas, J. I., Lee, H., Damsz, B., Prasad, T. D., Pardo, J. M., Hasegawa, P. M., Bressan, R. A., and Narasimhan, M. L. 2000. Fungal cell wall phosphomannans facilitate the toxic activity of a plant PR‐5 protein. Plant J. 23: 375‐383. Inbar, J., Abramsky, M., Cohen, D., and Chet, I. 1994. Plant growth enhancement and disease control by Trichoderma harzianum in vegetable seedlings grown under commercial conditions. Eur. J. Plant Pathol. 100: 337‐346. Jelev, Z. J., Bobey, S. G., Minz, D., Mavmon, M., and Freeman, S. 2009. Characterization of Colletotrichum Species Causing Strawberry Anthracnose in Bulgeria. Journal of Phytopathology 156: 668‐677. Jelev, Z. J., Bobey, S. G., Minz, D., Mavmon, M., and Freeman, S. 2008. First Report of Anthracnose Fruit Rot Caused by Colletotrichum acutatum on Pepper and Tomato in Bulgeria. Plant Disease 92 (1):172. Jenkins, J. A. 1948. The Origin of the Cultivated Tomato. Economic Botany. 2: 379‐392. Jett, L. W. 2006. Production of tomatoes within a high tunnel. http://www.hightunnels.org/ForGrowers/WarmSeasonVegetables/warmseasonvegtom
prod.htm Jett, L. W. 2006. Watering and fertilizing tomatoes in a high tunnel. Horticultural MU Guide. G6462 http://www.hightunnels.org/PDF/jettfertigation.pdf Jones, 2006. Early blight. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Diseases. APS press. Minnesota. USA: 13 p. 156 Jones, J. B., and Jones, J. P. 2006. Leaf Mold. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: p. 18. Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Diseases. APS press. Minnesota. USA. Jones, J. B., Lacy, G.H., Bouzar, H., Stall, R. E., and Schaad, N. W. 2004. Reclassification of the Xanthomonads associated with bacterial spot disease of tomato and pepper. System. Appl. Microbiol. 27: 755‐762. Jones, J. B., Stall, R. E., and Zitter, T. A. 1997. Compendium of Tomato Diseases. APS Press. Minnesota. USA: 73 p. Jones, J. P.,2006. Early Blight. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: pp 13‐14. Kalamaki, M. S., Harpster, M. H., Palys, J. M., Labavitch, J. M., Reid, D, S., and Brummell, D. A. 2003. Simultaneous Transgenic Suppression of LePG and LeExp1 Influences Rheological Properties of Juice and Concentrates from a Processing Tomato Variety. J Agric Food Chem. 51: 7456‐7464. Kannan, V., and Surrendar, R. 2009. Synergistic effect of beneficial rhizosphere microflora in biocontrol and plant growth promotion. Journal of Basic Microbiology 49: 158‐164. Keeling, A. A., McCallum, K. R., Beckwith, C.P. 2003. Mature green waste compost enhances growth and nitrogen uptake in wheat (Triticum aestivum L.) and oilseed rape (Brassica napus L.) through the action of water‐extractable factors. Bioresour. Technol. 90, 127–132. Keller, B., and Lamb, C. J. 1989. Specific expression of a novel cell wall hydroxyproline‐
rich glycoprotein gene in lateral root initiation. Genes Devel. 3:1639‐1646. Kerff, F., Amoroso, A., Herman, R., Sauvage, E., Petrella, S., Filée, P., Charlier, P., Joris, B., Tabuchi, A., Nikolaidis, N., and Cosgrove, D. J. 2008. Crystal structure and activity of Bacillus subtilis YoaJ (EXLX1), a bacterial expansin that promotes root colonization. Proc Natl Acad Sci U S A. 105: 16876‐81. Kettler, J. S. 1997. A pot study in investigating the relationship between tree mulch decomposition and nutrient element availability. Commun. Soil Sci. Plant Anal. 28: 1269‐
1284. 157 Khan, J., Ooka, J. J., Miller, S. A., Madden, L. V., and Hoitink, H. A. J. 2004. Systematioc resistance induced by Trichoderma hamatum 382 in cucumber against Phytophthora crown rot and leaf blight. Plant Dis. 88:280‐286. Kieliszewski, M. J., and Lamport, D. T. A. 1994. Extensin repetitive motifs, functional sites, post‐translational codes, and phylogeny. Plant J. 5:157‐172. Kim, H., Mun, J. H., Byun, B. H., hwang, H. J., Kwon, Y. M., and Kim, S. G. 2002. Molecular cloning and characterization of the gene encoding osmotin protein in Petunia hybrid. Plant Science 162: 745‐752. Kochler, A., Schwinding, S., and Conrath, U. 2002. Benzothiadiazole‐induced priming for potentiated response to pathogen infection, wounding and infiltration of water into leaves requires the NPR1/NIM1 gene in Arabidopsis. Plant Physiol. 128: 1046‐1056. Koike, S. T., Gladders, P., and Paulus, A. O. 2007.Vegetable Diseases. Manson Publishing Ltd. London. Koiwa, H., Kato, H., Nakatsu, T., Oda, J., Yamada, Y., and Sato, F. 1997. Purification and characterization of tobacco pathogenesis‐related protein PR‐5 d, an antifungal thaumatin‐like protein. Plant Cell Physiol. 38: 783‐791. Koiwa, H., Sato, F., and Yamada, Y. 1994. Characterization of accumulation of tobacco PR‐5 proteins by IEF‐immunoblot analysis. Plant Cell Physiol. 35: 821‐827. Krause, M. S., De Ceuster, T. J. J., Tiquia, S. M., Michel, F. C., Jr., Madden, L. V., and Hoitink, H. A. J. 2003. Isolation and characterization of rhizobacteria from compost that suppress the severity of bacterial leaf spot of radish. Phytopathology 93:1292‐1300. Kuc, J. 2001. Concepts and direction of induced systemic resistance in plants and its application. Eur. J. Plant Pathol. 107:7‐12. Kudla, U., Qin, L., Milac, A., Kielak, A., Maissen, C., Overmars, H., Popeijus, H., Roze, E., Petrescu, A., Smant, G., Bakker, J., and Helder, J. 2005. Origin, distribution and 3D‐
modeling of Gr‐EXPB1, an expansin from the potato cyst nematode Globodera rostochiensis. FEBS Lett. 579:2451‐2457. Kwok, O. C. H., Fahy, P. C., Hoitink, H. A. J., and Kuter, G. A. 1987. Interactions between bacteria and Trichoderma hamatum in suppression of rhizoctonia damping‐off in bark compost media. Phytopathology 77: 1206‐1212. Laine, M. J., Haapalainen, M., Wahlroos, T., Kankare, K., Nissinen, R., Kassuwi, S., and Metzler, M. C. 2000. The cellulase encoded by the native plasmid of Clavibacter 158 michiganensis ssp. sepedonicus plays a role in virulence and contains an expansin‐like domain. Physiological and Molecular Plant Pathology 57: 221‐233. LaRosa, P. C., Chen, Z., Nelson, D. E., Singh, N. K., Hasegawa, P. M., and Bresssa, R. A. 1992. Osmotin gene expression is post transcriptionally regulated. Plant Physiol. 100: 409‐415. Leandro, L. F. S., Guzman, T., Ferguson, L. M., and Louws, F. S. 2007. Population dynamics of Trichoderma in fumigated and compost‐amended soil and on strawberry roots. Applied Soil Ecology 35: 237‐246. Lee, Y., Choi, D., and Kende, H. 2001. Expansins: ever‐expanding numbers and functions. Curr. Opin. Plant Biol. 2001 4:527‐32. Lewis Ivey, M. L., Mera, J. R., and Miller, S. A.2005. Evaluation of fungicides and bactericides for the control of foliar and fruit diseases of processing tomatoes. Vegetable disease management research reports. Plant Pathology series No. 126. The Ohio State University. 4 p. Li, L. C., and Cosgrove, D. J. 2001. Grass group I pollen allergens (beta‐expansins) lack proteinase activity and do not cause wall loosening via proteolysis. European Journal of Biochemistry 268: 4217‐4226. Li, Z. C., Durachko, and D. M., Cosgrove, D. J. 1993. An oat coleoptile wall protein that induces wall extension in vitro and that is antigenically related to a similar protein from cucumber hypocotyls. Planta 191: 349‐356. Liu, D., Kashchandra, G., Raghothama, G., Paul, M., Hasegawa, M., and Bressan, R.A. 1993. Osmotin overexpression in potato delays development of disease symptoms. Proc. Natl. Acad. Sci. 91: 1888‐1892. Mahesaniya, A., Souza‐Machado, V., Pitblado, R., Khan, A., and Cuppels, D. 2002. Efficacy of acibenzolar‐S‐methyl and paclobutrazol for the control of bacterial speck (Pseudomonas syringae pv tomato) in tomato plug transplants. Can. J. Plant Pathol. 24: 377‐378. Manzies, J. G. and Jarvis, W. R. 1994. Early blight. In Howard, R. J., Garland, J. A. and Seaman, W. L. 1994. Diseases and pest of vegetable crops in Canada. The Canadian Phytopathological Society. Entomological Society of Canada. Canada: 346 pp. Mc Coy, C. W., Nigg, H. N., Timmer, L. W., and Futch, S. H. 2003. Use of pesticides in citrus IPM. In: Timmer, L. W. 2003. Florida citrus pest management guide, University of Florida Cooperative Extension Service, Institute of Food and Agricultural Services. 159 McQueen‐Mason, S., and Cosgrove, D. J. 1995. Expansin mode of action on cell walls: Analysis of wall hydrolysis, stress relaxation, and binding. Plant Physiol. 107: 87‐100. McQueen‐Mason, S., Durachko, D. M., and Cosgrove, D. J. 1992. Two endogenous proteins that induce cell wall expansion in plants. Plant Cell 4: 1425‐1433. Meera, M. S., Shivannan, M. B., Kageyama, K., and Hyakumachi, M. 1994. Plant growth promoting fungi from Zoysiagrass rhizosphere as potential inducers of systemic resistance in cucumber. Phtopathology 84: 1399‐1406. Melchers, I. S., Sela‐Burlage, M. B., Vloemans, S. A., Woloshuk, C. P., Can Roekel, J. S. C., Pen, J., Van denElzen, P. J. M., and Cornelissen, B. J. C. 1993. Extracellular targeting of the vacuolar tobacco protein, AP24, chitinase and β‐ 1,3 glucanase in transgenic plants. Plant Mol. Biol. 21: 583‐593. Mellilo, J. M., Aber, J. D., and Muratore, J. F. 1982. Nitrogen and lignin control of hardwood leaf litter decomposition dynamics. Ecology 63: 621‐626. Menzies, J. G., and Jarvis, W. R. 1994a. Early blight (target spot), alternaria fruit rot. In Howard, R. J.; Garland, J. A., and Seaman, W. L. 1994. Diseases and Pests of Vegetable Crops in Canada. The Canadian Phytopathological Society and the Entomological Society of Canada: 346 pp. Menzies, J. G., and Jarvis, W. R. 1994b. Gray mold (ghost spot). In Howard, R. J.; Garland, J. A., and Seaman, W. L. 1994. Diseases and Pests of Vegetable Crops in Canada. The Canadian Phytopathological Society and the Entomological Society of Canada: 348‐349 pp. Mercier, J., and Jimenez, J. I. 2004. Control of fungal decay of apples and peaches by the biofumigant fungus Muscodor albus. Postharvest Biol. Technol. 31: 1‐8. Mercier, J., and Manker, D. C. 2005. Biocontrol of soil‐borne diseases and plant growth enhancement in greenhouse soilless mix by the volatile‐producing fungus Muscodor albus. Crop Prot. 24: 355‐365. Mercier, J., and Smilanick, J. L. 2005. Control of green mold and sour rot of stored lemon by biofumigation with Muscodor albus. Biol. Control 32: 401‐407. Merkouropoulos, G., Barnett, D. C., and Shirsat, A. H. 1999. The Arabidopsis extensin gene is developmentally regulated is induced by wounding, methyl jasmonate, abscisic and salicylic acid, and codes for a protein with unusual motifs. Planta 208:212‐219. Miller, S. 2006. Managing diseases of tomatoes in high tunnels. VegNet 13: 5 http://vegnet.osu.edu/news/currentvn05‐06.htm 160 Miller, S. A., and Ivey, M. L. L. 2006. Hot water and chlorine treatment of vegetable seeds to eradicate bacterial plant pathogens. Vegetable isease management Research Reports, OSU extension. Miller, S. A., Rowe, R. C., and Riedel, R. M. 1996. Blossom‐end rot of tomato, pepper, and eggplant. Extension Fact Sheet, The Ohio State University. HYG‐3117‐96. http://ohioline.osu.edu/hyg‐fact/3000/pdf/3117.pdf Mugendi, D. N., Nair, P. K. R., Mugwe, J. N., O’Neill, M. K., Swift, M. J., and Woomer, P. L. 1999. Alley cropping of maize with calliandra and leucaena in the sub humid highlands of Kenya: Part 2. Biomass decomposition, N mineralization, and N uptake by maize. Agroforestry Systems 46: 51‐64. Mur, L. A. J., Naylor, G., Warner, S. A. J., Sugars, J. M., White, R. F., and Draper, J. 1996. Salicylic acid potentiates defense gene expression in tissue exhibiting acquired resistance to pathogen attack. Plant Journal 9: 559‐571. Narasimhan, M. L., Damsz, B., Coca, M. A., Ibeas, J. I., Yun, D. J., Pardo, J. M., Hasegawa, P. M., and Bressan, R. A. 2001. A plant defense response effector induces microbial apoptosis. Mol. Cell. 8: 921‐930. Nava‐Diaz, C. 2006. Role of plant growth promoting Rhizobacteria in integrated disease management and productivity of tomato. Ph. D. thesis. The Ohio State University. pp 153‐184. Nelson, D. E., Raghothama, K. G., Singh, N. K., Hasegawa, P. M., Bressan, R. A. 1992. Analysis of structure and transcriptional activation of an osmotin gene. Plant Mol Biol. 19: 577‐588. Nelson, E. B., and Craft, C. M. 1992. Suppression of dollar spot on creeping bentgrass and annual bluegrass turf with compost amended topdressings. Plant Dis. 76: 954. Nelson, E. B., Kuter, G. A., and Hoitink, H. A. J. 1983. Effects of fungal antagonists and compost age on suppression of rhizoctonia damping‐off in container media amended with composted hardwood bark. Phytopathology 73: 1457‐1462. Newton, S. S. and Duman, J.G. 2000. An osmotin‐like cryoprotective protein from the bittersweet nightshade Solanum dulcamara. Plant Mol. Biol. 44: 581‐589. NOSB. 2004. Compost tea task force report. April 6, 2004. http://www.ams.usda.gov/AMSv1.0/getfile?dDocName=STELPRDC5070290 161 Obenland, D. M., Crisosto, C. H., and Rose, J. K. C. 2003. Expansin protein levels decline with the development of mealiness in peaches. Postharvest Biology and Technology 29:11‐18. Obradovic, A., Mavridis, A., Rudolph, K., Janse, J. D., Arsenijevic, M., Jones, J. B., Minsavages, G. V., and Wang, J. 2004. Characterization and PCR‐based typing of Xanthomonas campestris pv. Vesicatoria from peppers and tomatoes in Serbia. European Journal of Plant Pathology 110: 285‐292. Ohio Vegetable Production Guide. 2008. Green House Tomatoes. The Ohio State University, Extension bulletin 672‐08. Ohio Vegetable Production Guide. 2008. Tomatoes: Fresh market and Processing. The Ohio State University, Extension bulletin 672‐08. O'Malley, R. C., and Lynn, D. G. 2000. Expansin message regulation in parasitic angiosperms: Marking time in development. Plant Cell 12: 1455‐1466. Pal, K. K. and B. McSpadden Gardener, 2006. Biological Control of Plant Pathogens. The Plant Health Instructor DOI: 10.1094/PHI‐A‐2006‐1117‐02. Paulus, A. O.,2006. Alternaria Stem Canker (Black Mold). In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: 9pp. Peet, M. 1995. Sustainable Practices for Vegetable Production in the South. Focus Publishing . Newburyport, MA Pieterse, C. M. J., Van Pelt, J. A., Ton, J., Parchmann, S., Muller, M. J., Buchala, A. J., Metraux, J. P., and Van Loon, L. C. 2000. Rhizobacteria mediated induced systemic resistance (ISR) in Arabidopsis requires sensitivity to jasmonate and ethylene but is not accompanied by an increase in their production. Physiol. Mol. Plant pathol. 57:123‐134. Pieterse, C. M. J., Van Wees, S. C. M., Hoffland, E., Van Pelt, J. A., and Van Loon, L. C. 1996. Systemic resistance in Arabidopsis and pathogenesis‐related gene expression. Plant Cell 8:1225‐1237. Pieterse, C. M. J., van Wees, S. C. M., Hoffland, E., van Pelt, J. A., and van Loon, L. C. 1996. Systemic resistance in Arabidopsis induced by biocontrol bacteria is independent of salicylic acid accumulation and pathogenesis related gene expression. Plant Cell 8: 1225‐1237. 162 Pieterse, C. M. J., Van Wees, S. C. M., Van Pelt, J. A., Knoester, M., Laan, R., Gerrits, H., Weisbeek, P. J., and Van Loon, L. C. 1998. A novel signaling pathway controlling induced systemic resistance in Arabidopsis. Plant Cell 10:1571‐1580. Pitblado, R. E., and Howard, R. J. 1994. Early blight. In Howard, R. J., Garland, J. A. and Seaman, W. L. 1994. Diseases and pest of vegetable crops in Canada. The Canadian Phytopathological Society. Entomological Society of Canada. Canada: 274 pp. Pozo, M. J., Cordier, C., Dumas‐Gaudot, E., Gianinazzi, S., Barea, J. M., and Azcon‐
Aguilar, C. 2002. Localized vs. systemic effect of arbuscular mycorrhizal fungi on defense responses to Phytophthora infection in tomato plants. J. Exp. Bot. 53: 525‐534. Precheur, R. 2005. Ohio Vegetable Production Guide, Bulletin 672‐04 http://ohioline.osu.edu/b672/ Precheur, R. J., Bennett, M. A., Riedel, R. M, Wiese, K. L., and Dudek, J. 1992. Management of fungicide residues on processing tomatoes. Plant Dis. 76: 700‐702. Pressey, R. 1997. Two isoforms of NP24, a thaumatin‐like protein in tomato fruit. Phytochemistry 44:1241‐1245. Qin, L., Kudla, U., Roze, E. H., Goverse, A., Popeijus, H., Nieuwland, J., Overmars, H., Jones, J. T., Schots, A., Smant, G., Bakker, J., Helder, J. 2004. Plant degradation: A nematode expansin acting on plants. Nature 427: 30. Rehner, S. A., and Samuels, G. J. 1994. Taxonomy and phylogeny of Gliocladium analyzed by large subunit ribosomal DNA sequences. Mycol. Res. 98:625‐634. Roberts, W. K. and Selitrennikoff, C. P. 1990. Zeamatin, an antifungal protein from maize with membrane‐permeabilizing activity. J. General Microbiol. 136: 1771‐1778. Rodrigo, I., Vera, P., Tornero, P., Hernandez‐Yago, J., and Conejero, V. 1993. cDNA cloning of viroid‐induced tomato pathogenesis‐related protein P23. Plant Physiol. 102: 939‐945. Romantschuck, M. 1992. Attachment of plant pathogenic bacteria to plant surfaces. Ann. Rev. Phytopathol. 30: 225‐243. Rose, J. K. C., Lee, H. H., and Bennett, A. B. 1997. Expression of a divergent expansin gene is fruit‐specific and ripening‐regulated. Proc. Natl. Acad. Sci. USA 94: 5955‐5960. Ryals, J. A., Neuenschwander, U. H., Willits, M. G., Molina, A., Steiner, H. Y., and Hunt, M. D. 1996. Systemic acquired resistance. Plant Cell 8: 1809–19. 163 Ryu, C. M., Murphy, J. F., Mysore, K. S. and Kloepper, J. W. 2004. Plant growth promoting Rhizobactoria systemically protect Arabidopsis thaliana against cucumber mosaic virus by a salicylic acid and NPR1‐independent and jasmonic acid dependent signaling pathway. The Plant Journal 39:381‐392. Sabine, J. 1819. On the love apple or tomato. Royal Hort. Soc. Trans. 3: 342‐354. Saloheimo, M., Paloheimo, M., Hakola, S., Pere, J., Swanson, B., Nyyssonen, E., Bhatia, A., Ward, M., and Penttila, M. 2002. Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials. European Journal of Biochemistry 269:4202‐4211. Salzman, R. A., Tikhonova, I., Bordelon, B. P., Hasegawa, P. M., and Bressan, R. A. 1998. Coordinate accumulation of antifungal proteins and hexoses constitutes a developmentally controlled defense response during fruit ripening in grape. Plant Physiol. 117: 465–472. Sampedro, J., and Cosgrove, D. J. 2005. The expansin superfamily. Genome Biol. 6:242. Sato, F., Kitajima, S., Koyama, T., Yamada, Y. 1996. Ethylene induced gene expression of osmotin like protein, a neutral isoform of tobacco PR‐5, is mediated by the AGCCGCC cis‐sequence. Plan Cell Physiol. 37:249‐255. Scheuerell, S. J., Sullivan, D. M., and Walter, F. M. 2005. Suppression of seedling damping off caused by Pythium ultimum, P. irregulare, and Rhizoctonia solani in container media amended with a diverse range of Pacific Northwest compost sources. Phytopathology 95: 306‐315. Schnabel, G., and Mercier, J. 2006. Use of a Muscodor albus pad delivery system for the management of brown rot of peach in shipping cartons. Postharvest Biol. Technol. 42: 121‐123. Schneider, T. D., and Stephens, R. M. 1990. Sequence logos: a new way to display consensus sequences. Nucl. Acids Res. 18: 6097‐6100. Shoresh, M., and Harman, E. 2008. The molecular basis of shoot responses of maize seedlings to Trichoderma harzianum T22 inoculation of the root: A proteomic approach. Plant Physiology 147: 2147‐2163. Shoresh, M., Yedida, I., and Chet, I. 2005. Involvement of jasmonic acid/ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T‐203. Phytopathology 95:76‐84. 164 Showalter, A. M. 1993. Structure and function of plant cell wall proteins. Plant Cell 5:9‐
23. Siciliano, V., Genre, A., Balestrini, R., Cappellazzo, G., deWit, P. J., and Bonfante, P. 2007. Transcriptome analysis of arbuscular mycorrhizal roots during development of the prepenetration apparatus. Plant Physiol. 144:1455‐66. Silvar, C., Diaz, J., and Merino, F. 2005. Real‐time polymerase chain reaction quantification of phytophthora capsici in different pepper genotypes. Phytopathology 95: 1423‐1429. Singh, N. K., Bracker, C. A., Hasegawa, P. M., Handa, A. K., Buckel, S., Hermodson, M. A., Pfankoch, E., and Bressan, R. A. 1987. Characterization of osmotin. Plant Physiol. 85: 529‐536. Singh, N. K., Handa, A. K., Hasegawa, P. M., and Bressan, R. A. 1985. Protein associated with adaptation of cultured tobacco cells to NaCl. Plant Physiol. 79: 126‐137. Singh, N. K., Nelson, D. E., Rosa, P. C., Bracker, C. E., Handa, A. K., Hasegawa, P. M., and Breaasn, R. A. 1989. Osmotin: A protein associated with osmotic stress adaptation in plant cells. Environmental stress in plants. Cherry, J.A., Ed. Heidglberg: Springer‐Verlag, pp. 67‐68. Smith, D. C., Beharee, V., and Jughes, J. C. 2001. The effect of compost produced by a simple procedure on the yields of swiss chard (Beta vulgaris L. var. flavescens) and common bean (Phaseolus vulgaris L. var. nanus). Scientia Horticulturae 91: 393‐406. Song, W. G., Li, B. J., Ye, Z. H., Zhao, Z. H., and Shi, Y. X. 2008. Concentration Prediction of Pesticides with Different Transformation Fate in Agricultural Soil Environment. J. Agro‐Environ. Sci. 27: 1574‐1581. Stall, R. E. 2006. Gray Mold. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: pp 16‐17. Stevenson, W. R. 2006. Septoria leaf spot. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Diseases. APS press. Minnesota. USA: 22 p. Stevenson, W. R., and Pohronezny, K. L. 2006. Anthracnose. In Jones, J. B., Jones, J. P., Stall, R. E., and Zitter, T. A. 2006. Compendium of Tomato Disease. APS Press. Minnesota. USA: pp 9‐10. Sticcher, L., Mauch‐Mani, B., and Metraux, J. P. 1997. Systemic acquired resistance. Annu. Rev. Phytopathol. 35:235‐270. 165 Stinson, A. M., Zidack, N. K., Strobel, G. A., and Jacobsen, B. J. 2003 Mycofumigation with Muscodor albus and Muscodor roseus for control of seedling diseases of sugar beet and Verticillium wilt of eggplant. Plant Dis. 87: 1349‐1354. Strobel, G. 2006. Muscodor albus and its biological promise. J Ind Microbiol Biotechnol. 33: 514‐522. Strobel, G. A., Dirksie, E., Sears, J., and Markworth, C. (2001) Volatile antimicrobials from a novel endophytic fungus. Microbiology 147: 1943‐2950. Strobel, G.A., and Ezra, D. (2008) Application of Muscodor albus to control harmful microbes in human and animal wastes. United States Montana State University (Bozeman, MT, US) 7341862 Strobel, G.A., and Ezra, D. 2008. Application of Muscodor albus to control harmful microbes in human and animal wastes. United States Montana State University (Bozeman, MT, US) 7341862 http://www.freepatentsonline.com/7341862.html Tire, C., De Rycke, R., De Loose, M., Inze, D., Van Montagu, M., and Engler, G. 1994. Extensin gene expression is induced by mechanical stimuli leading to local cell wall strengthening in Nicotiana plumbaginifolia. Planta 195:175‐181. Trivedi, P. K., and Nath, P. 2004. MaEXP1, an ethylene‐induced expansin from ripening banana fruit. Plant Science 167: 1351‐1358. Tuite, J. 1969. Plant pathological methods fungi and bacteria. Burgess publishing company. pp 183‐184. Uknes, S., Mauch‐Mani, B., Moyer, M., Potter, S., Williams, S., and Dicher, S. 1992. Acquired resistance in Arabidopsis. Plant Cell 4: 645–56. USDA, 2008. United States Department of Agriculture, National Agriculture Statistics. http://www.nass.usda.gov/QuickStats/PullData_US.jsp Van Loon, L. C. and Van Kammen, A. 1970. Polyacrylamide disc electrophoresis of the soluble leaf proteins from Nicotiana tabacum var. “Samsun” and “Samsun NN” II. Changes in protein constitution after infection with tobacco mosaic virus. Virology 40: 199‐211. Van Loon, L. C. and Van Strien, E. A. 1999. The families of pathogenesis‐related proteins, their activities and comparative analysis of PR‐1 type proteins. Molecular Plant‐Microbe Interaction 4: 315‐323. 166 Van Loon, L. C., Pierpoint, W. S., Boller, T., and Conejero, V. 1994. Recommendation for naming plant pathogenesis‐ related proteins. Plant Mol. Biol. Reporter 12, 245‐264. Van Wees, S. C. M., Van der Ent, S., and Pieterse, C. M. J. 2008. Plant immune responses triggered by beneficial microbes. Current Opinion in Plant Biology 11: 443‐448. Voloudakis, A. E., Reignier, T. M., and Cooksey, D. A.2005. Regulation of resistance to copper in Xanthomonas axonopodis pv. vesicatoria. Appl. Environ. Microbiol. 71: 782‐
789. Vu, L. and Huynh, Q. K. (1994) Isolation and characterization of a 27 kDa antifungal protein from the fruits of Diospyros texana. Biochem. Biophys. Res. Communications. 202: 666‐672. Weindling, R. 1941. Experimental consideration of model toxin of Gliocladium and Trichoderma. Phytopathology 31:991‐1003. Wieczorek, K., Golecki, B., Gerdes, L., Heinen, P., Szakasits, D., Durachko, D. M., Cosgrove, D. J., Kreil, D. P., Puzio, P. S., Bohlmann, H., and Grundler, F. M. 2006. Expansins are involved in the formation of nematode‐induced syncytia in roots of Arabidopsis thaliana. Plant J. 48: 98‐112. Willis, J. L. 1924. A Flora of Economic Plants of California. Associated Student Store, Berkeley, California. Wilson, P. S., Ketola, E. O., Ahvenniemi, P. M., Lehtonen, M. J., and Valkonen, J. P. T. 2008. Dynamics of soilborne Rhizoctonia solani in the presence of Trichoderma harziamun: effects on stem canker, black scurf and progeny tubers. Plant Pathol. 57: 152‐161. Woo, S. L., Donzelli, B., Scala, F., Mach, R., Harman, G. E., Kubicek, C. P., Del Sorbo, G., and Lorito, M. 1999. Disruption of the ech 42 (endochitinase‐encoding) gene affects biocontrol activity in Trichoderma harzianum P1. Mol. Plant‐Microbe Interact. 12:419‐
429. Woo, S. L., Scala, F., Ruocco, M., and Lorito, M. 2006. The molecular biology of the interactions between Trichoderma spp., pathogenic fungi, and plants. Phytopathology 96:181‐185. Woropong, J., Strobel, G. A., Ford, F. J., Li, J. Y., Baird, G., and Hess, W. M. 2001. Muscodor albus anam. novel endophyte from Cinnamomum zeylanicum. Mycotaxon 79: 67‐79. 167 Ye, X. Y., Wang, H. X., and Ng, T. B. 1999. First chromatographic isolation of an antifungal thaumatin‐like protein from French bean legumes and demonstration of its antifungal activity. Biochem. Biophys. Communications 263: 130‐134. Yedida, I., Benhamou, N., Kapulenik, Y., and Chet, I. 2000. Induction and accumulation of PR proteins activity during early stages of root colonization by the mycoparasite Trichoderma harzianum strain T‐203. Plant Physiol. Biochem. 38:863‐873. Yedidia, I., Shoresh, M., Kerem, Z., Benhamon, N., Kapulnik, Y., and Chet, I. 2003. Concomitant induction of systemic resistance to Pseudomonas syringae Pv. Lachrymans in cucumber by Trichoderma asperelleum (T‐203) and accumulation of phytoalexins. Appl. Environ. Microbiol. 69:7343‐7353. Yi, L., Jones, L., and McQueen‐Mason, S. 2003. Expansins and cell growth. Current Opinion in Plant Biology 6: 603‐610. Yoo, S. D., Gao, Z. F., Cantini, C., Loescher,W. H., and van Nocker, S. 2003 Fruit ripening in sour cherry: Changes in expression of genes encoding expansins and other cell‐wall‐
modifying enzymes. Journal of the American Society for Horticultural Science 128: 16‐
22. Yuan, S., Wu, Y., and Cosgrove, D. J. 2001. A fungal endoglucanase with plant cell wall extension activity. Plant Physiol. 127: 324‐333. Yun, L. T., Mizubuti, E., and Fry, W. E. 1999.Genetics of metalaxyl resistance in Phytophthora infestans. Fungal Genetics and Biology 26: 118‐130. Zhang, W., Han, D. Y., Dick, W. A., Davis, K. R., and Hoitink, H. A. J.1998. Compost and compost water extract‐induced systemic acquired resistance in cucumber and Arabidopsis. Phytopathology 88:450‐455. Zhu, B., Chen, T. H. H., Li, P. H. 1995. Activation of two osmotin like proteins in transgenic potato plants. Plant Physiol. 108: 929‐937. Zitter, T. A. 2007. In high tunnels, diseases are what you make them. Cornell University, Vegetable MD online . http://vegetableonline.ppath.cornell.edu/NewsArticles/HighTunn.htm 168