From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
HEMOSTASIS, THROMBOSIS, AND VASCULAR BIOLOGY
Basal and angiopoietin-1–mediated endothelial permeability is regulated by
sphingosine kinase-1
Xiaochun Li,1 Milena Stankovic,1 Claudine S. Bonder,1 Christopher N. Hahn,1 Michelle Parsons,1 Stuart M. Pitson,1 Pu Xia,2
Richard L. Proia,3 Mathew A. Vadas,2 and Jennifer R. Gamble2
1Division of Human Immunology, Hanson Institute, Institute of Medical & Veterinary Science, Adelaide, Australia; 2Centenary Institute of Cancer Medicine and
Cell Biology, Medical Foundation and the University of Sydney, Sydney, Australia; and 3Genetics of Development and Disease Branch, National Institute of
Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD
Endothelial cells (ECs) regulate the barrier function of blood vessels. Here we
show that basal and angiopoietin-1 (Ang1)–regulated control of EC permeability is
mediated by 2 different functional states
of sphingosine kinase-1 (SK-1). Mice depleted of SK-1 have increased vascular
leakiness, whereas mice transgenic for
SK-1 in ECs show attenuation of leakiness. Furthermore, Ang-1 rapidly and transiently stimulates SK-1 activity and phosphorylation, and induces an increase in
intracellular sphingosine-1-phosphate
(S1P) concentration. Overexpression of
SK-1 resulted in inhibition of permeability
similar to that seen for Ang-1, whereas
knockdown of SK-1 by small interfering
RNA blocked Ang-1-mediated inhibition
of permeability. Transfection with SKS225A,
a nonphosphorylatable mutant of SK-1,
inhibited basal leakiness, and both SKS225A
and a dominant-negative SK-1 mutant removed the capacity of Ang-1 to inhibit
permeability. These effects were indepen-
dent of extracellular S1P as knockdown
or inhibition of S1P1, S1P2, or S1P3, did
not affect the Ang-1 response. Thus, SK-1
levels in ECs powerfully regulate basal
permeability in vitro and in vivo. In addition, the Ang-1–induced inhibition of leakiness is mediated through activation of
SK-1, defining a new signaling pathway in
the Ang-1 regulation of permeability.
(Blood. 2008;111:3489-3497)
Introduction
The control of vascular homeostasis is mediated through the
maintenance of endothelial cell (EC) monolayer integrity, which is
responsible for the tonic impermeable nature of blood vessels.
Altered endothelial integrity underlies changes in vascular permeability, as seen in inflammatory responses and angiogenesis, and in
diseases, such as rheumatoid arthritis and atherosclerosis. Stimuli,
such as thrombin, histamine, and tumor necrosis factor (TNF), are
powerful inducers of EC permeability,1 whereas the angiogenic
factor angiopoietin-1 (Ang-1), acting through the tyrosine kinase
receptor Tie2, and sphingosine-1-phosphate (S1P), acting through
the G protein coupled receptors S1P1 or S1P3, inhibit the action of
these stimulators and are potent protectors of barrier function.2-4
The Ang-1/Tie2 axis is essential for vascular development and,
in the adult, for the formation and maintenance of EC integrity.2 In
vivo, transgenic expression of Ang-1 in mice results in leakage
resistant blood vessels,5 and systemic administration of Ang-1
inhibits vessel leak.6 In vitro, the antipermeability and antiinflammatory effects of Ang-1 appear to function at 2 levels, one to
inhibit the basal permeability of EC and the other to limit the
activity of agents, such as thrombin and TNF.3 The signaling
pathways regulated in response to ligand-induced phosphorylation
of Tie2 are only now being elucidated.7 AKT is involved in the
prosurvival and angiogenic activities of Ang-1.8 Interaction of
ShcA with Tie2 and phospholipase D-dependent regulation of
mitogen-activated protein kinase (MAPK) are involved in Ang-1mediated cell migration9 and a Ras/MAPK cascade is responsible
for Ang-1–induced cell proliferation.10 We have shown that Ang-1
inhibits thrombin-induced activation of Rho- and Ca2⫹-dependent
pathways, together with a newly described protein kinase C (PKC)
␨-dependent signaling pathway.11 In addition, Jho et al12 have
shown that Ang-1 inhibits vascular endothelial cell growth factor
(VEGF)-induced phospholipase C-inositol-1,4,5-trisphosphate
(PLC-IP3)-dependent Ca2⫹ influx to inhibit EC permeability.
Because Ang-1 can regulate multiple pathways implicated in EC
permeability, we sought to determine whether it affects other
signaling pathways.
Sphingosine kinase (SK) regulates the conversion of sphingosine into its biologically active metabolite, S1P. SK-1 is activated by a variety of stimuli, including serum, VEGF, plateletderived growth factor, and hyperglycemia,13 and is involved in
promoting cell survival and proliferation. SK-1 is also involved in
estrogen-dependent regulation of tumor cell growth and survival,
and elevated levels of SK-1 are seen in some human tumors.14
Several effects of SK-1, for example, estrogen-dependent
cancer growth, are the result of autocrine or paracrine effects
of extracellular S1P,15 acting through G protein-coupled cell
surface receptors that belong to the endothelial differentiation gene
receptor family, and are now referred to as S1P1-5. These S1P
receptors regulate proliferation, survival, and differentiation.16
S1P1 is essential for vascular maturation and in mature ECs, S1P
regulates migration17 and inhibits permeability through S1Preceptor-dependent mechanisms.4 Interestingly, activated protein C
also mediates its barrier protective effects through S1P receptors.18
FTY720, an analog of S1P, inhibits VEGF-induced permeability,
Submitted May 24, 2007; accepted December 29, 2007. Prepublished online
as Blood First Edition paper, January 16, 2008; DOI 10.1182/blood-2007-05092148.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
The online version of this article contains a data supplement.
BLOOD, 1 APRIL 2008 䡠 VOLUME 111, NUMBER 7
3489
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
3490
BLOOD, 1 APRIL 2008 䡠 VOLUME 111, NUMBER 7
LI et al
angiogenesis, and tumor vascularization.19 Other effects of SK-1,
such as the induction of a novel PECAM-1–dependent signaling
pathway, are the result of intracellular effects of the signaling
system,20 although the intracellular receptors for S1P are yet to be
identified.
Here we investigate the role of the SK-1–S1P axis in regulating
vascular permeability and describe 2 important findings. The first is
that SK-1 controls the tonic impermeable nature of blood vessels.
The second is that Ang-1 exerts its antipermeability effects through
SK-1 independent of the action of exogenous S1P.
Methods
The experimental procedures were approved by the Animal Ethics Committee of the Institute of Medical and Veterinary Science and conform to the
guidelines established by the Australian Code of Practice for the Care and
Use of Animals for Scientific Purposes.
Reagents
Ang-1 was obtained from R&D Systems (Minneapolis, MN). n,n-Dimethylsphingosine (DMS) and S1P were purchased from Biomol Research Laboratories
(Plymouth Meeting, PA). [␥-32P]ATP was from Geneworks (Adelaide, Australia). JET-013 was from Cayman (Ann Arbor, MI) and VPC 23 019 was from
Avanti Polar Lipids (Alabaster, AL). The kinase inhibitor U0126 was from Cell
Signaling Technology (Danvers, MA).
Cells and cell culture
Umbilical cords were collected after consent was obtained in accordance
with the Declaration of Helsinki. Human umbilical vein endothelial cells
(HUVECs) were grown as described.21 Cells were used at passage 4 or less.
SK-1 and recombinant adenoviral constructs
Wild-type human SK-1, FLAG, and mutants possessing an alanine at
position 225 (SK-1S225A) or an aspartate at position 82 (SK1G82D) were
made as previously described.22,23 Recombinant adenoviruses were
made by subcloning Kpn I/XhoI fragments from pcDNA3-SK-1 constructs into the pAdEasy-1 vector (Qbiogene, Irvine, CA). Virus was
amplified in HEK293 cells and purified by CsCl gradient ultracentrifugation. Virus titers were determined using the TCID50 method, as
recommended by Qbiogene. For infection with adenoviral constructs,
HUVECs were grown to 80% confluence and exposed to one plaque
forming unit/cell for 2 hours in M119 medium with 2% fetal calf serum
(FCS) and a further 22 hours with medium containing 20% FCS.
SK-1 transfection with small interfering RNA
Small interfering RNA (siRNA) targeted to human SK-1 [r(GAGCUGCAAGGCCUUGCCC)d(TT) and r(GGGCAAGGCCUUGCAGCUC)d(tt)]
and control nonsilencing siRNA [r(UUCUCCGAACGUGUCACGU)d(TT)
and r(ACGUGACACGUUCGGAGAA)d(TT)] were synthesized by
QIAGEN-Xeragon (Germantown, MD). siRNA targeted to human S1P1,
GCGGACAAGGAGAACAGCAUUAAAC and GUUUAAUGCUGUUCUCCUUGUCCGC, and human S1P3, UAGAGGAUCACGAUGGUCACCAGGA and UCCUGGUGACCAUCGUGAUCCUCUA were synthesized
by Invitrogen (Carlsbad, CA). The transfection of the siRNA into HUVECs
by using the HiPerFect transfection reagent was done according to the
manufacturer’s protocol (QIAGEN).
SK-1 activity assays
SK-1 activity was determined using d-erythro-sphingosine and [␥-32P]ATP
as substrates, as described.24
S1P levels
S1P levels were determined after metabolic labeling of cells with
[32P]orthophosphate as described.23
Endothelial permeability assays
Permeability assays were performed as described.11 HUVECs (105) were
cultured in transwells (3 ␮m; Corning Life Sciences, Acton, MA) for
24 hours in complete medium and then in 2% FCS medium for an additional
24 hours. Adenovirus-infected ECs were plated onto transwells 24 hours
after the infection, incubated in 20% FCS M119 medium for 24 hours, and
then changed to 2% FCS M119 medium for another 24 hours before assay.
siRNA-transfected cells were plated onto transwells 24 hours after transfection and incubated M119 medium with 20% FCS for another 24 hours
before the assay. Cells were pretreated with reagents in combination as
required [Ang-1 (0.2 ␮g/mL), S1P (1 ␮M), DMS (5 ␮M), VPC 23 019
(10 ␮M), and JET-013 (1 ␮M)]. Fluorescein isothiocyanate (FITC)conjugated dextran (2 ␮g, molecular weight 40 000) was added to the upper
chamber of all wells. The amount of FITC-dextran in the lower chambers of
the transwells was measured over a 30-minute period and determined by
using a LS 50B Luminescence Spectrometer (PerkinElmer, Beaconsfield,
United Kingdom; excitation wavelength, 485 nm; emission wavelength,
530 nm). Permeability is given as the amount of FITC-dextran passing from
the top chamber to the bottom chamber.
VE-cadherin staining
HUVECs were infected with empty vector (EV) or SK-1 in adenovirus.
Forty-eight hours later, the cells were replated onto LabTek slides for
45 minutes and washed with phosphate-buffered saline (PBS), fixed with
4% paraformaldehyde for 10 minutes, and permeabilized with PBS
containing 0.1% Triton X-100.
Transfected cells were plated onto LabTek slides 24 hours after the
transfection and incubated in M119 medium containing 2% FCS for another
24 hours. Cells were treated with or without Ang-1 (0.2 ␮g/mL) for 1 hour
then washed and fixed. The cells were then incubated with mouse
monoclonal anti-VE-cadherin21 overnight at 4°C, followed by Alexa Fluor
488 goat antimouse IgG (Invitrogen). They were viewed using a 40⫻ objective on an Olympus BX51 microscope (Olympus, Hamburg, Germany)
equipped with excitation filters for fluorescein and acquired to a Photometrics Cool Snap FX charge-coupled device camera (Roper Scientific,
Friedland, Germany). Images were adjusted for brightness and contrast
using V⫹⫹ software (Digital Optics, Auckland, New Zealand).
Miles assay for in vivo permeability
Miles assays were performed essentially as given in Horowitz et al.25 The
SK-1 knockout (KO) mice26 had been backcrossed with C57BL6 mice for
7 generations. SK-1 transgenic mice on the C57BL6 background were
generated by Ozgene (Bentley, Australia), where the human SK-1 gene was
injected into the nucleus via a vector driven by the Tie-2 promoter, to give
high levels of expression in the endothelial cell compartment. Mice were
injected intravenously with 200 ␮L of 0.5% Evans Blue dye. After
10 minutes, intradermal injections of PBS, VEGF (10 ng), and histamine
(1 ␮M) were given into the shaved back area (2 sites per agent). The mice
were killed 30 minutes later, and permeability was measured as the extent of
blue dye perfusion away from the injection site. For quantification, a biopsy
of the affected area was taken, the dye eluted in formamide overnight at
37°C, and the absorbance read at 620 nm.
Immunoprecipitation and immunoblotting
Cells were grown to confluence and then changed to 2% FCS for 24 hours
before treatment with Ang-1. Immunoblotting was performed essentially as
given by Li et al.11 For each immunoprecipitation, 500 ␮g protein was used.
A monoclonal mouse anti-PECAM-121 or anti-Tie2 (Upstate, Lake Placid,
NY) antibody was used. Antibodies used for probing were a monoclonal
antiphosphotyrosine antibody (Cell Signaling), a polyclonal rabbit antiphospho-extracellular signal-regulated kinase (ERK) 1/2 antibody (Promega,
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
BLOOD, 1 APRIL 2008 䡠 VOLUME 111, NUMBER 7
ENDOTHELIAL CELL PERMEABILITY
3491
Figure 1. Ang-1 induces SK-1 activation in HUVECs. (A) HUVECs were either
untreated or treated with Ang-1 at 0.2 ␮g/mL for various times. Cells were lysed and
SK-1 activity measured. Shown are pooled data from 3 experiments and expressed
as fold change in relation to untreated group, where the SK-1 activity was normalized
to 1.0 (*P ⬍ .01 vs untreated group). (B) HUVECs were untreated (Nil) or treated with
Ang-1 at 0.2 ␮g/mL for 15 minutes. Intracellular S1P levels were determined. Data
are mean plus or minus SEM from 3 independent experiments (*P ⬍ .001 vs
untreated group).
Madison, WI), and an antiphospho-SK-1 antibody.23 After washing, membranes were incubated with horseradish peroxidase-conjugated secondary
antibody and reactive bands were detected by chemiluminescence (ECL
Western Blotting Detection Reagents, GE Healthcare, Little Chalfont,
United Kingdom). Membranes were stripped using stripping buffer (ReBlot Plus Western Blot Recycling Kit, Chemicon, Temecula, CA) and
reprobed with rabbit anti-ERK1/2 (Promega), or anti-PECAM-1, anti-Tie2,
or anti-Flag (Sigma-Aldrich, St Louis, MO) antibodies.
Statistical significance was determined using Student t test, with values
of P less than .05 considered significant.
Results
Angiopoietin-1 increases SK-1 activity and phosphorylation
in ECs
To determine the possibility that Ang-1 may signal through
SK-1, we sought initially to determine whether Ang-1 stimulated SK-1 activity. HUVECs were grown to confluence, treated
with Ang-1 at 0.2 ␮g/mL (previously shown to be optimal for
effects on ECs3) for various times, and the SK-1 activity in the
cell lysates determined. Figure 1A shows that stimulation with
Ang-1 resulted in a transient increase in endogenous SK-1
activity, which was maximal at 10 to 30 minutes. In the
3 experiments performed, stimulation with Ang-1 for 10 minutes
resulted in a 93% plus or minus 4% increase in SK-1 activity.
Furthermore, such stimulation results in a 116% plus or minus
17% increase in intracellular S1P (Figure 1B).
Ang-1 treatment induced an increase in the level of phosphorylation of SK-1, as detected by an antibody raised against the
phosphorylated form of SK-123 (Figure 2A). The level of phosphorylation was maximal 15 minutes after Ang-1 stimulation (data not
shown). SK-1 phosphorylation by agents, such as phorbol 12myristate 13-acetate and TNF, is mediated by the mitogenactivated serine/threonine protein kinases, ERK1/2.23 Ang-1 activation of its receptor, Tie2, is also known to activate ERK1/2 to
promote EC survival and migration.27 Ang-1 treatment of ECs
phosphorylates ERK1/2, which was maximal by 15 minutes, with
declining levels seen 30 minutes after stimulation (Figure 2B). The
ERK1/2 pathway inhibitor U0126 blocked the Ang-1–mediated
increase in SK-1 activity (Figure 2C) and its phosphorylation
(Figure 2A) demonstrating that Ang-1, acting through an ERK1/2dependent pathway, activates SK-1.
Figure 2. Ang-1 induces SK-1 activation in HUVECs through ERK1/2.
(A) HUVECs were infected with adenovirus carrying hSK-1-FLAG. Cells were lysed after
no treatment (Nil), treatment with Ang-1 at 0.2 ␮g/mL for 30 minutes (Ang-1), or
pretreatment with U0126 (2 ␮M for 20 minutes) followed by treatment with Ang-1
(U0126 ⫹ Ang-1). Phospho-SK-1 in the top panel and total SK-1 in the bottom panel are
shown. (B) HUVECs were untreated (⫺), or treated with Ang-1 for various times.
Phospho-ERK is shown in the top panel and total ERK in the bottom panel. (C) HUVECs
were untreated (Nil), treated with Ang-1 at 0.2 ␮g/mL for 15 minutes (Ang-1), or pretreated
with U0126 (2 ␮M) for 20 minutes and then treated withAng-1 for 15 minutes (UO126 ⫹ Ang1). The SK-1 activity was measured. Pooled data from 3 experiments are expressed as in
Figure 1A (mean ⫾ SEM; *P ⬍ .05 vs untreated cells).
SK-1 regulates endothelial cell permeability and vascular leak
in vivo
To determine whether Ang-1 acts through SK-1 to regulate
permeability, the effects on permeability of DMS, a competitive
inhibitor of SK, was examined. Pretreatment with DMS increased
the baseline permeability of ECs (Figure 3A), highlighting a
potential role of SK in regulation of permeability. In addition,
Ang-1 inhibited permeability as we have reported previously,3 and
this inhibition was partially removed by pretreatment with DMS.
These results suggested 2 things: (1) that SK may be important in
the regulation of basal EC permeability, and (2) that Ang-1 may
signal through SK to inhibit permeability.
To investigate further whether SK-1 is important in the control
of basal EC barrier function, SK-1 levels and activity were varied.
SK-1 was depleted using siRNA and RT-PCR showed that the
mRNA level was consistently reduced by approximately 70%.20
The SK-1 activity in these cells was reduced by 62% plus or minus
5% (Figure 3B), and there was an increase in basal permeability
(48% ⫾ 7%) in SK-1 siRNA-transfected cells compared with
control siRNA-transfected cells (Figure 3C). SK-1 levels were
increased by infecting cells with adenovirus carrying human SK-1
cDNA. The dose of virus was adjusted to give a 2- to 5-fold
increase above control (Figure 3D), similar to levels achieved with
endogenous increases in SK activity when stimulated with agents,
such as TNF28 and VEGF.29 In these SK-1 overexpressing cells, the
permeability was significantly decreased (Figure 3E).
Changes in EC permeability occur through regulation of
junctional integrity. The adhesion molecule PECAM-1 is a marker
for junctional integrity and has been implicated in permeability
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
3492
LI et al
BLOOD, 1 APRIL 2008 䡠 VOLUME 111, NUMBER 7
Figure 3. SK-1 regulates EC permeability changes. (A) HUVECs were
untreated (Nil) or treated with 5 ␮M DMS for 15 minutes (DMS), Ang-1
(0.2 ␮g/mL) for 30 minutes (Ang-1), or Ang-1 and DMS (Ang-1 ⫹ DMS).
Permeability is given as the FITC-dextran passage in 30 minutes. Pooled
data from 3 experiments are shown (*P ⬍ .01 vs untreated cells).
(B) HUVECs were transfected with control siRNA or siRNA against hSK-1.
After 48 hours, cells were lysed and SK-1 activity measured. Pooled data
from 3 experiments are shown and are expressed as the fold change in
relation to control cells where the SK-1 activity was set to 1.0 (*P ⬍ .001 vs
control siRNA cells). (C) HUVECs were transfected with control siRNA or
siRNA against hSK-1. Permeability was measured 48 hours later. Permeability is given as the FITC-dextran passage in 30 minutes. Pooled data
from 3 experiments are shown (*P ⬍ .01 vs control siRNA cells).
(D) HUVECs were infected with adenoviral carrying EV or human SK-1.
After 48 hours, SK-1 activity was measured. Pooled data from 3 experiments are shown and are expressed as the fold change in relation to EV
cells, which was normalized to 1.0 (*P ⬍ .001 vs EV cells). (E) HUVECs
were infected with EV or SK-1 in adenovirus. Permeability was measured
72 hours later. Permeability is given as the FITC-dextran passage in
30 minutes. Shown are pooled data from 3 experiments (*P ⬍ .01 vs EV
cells). (F) HUVECs were infected with EV or SK-1 in adenovirus. After
48 hours, cell lysates were immunoprecipitated with an anti-PECAM-1
antibody. Western blots for phosphotyrosine (top panel) and PECAM-1
(bottom panel) are shown. (G) HUVECs were transfected with control
siRNA or siRNA against hSK-1. After 48 hours, cells were lysed and
immunoprecipitated with an anti-PECAM-1 antibody. Western blots for
phosphotyrosine (top panel) and PECAM-1 (bottom panel) are shown.
(H) HUVECs were infected with EV (EV) or SK-1 (SK-1) in adenovirus.
Forty-eight hours after infection, the cells were replated onto LabTek slides
and washed and fixed 45 minutes after plating. Cells were stained with
anti–VE-cadherin antibody. For imaging information, see “VE-cadherin
staining” section in “Methods.” All data are mean plus or minus SEM.
regulation.30 Overexpression of SK-1 in HUVECs resulted in a
significant decrease in the phosphorylation of PECAM-1 (Figure
3F) consistent with tightening of junctions and a decrease in
permeability. Conversely, cells transfected with siRNA against
SK-1 had increased tyrosine phosphorylation of PECAM-1 (Figure
3G) consistent with relaxation of barrier integrity and the increase
in permeability. The SK-1 effects on tightening cell junctions were
further substantiated by the relocalization of VE-cadherin to sites
of cell-cell interactions in cells overexpressing SK-1 (Figure 3H).
To determine whether SK-1 plays a significant role in the
regulation of permeability in vivo, the classic Miles assay for
measurement of vascular permeability was used in mice deficient
in SK-1.26 We noted a significant increase in permeability in SK-1
KO mice injected with PBS alone compared with age- and
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
BLOOD, 1 APRIL 2008 䡠 VOLUME 111, NUMBER 7
ENDOTHELIAL CELL PERMEABILITY
3493
(Figure 3A), suggesting that Ang-1 and SK-1 may act through a
common pathway. To investigate the possibility that SK-1 may be
involved in Ang-1 signaling to inhibit permeability, cells were
depleted of SK-1 by siRNA. These cells failed to show an increase
in SK-1 activity after Ang-1 stimulation, whereas control siRNAtransfected cells behaved as normal, showing a 78% plus or minus
9% increase in SK-1 activity after Ang-1 stimulation (Figure 5A).
Ang-1 was able to inhibit permeability in control siRNAtransfected cells (Figure 5B), similar to normal ECs.3 However,
treatment with Ang-1 did not induce any significant inhibition of
permeability in SK-1–depleted cells (Figure 5B). Increasing the
concentration of Ang-1 used in these experiments did not have any
further functional effects (data not shown). In control cells, Ang-1
treatment resulted in an increase in VE-cadherin staining and less
diffuse staining of the cell-cell junctions (Figure 5Ci,ii). In cells
where SK-1 was depleted by siRNA, the VE-cadherin at the cell
junctions was significantly reduced and Ang-1 treatment had no
effect (Figure 5Ciii,iv), demonstrating the requirement for SK-1 in
Ang-1–mediated effects.
We have previously shown that Ang-1 mediates its effects on
permeability through the Tie2 receptor.3 The loss of Ang-1
response in the SK-1–depleted cells is not through alteration in
Tie2 receptor expression as control cells and cells treated with
siRNA to SK-1 showed similar levels of Tie2 expression. In
addition, Ang-1 treatment resulted in similar degrees of phosphorylation of the receptor in both control and siRNA-treated cells
(Figure 5D). Thus, SK-1 must act downstream of the initial
Ang-1/Tie2 signaling event, and SK-1 activity is required for ECs
to respond to Ang-1 to inhibit permeability.
Ang-1 regulation of permeability is independent of
S1P receptors
Figure 4. SK-1 regulates EC permeability and vascular leakage in vivo. (A) The
absorbances of the dye eluted from the injected areas (PBS, VEGF, and histamine) of
10 age- and sex-matched WT mice and 10 SK-1 KO mice (SK-1⫺/⫺) were read at
620 nm. The pooled results (mean ⫾ SEM) for each group of mice are shown
(*P ⬍ .05 vs WT mice injected with PBS). (B) The absorbances of the dye eluted from
the injected areas of 8 age- and sex-matched WT mice and 8 SK-1 transgenic mice
(SK-1⫹/⫹) were read at 620 nm. The pooled results (mean ⫾ SEM) for each group of
mice are shown (*P ⬍ .05 vs the WT mice injected with PBS).
sex-matched wild-type (WT) mice. No further increase in vascular
leak was achieved after VEGF or histamine stimulation in these
mice, although the WT controls responded to these stimuli (Figure
4A). Further confirmation of a role for SK-1 in regulation of basal
permeability was obtained using transgenic mice overexpressing
SK-1 in endothelial cells. These mice show a 2-fold increase in
SK-1 activity in organs, such as spleen, lung, and heart (data not
shown). Permeability measurements showed a decrease in Evans
Blue dye with subcutaneous injection of PBS. When challenged
with VEGF or histamine, WT mice responded, showing an increase
in permeability, whereas the SK-1 transgenic mice showed a
suppressed VEGF or histamine response (Figure 4B). Analysis of
plasma VEGF (Figure S1, available on the Blood website; see the
Supplemental Materials link at the top of the online article) and the
number of blood vessels showed no significant differences between
the WT, KO, and transgenic animals.
SK-1 mediates the Ang-1 effects on permeability
Ang-1 treatment of ECs inhibits their permeability. Treatment of
the cells with both DMS and Ang-1 reversed the effect of DMS
Extracellular S1P regulates permeability through S1P1 and S1P3.31
To determine whether extracellular S1P is involved in the ability of
Ang-1 to inhibit permeability, cells were depleted of S1P1 and S1P3
using siRNA. RT-PCR showed a 70% to 80% decrease in mRNA
level (Figure S2). Cells transfected with control siRNA responded
to both Ang-1 and S1P showing an inhibition of permeability
(Figure 6A). Knockdown of S1P1 with siRNA removes most of the
S1P-mediated inhibition of permeability.31 However, the Ang-1
effect on permeability remains intact (Figure 6A). Knockdown of
S1P3 did not alter the inhibitory effects of S1P or Ang-1 on
permeability, indicating that in our system S1P predominantly
signals through S1P1. Further, when S1P1, S1P2, and S1P3 receptors
were inhibited using the inhibitors JET-013 and VPC23019, which
are directed to S1P232 or S1P1 and S1P3,33 respectively, the
S1P-mediated reduction in permeability was abrogated, but Ang-1
remained able to function (Figure 6B). Thus, Ang-1–mediated
inhibition of permeability is independent of exogenous S1P
activation of the S1P receptors, S1P1, S1P2, and S1P3.
SK-1 activation is necessary for Ang-1–mediated
EC permeability
SK-1 possesses both intrinsic catalytic activity and activity that can
be activated. We have previously used 2 mutants to dissect out
these activities. The first is a catalytically inactive version of SK-1,
SKG82D, which acts in a dominant-negative manner to specifically
inhibit SK-1 activation without altering basal SK-1 activity.22
HUVECs expressing the SKG82D mutant show no detectable change
in basal SK-1 activity, although overexpression of WT SK-1 results
in a 2- to 3-fold increase in activity (Figure 7A). Ang-1 was able to
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
3494
BLOOD, 1 APRIL 2008 䡠 VOLUME 111, NUMBER 7
LI et al
Figure 5. SK-1 mediates the Ang-1 effects on permeability. (A) HUVECs were transfected with control
siRNA or siRNA against hSK-1. After 48 hours, cells
were treated with or without Ang-1 for 30 minutes and
SK-1 activity measured. Pooled data from 3 experiments are shown and are expressed as the fold change
in relation to untreated control cells where the SK-1
activity was set to 1.0 (*P ⬍ .001 vs control siRNA cells
without treatment). NS indicates no significant difference versus SK-1 siRNA cells without treatment.
(B) HUVECs were transfected with control siRNA or
siRNA against hSK-1. Forty-eight hours later, cells
were untreated or treated with Ang-1 (0.2 ␮g/mL) for
30 minutes, and permeability is measured. Permeability is given as the FITC-dextran passed after
30 minutes. Pooled data from 3 experiments are shown
(mean ⫾ SEM; *P ⬍ .01 vs control siRNA cells without
treatment). NS, vs SK-1 siRNA cells without treatment.
(C) HUVECs were transfected with control siRNA
(Ci and Cii) or siRNA against hSK-1 (Ciii and Civ).
Forty-eight hours later, cells were untreated (Ci and
Ciii) or treated (Cii and Civ) with Ang-1 for 1 hour and
then stained for VE-cadherin. In panel Ci, arrow shows
diffuse, broad VE-cadherin staining with classic zipperlike pattern indicative of immature junctions. In panel
Cii, arrow indicates increased VE-cadherin staining at
the junctions, with a more linear staining pattern indicative of mature EC junctions. (D) HUVECs were transfected with control siRNA or siRNA against hSK-1.
Forty-eight hours later, cells were untreated (⫺) or
treated (⫹) with Ang-1 (0.2 ␮g/mL) for 30 minutes then
were lysed and immunoprecipitated with an anti-Tie2
antibody. Western blots for phosphotyrosine (top panel)
and Tie2 (bottom panel) are shown. For imaging
information, see “VE-cadherin staining” section
in “Methods.”
promote SK-1 activity in both control and WT SK-1–transfected
cells but failed to affect SK-1 activity levels in SKG82D-transfected
cells (Figure 7A), WT SK-1–transfected cells inhibited permeability and Ang-1 treatment failed to exert any further inhibition. The
SKG82D-transfected cells showed no change in basal permeability
compared with control cells and failed to respond to Ang-1 (Figure
7B). Activation of SK-1 in response to TNF and PMA occurs via
ERK1/2-mediated phosphorylation of SK-1 at serine 225.23 Mutation of this serine results in a nonphosphorylatable protein that,
although having full intrinsic catalytic activity, cannot be activated
and fails to translocate to the plasma membrane in an agonistdependent manner.23 In HUVECs, expression of the SKS225A
mutant increased the cellular SK-1 activity (Figure 7A), similar to
the increases seen in other cell types.23,34 Consistent with this
enhanced cellular SK-1 activity, permeability was decreased in
these SKS225A-transfected cells (Figure 7B). However, Ang-1 did
not increase SK-1 activity in SKS225A-transfected cells (Figure 7A)
and did not inhibit further their permeability (Figure 7B), consistent with the inability of this mutant to be phosphorylated in
response to Ang-1 (Figure 7C). Taken together, these results show
that the Ang-1 inhibition of EC permeability is mediated in part
through SK-1 and requires the activation of SK-1.
Discussion
This study has demonstrated distinct and critical roles for
2 important regulators of endothelial cell function in the control of
vascular permeability. First, we show that basal levels of SK-1 are,
in part, responsible for the impermeable basal state of ECs and the
vascular system in vivo. Second, we define a novel signaling
pathway that mediates the antipermeability effects of Ang-1,
involving the activation of SK-1.
The SK-1 enzyme has 2 functional states. One is intrinsic
catalytic activity independent of post-translational modifications,
which is probably responsible for housekeeping roles. The other is
agonist-induced activation resulting from phosphorylation of serine
225, which increases its Vmax by 14-fold and is responsible for its
oncogenic function.23
Our results here support a new role for the intrinsic activity of
SK-1, that of regulation of the basal impermeable nature of ECs.
The key experiments supporting this contention were the increased
permeability in cells depleted of SK-1 and the inhibition of basal
permeability by not only WT SK-1, a molecule that increases basal
levels and is also activatable, but also by SKS225A, which only
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
BLOOD, 1 APRIL 2008 䡠 VOLUME 111, NUMBER 7
Figure 6. Ang-1 inhibition of EC permeability is independent of the S1P
receptor. (A) HUVECs were transfected with control siRNA, siRNA against S1P1 or
against S1P3. Seventy-two hours after transfection, cells were untreated (Nil), treated
with Ang-1 for 30 minutes (Ang-1), or treated with S1P at 1 ␮M for 15 minutes (S-1-P)
and permeability measured. Permeability is given as the FITC-dextran passage in
30 minutes. The pooled data from 3 experiments are shown (*P ⬍ .01 vs untreated
cells). NS indicates no significant difference versus untreated cells. (B) HUVECs
were untreated (Nil), treated with Ang-1 (Ang-1) 0.2 ␮g/mL for 30 minutes, S1P (S1P)
1 ␮M for 15 minutes, JET-013 (JET) 1␮M, and VPC 23 019 (VPC) 10 ␮M for
30 minutes (JET ⫹ VPC), or pretreated with JET-013 and VPC 23 019 for 30 minutes
then treated with Ang-1 (J ⫹ V ⫹ Ang) or S1P (J ⫹ V ⫹ S1P). Permeability is given
as the FITC-dextran passage in 30 minutes. Pooled data from 3 experiments are
shown (*P ⬍ .01 vs untreated cells). All data are mean plus or minus SEM. NS
indicates no significant difference versus untreated cells.
increases basal levels as it is incapable of being activated.23
Importantly, using SK-1 KO and transgenic mice, we also showed
that SK-1 is a regulator of permeability in vivo. Our in vitro data
thus suggest that the intrinsic catalytic activity of SK-1 is the
critical determinant of basal permeability.
Ang-1 is a powerful inhibitor of vascular permeability, as
demonstrated in in vitro and in vivo studies.3,5 The pathways
downstream of the Ang-1 receptor and Tie2-mediated regulation of
permeability involve PLC-IP3 and PKC␨11,12 and, now as shown
here, SK-1 activity. Activation of SK-1 by Ang-1 was demonstrated
by changes in activation, namely, rapid increases in SK-1 activity
levels leading to increases in intracellular S1P and increased SK-1
phosphorylation. Thus, Ang-1 can be added to the growing list of
agonists activating the SK-1 pathway, all of which also activate
ERK, the kinase involved in SK-1 phosphorylation.23 In ECs, these
include inflammatory mediators, such as TNF28 and high glucose
concentrations,35 angiogenic agents, such as VEGF,29 and, as we
show here, the antipermeability agent, Ang-1. Interestingly, in
contrast to Ang-1, VEGF and TNF are inducers of vascular leakage.
Thus, it would appear that SK-1 could act as a fulcrum for both
inflammatory and anti-inflammatory effects, similar to actions
observed for agents, such as transforming growth factor-␤. The
mechanism whereby the one signaling molecule can mediate such
opposing effects is not understood at present but could lie in unique
ligand-specific signals being generated downstream of SK-1 activa-
ENDOTHELIAL CELL PERMEABILITY
3495
Figure 7. Mutation of SK-1 blocks the Ang-1 effects on permeability change.
(A) HUVECs were infected with adenoviral carrying EV, SK-1, SKG82D, or SKS225A.
After 48 hours, SK-1 activity was measured from cells that were either untreated (⫺)
or treated with Ang-1 (⫹). Pooled data from 3 experiments are shown, expressed as
the fold change in relation to EV untreated cells, normalized to 1.0 (*P ⬍ .01
versus untreated EV-infected cells or untreated SK-1-infected cells). NS indicates no
significant difference versus untreated SKG82D or untreated SKS225A cells.
(B) HUVECs were infected with EV, SK-1, SKG82D, or SKS225A in adenovirus. After
72 hours, cells were either untreated (⫺) or treated with Ang-1 (⫹) for 30 minutes and
permeability measured. Permeability is given as the FITC-dextran passage in
30 minutes. Shown are the pooled data from 3 experiments (*P ⬍ .01 vs nontreated
EV-infected cells). NS indicates no significant difference versus untreated SK-1,
SKG82D, or untreated SKS225A-infected cells. All data are mean plus or minus SEM.
(C) HUVECs were infected with SK-1 or SKS225A in adenovirus. Forty-eight hours
after infection, cells were lysed after either no treatment (⫺) or treatment with Ang-1
(⫹). Phospho-SK-1 is shown in the top and total SK-1 in the bottom panel.
tion, perhaps mediated through the ability of SK-1 to interact with
multiple binding partners.
Support for the role of SK-1 activation mediating the inhibitory
action of Ang-1 on permeability came from experiments using
2 mutants of SK-1. SKG82D is a catalytically inactive mutant that
acts in a dominant-negative manner to block activation of SK-1,
but not basal (intrinsic) SK-1 activity.22 Overexpression of SKG82D
in ECs did not alter basal permeability but inhibited the Ang-1
stimulation of SK-1 activity levels and inhibited the effect of Ang-1
on permeability. SKS225A has full intrinsic catalytic activity but is
incapable of ligand-mediated phosphorylation, membrane translocation, and activation.23 The oncogenic signaling potential of SK-1,
as demonstrated in in vitro and in vivo experiments, is dependent
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
3496
BLOOD, 1 APRIL 2008 䡠 VOLUME 111, NUMBER 7
LI et al
on phosphorylation-induced translocation of SK-1 to the membrane and not on the increase in catalytic activity of SK-1.34 In ECs
overexpressing SKS225A, although there was a decrease in basal
permeability, no change in SK-1 activity was elicited by Ang-1 and
no decrease in permeability was seen after Ang-1 stimulation.
These results are again consistent with the inability of this mutant
to be activated by agonists. These results also suggest that,
although Ang-1 can target SK-1 to the plasma membrane (Figure
S3A,B), this translocation of SK-1 is not essential in mediating
basal permeability changes as the SKS225A mutant, which is not able
to localize to the membrane,23 does show inhibition of basal
permeability. Taken together, these experiments using the 2 SK-1
mutants confirm the involvement of SK-1 in the regulation of EC
permeability and demonstrate that Ang-1–mediated changes in
permeability require activation of SK-1, which results in an
increase in the levels of intracellular S1P. However, the action of
Ang-1 to inhibit endothelial cell permeability is independent of
exogenous S1P, as knockdown or inhibition of the S1P1-3 receptors
ablates the S1P-mediated inhibition while leaving the Ang-1 effects
intact. Thus, the effects of Ang-1 are generated intracellularly
rather than through the extracellular actions of S1P.
Extracellular S1P inhibits EC permeability through an S1P
receptor-dependent mechanism,31 resulting in Rac activation and
the strengthening of adherens junctions by increasing the formation
of the VE-cadherin and ␤-catenin complexes,36 and by actions on
the tight junction proteins ZO-1 and ␣-catenin.37 Our results
suggest that the SK-1–dependent Ang-1–mediated signaling pathway is not produced through extracellular S1P. First, the Ang-1–
mediated responses are independent of the S1P1-3 receptors; and
second, alteration in SK-1 levels has no effect on Rac activity, even
though we see changes in the actin cytoskeleton (Figure S4).
Although we and others have previously reported that Ang-1 is able
to regulate many of the pathways involved in permeability
changes,11,12 which of these or perhaps other pathways is accessed
through the SK-1 signaling cascade remains to be determined.
In summary, we propose that the SK-1 regulation of permeability falls into 2 categories: (1) the control of basal tonic permeability
mediated by the intrinsic catalytic activity of SK-1, and (2) that
after an activation event. In this case, Ang-1, acting through
multiple pathways, including via intracellular SK-1, will act to
dampen inflammatory responses, inhibit the action of the stimulators of vascular leakage, and return the vessel to its normal
impermeable nature. Thus, the generation of inhibitors of intracellular SK-1 that are being contemplated for diseases, such as cancers
and atherosclerosis, will have to take into account the multiple
facets of this signaling pathway.
Acknowledgments
The authors thank Jenny Drew and Anna Sapa for excellent
technical assistance and the staff at the Women’s & Children’s
Hospital and Burnside War Memorial Hospital for collection of
umbilical cords.
This work was supported by grants from the National Health &
Medical Research Council of Australia and the National Heart
Foundation of Australia. J.R.G. is a Medical Foundation Fellow,
University of Sydney.
Authorship
Contribution: X.L. and M.S. performed research; M.P. and C.S.B.
performed animal studies; X.L., C.N.H., M.A.V., and J.R.G.
designed research; R.L.P. kindly provided SK-1 knockout mice;
S.M.P. and P.X. contributed expert guidance; X.L. and J.R.G. wrote
the paper.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Jennifer R. Gamble, Centenary Institute of
Cancer Medicine and Cell Biology, Locked Bag #6, Newtown,
NSW 2042, Australia; e-mail: [email protected].
References
1. Mehta D, Malik AB. Signaling mechanisms regulating endothelial permeability. Physiol Rev. 2006;
86:279-367.
2. Suri C, Jones PF, Patan S, et al. Requisite role of
angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis. Cell. 1996;87:11711180.
3. Gamble JR, Drew J, Trezise L, et al. Angiopoietin-1 is an antipermeability and anti-inflammatory agent in vitro and targets cell junctions. Circ
Res. 2000;87:603-607.
4. McVerry BJ, Garcia JG. Endothelial cell barrier
regulation by sphingosine 1-phosphate. J Cell
Biochem. 2004;92:1075-1085.
5. Thurston G, Suri C, Smith K, et al. Leakage-resistant blood vessels in mice transgenically overexpressing angiopoietin-1. Science. 1999;286:25112514.
6. Thurston G, Rudge JS, Ioffe E, et al. Angiopoietin-1 protects the adult vasculature against
plasma leakage. Nat Med. 2000;6:460-463.
ShcA protein binds tyrosine kinase Tie2 receptor
and regulates migration and sprouting but not
survival of endothelial cells. J Biol Chem. 2004;
279:13224-13233.
10. Kim I, Ryu YS, Kwak HJ, et al. EphB ligand, ephrinB2, suppresses the VEGF- and angiopoietin
1-induced Ras/mitogen-activated protein kinase
pathway in venous endothelial cells. FASEB J.
2002;16:1126-1128.
11. Li X, Hahn CN, Parsons M, Drew J, Vadas MA,
Gamble JR. Role of protein kinase Czeta in
thrombin-induced endothelial permeability
changes: inhibition by angiopoietin-1. Blood.
2004;104:1716-1724.
12. Jho D, Mehta D, Ahmmed G, et al. Angiopoietin-1
opposes VEGF-induced increase in endothelial
permeability by inhibiting TRPC1-dependent Ca2
influx. Circ Res. 2005;96:1282-1290.
13. Olivera A, Spiegel S. Sphingosine kinase: a mediator of vital cellular functions. Prostaglandins
Other Lipid Mediat. 2001;64:123-134.
7. Brindle NP, Saharinen P, Alitalo K. Signaling and
functions of angiopoietin-1 in vascular protection.
Circ Res. 2006;98:1014-1023.
14. Sukocheva OA, Wang L, Albanese N, Pitson SM,
Vadas MA, Xia P. Sphingosine kinase transmits
estrogen signaling in human breast cancer cells.
Mol Endocrinol. 2003;17:2002-2012.
8. DeBusk LM, Hallahan DE, Lin PC. Akt is a major
angiogenic mediator downstream of the Ang1/
Tie2 signaling pathway. Exp Cell Res. 2004;298:
167-177.
15. Sukocheva O, Wadham C, Holmes A, et al. Estrogen transactivates EGFR via the sphingosine
1-phosphate receptor Edg-3: the role of sphingosine kinase-1. J Cell Biol. 2006;173:301-310.
9. Audero E, Cascone I, Maniero F, et al. Adaptor
16. Pyne S, Pyne N. Sphingosine 1-phosphate sig-
nalling via the endothelial differentiation gene
family of G-protein-coupled receptors. Pharmacol
Ther. 2000;88:115-131.
17. Paik JH, Chae S, Lee MJ, Thangada S, Hla T.
Sphingosine 1-phosphate-induced endothelial
cell migration requires the expression of EDG-1
and EDG-3 receptors and Rho-dependent activation of alpha vbeta3- and beta1-containing integrins. J Biol Chem. 2001;276:11830-11837.
18. Feistritzer C, Riewald M. Endothelial barrier protection by activated protein C through PAR1dependent sphingosine 1-phosphate receptor-1
crossactivation. Blood. 2005;105:3178-3184.
19. LaMontagne K, Littlewood-Evans A, Schnell C, et
al. Antagonism of sphingosine-1-phosphate receptors by FTY720 inhibits angiogenesis and tumor vascularization. Cancer Res. 2006;66:221231.
20. Limaye V, Li X, Hahn C, et al. Sphingosine kinase-1 enhances endothelial cell survival through
a PECAM-1-dependent activation of PI-3K/Akt
and regulation of Bcl-2 family members. Blood.
2005;105:3169-3177.
21. Litwin M, Clark K, Noack L, et al. Novel cytokineindependent induction of endothelial adhesion
molecules regulated by platelet/endothelial cell
adhesion molecule (CD31). J Cell Biol. 1997;139:
219-228.
22. Pitson SM, Moretti PA, Zebol JR, et al. Expression of a catalytically inactive sphingosine kinase
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
BLOOD, 1 APRIL 2008 䡠 VOLUME 111, NUMBER 7
mutant blocks agonist-induced sphingosine kinase activation: a dominant-negative sphingosine
kinase. J Biol Chem. 2000;275:33945-33950.
23. Pitson SM, Moretti PA, Zebol JR, et al. Activation
of sphingosine kinase 1 by ERK1/2-mediated
phosphorylation. EMBO J. 2003;22:5491-5500.
24. Roberts JL, Moretti PA, Darrow AL, Derian CK,
Vadas MA, Pitson SM. An assay for sphingosine
kinase activity using biotinylated sphingosine and
streptavidin-coated membranes. Anal Biochem.
2004;331:122-129.
25. Horowitz JR, Rivard A, van der Zee R, et al. Vascular endothelial growth factor/vascular permeability factor produces nitric oxide-dependent
hypotension: evidence for a maintenance role in
quiescent adult endothelium. Arterioscler Thromb
Vasc Biol. 1997;17:2793-2800.
ENDOTHELIAL CELL PERMEABILITY
etin-1–induced MEK/ERK phosphorylation and
migration in endothelial cells. Biochem Biophys
Res Commun. 2003;308:101-105.
3497
smooth muscle cells by an EDG-5 antagonist.
Biochem Biophys Res Commun. 2002;299:483487.
28. Xia P, Wang L, Gamble JR, Vadas MA. Activation
of sphingosine kinase by tumor necrosis factoralpha inhibits apoptosis in human endothelial
cells. J Biol Chem. 1999;274:34499-34505.
33. Davis MD, Clemens JJ, Macdonald TL, Lynch
KR. Sphingosine 1-phosphate analogs as receptor antagonists. J Biol Chem. 2005;280:98339841.
29. Shu X, Wu W, Mosteller RD, Broek D. Sphingosine kinase mediates vascular endothelial
growth factor-induced activation of ras and mitogen-activated protein kinases. Mol Cell Biol.
2002;22:7758-7768.
34. Pitson SM, Xia P, Leclercq TM, et al. Phosphorylation-dependent translocation of sphingosine
kinase to the plasma membrane drives its oncogenic signalling. J Exp Med. 2005;201:49-54.
30. Newman PJ, Hillery CA, Albrecht R, et al. Activation-dependent changes in human platelet PECAM-1: phosphorylation, cytoskeletal association, and surface membrane redistribution. J Cell
Biol. 1992;119:239-246.
26. Allende ML, Sasaki T, Kawai H, et al. Mice deficient in sphingosine kinase 1 are rendered lymphopenic by FTY720. J Biol Chem. 2004;279:
52487-52492.
31. Garcia JG, Liu F, Verin AD, et al. Sphingosine
1-phosphate promotes endothelial cell barrier
integrity by Edg-dependent cytoskeletal rearrangement. J Clin Invest. 2001;108:689-701.
27. Yoon MJ, Cho CH, Lee CS, Jang IH, Ryu SH,
Koh GY. Localization of Tie2 and phospholipase
D in endothelial caveolae is involved in angiopoi-
32. Osada M, Yatomi Y, Ohmori T, Ikeda H, Ozaki Y.
Enhancement of sphingosine 1-phosphate-induced migration of vascular endothelial cells and
35. Wang L, Xing XP, Holmes A, et al. Activation of
the sphingosine kinase-signaling pathway by high
glucose mediates the proinflammatory phenotype
of endothelial cells. Circ Res. 2005;97:891-899.
36. Lee MJ, Thangada S, Claffey KP, et al. Vascular
endothelial cell adherens junction assembly and
morphogenesis induced by sphingosine-1-phosphate. Cell. 1999;99:301-312.
37. Lee JF, Zeng Q, Ozaki H, et al. Dual roles of tight
junction associated protein, zonula occludens-1,
in sphingosine-1-phosphate mediated endothelial
chemotaxis and barrier integrity. J Biol Chem.
2006;281:29190-29200.
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
2008 111: 3489-3497
doi:10.1182/blood-2007-05-092148 originally published
online January 16, 2008
Basal and angiopoietin-1−mediated endothelial permeability is regulated
by sphingosine kinase-1
Xiaochun Li, Milena Stankovic, Claudine S. Bonder, Christopher N. Hahn, Michelle Parsons, Stuart
M. Pitson, Pu Xia, Richard L. Proia, Mathew A. Vadas and Jennifer R. Gamble
Updated information and services can be found at:
http://www.bloodjournal.org/content/111/7/3489.full.html
Articles on similar topics can be found in the following Blood collections
Hemostasis, Thrombosis, and Vascular Biology (2485 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.