Acylated galactolipids in
Arabidopsis thaliana
Lovisa Johansdotter Bodin
Degree project for Master of Science in Biology
Degree course in Plant molecular biology 60 hec
HT 2013-VT 2014
Examiner: Adrian Clarke
Supervisor:
Mats Andersson
Oskar Johansson
Per Fahlberg
Department of Biological and Environmental Sciences
University of Gothenburg
ABSTRACT
The membranes of the photosynthetic organelle, chloroplast, are mainly composed by a subgroup of
glycerolipids called galactolipids. Glycerolipids contain two fatty acids and one polar headgroup attached
to a glycerol backbone. In the galactolipids the polar headgroup consists of one
(monogalactosyldiacylglycerol) or two (digalactosyldiacylglycerol) galactose groups. When plants are
exposed to extreme wounding, a lot of the normal galactolipids in the chloroplast are converted into a
headgroup acylated form, containing three instead of two fatty acids. Even though the properties are not
yet resolved for these compounds their existence have been known for over 40 years, when these
headgroup acylated species were found as a response to wounding in spinach. Even though the response
is quite extreme it was not studied in further detail for a long time. In Arabidopsis thaliana and some other
plant species the acylated galactolipids have been shown to contain oxidized fatty acids called oxophytodienoic acids. These forms of galactolipids are named Arabidopsides. The ability to form headgroup
acylated galactolipids have been shown to be conserved, compared to the ability to form Arabidopsides,
throughout the plant kingdom. The enzyme responsible for the acyl transfer in galactoplipids has been
isolated from oat and the closest gene match in Arabidopsis thaliana is located at locus At2G42690. This
project shows that heterologous expression of the gene from Arabidopsis thaliana in E.coli gives an
enzyme with acyl transfer properties in vitro. To study the importance of this enzyme in vivo, viability of
knockout lines were tested with different stresses like UV, cold and bacteria. No direct differences could
be confirmed between the knockout lines and the normal plants.
SAMMANFATTNING
Membranen hos fotosyntetiserande organeller, kloroplaster, är främst uppbyggda av en undergrupp till
glycerolipider som kallas galaktolipider. Glycerolipider innehåller två fettsyror och en polär huvudgrupp
ihopbundna
av
en
glycerolmolekyl.
I
galaktolipider
består
huvudgruppen
av
en
(monogalaktosyldiacylglycerol) eller två (digalaktosyldiacylglycerol) galaktosgrupper. När växter utsätts
för extrem skada omvandlas mycket av de normala galaktolipiderna till en sort som har en tredje fettsyra
acylerad till huvudgruppen. Även om egenskaperna hos dessa molekyler inte är kartlagda än så har deras
existens varit känd i 40 år då de först upptäcktes som en respons på skada i spenat. Även om responsen
visade sig vara relativt extrem har den inte studerats mer ingående förrän nu. I Arabidopsis thaliana, och
några fler arter, kan de huvudgrupps-acylerade galaktolipiderna innehålla en oxiderad variant av fettsyra
som kallas oxo-fytodienoik syra. Denna typ av galaktolipider kallas för Arbidopsider. Möjligheten att
producera huvudgrupps-acylerade galaktolipider har visat sig vara väl bevarat i växtriket till skillnad från
förmågan att producera Arabidopsider. Nyligen isolerades enzymet som är ansvarigt för huvudgruppsacyleringen av galaktolipider ifrån havre och dess närmaste genmatch i Arabidopsis thaliana finns vid
locus At2G42690. Detta projekt visar att heterolog expression av genen från Arabidopsis thalinana i E.coli
har acyltransferas-aktivitet in vitro. För att studera vikten av detta enzym in vivo utsattes acyltransferasknockout-linjer för olika stressbehandlingar som UV, köld och bakterier. Ingen direkt skillnad mellan
knockout-linjerna och de normala plantorna kunde fastställas.
Keywords: Arabidopsis thaliana, MGDG, DGDG, OPDA, dnOPDA, Arabidopsides, acylated galactolipids.
ABBREVIATIONS
DAMP: danger-associated molecular pattern
DGDG: Digalactosyldiacylglycerol
dnOPDA: dinor oxo-phytodienoic acid
Effectors: effector molecules injected to the plant cell by pathogens to hinder the MAMP response.
ETI: effector triggered immunity
GMO: genetically modified organism
JA-Ile: jasmonic acid-iso leucine conjugate
MAMP: microbe-associated molecular pattern
MGDG: monogalactosyldiacylglycerol
MTI: MAMP-triggered immunity
OPDA: oxo-phytodienoic acid
PRR: pathogen recognition receptors
TABLE OF CONTENTS
INTRODUCTION ............................................. 1
Stress responses in plants ............................... 1
Chloroplast membrane lipids......................... 2
Preliminary results .............................................. 1
MATERIAL & METHODS ............................... 1
Heterologous expression of AGAP1 ............ 1
Acyl transferase assay........................................ 1
Lipase activity assay ........................................... 2
Enzyme purification............................................ 2
Plant material ......................................................... 2
DNA extraction ...................................................... 2
Genotyping............................................................... 2
Lipid extraction from plant material.......... 3
Stress treatments ................................................. 3
Quantification of hypersensitive response
........................................................................................ 3
Bacterial growth curves .................................... 3
RESULTS........................................................... 4
In vitro characterization ................................... 4
agap1 characterization in vivo ...................... 5
Abiotic stress treatments ................................. 6
HR in Agap1-1 and Lox2 .................................... 6
Resistance to bacterial growth ...................... 8
DISCUSSION..................................................... 8
CONCLUSIONS .............................................. 10
ACKNOWLEDGEMENTS ............................. 10
REFERENCES ................................................ 11
Stress responses in plants
There are two main groups of stressing agents
affecting plants: abiotic and biotic factors. An
abiotic stress factor is something that physically
or chemically affects the plant from a non-living
source. Examples of this are the access to
sunlight, water and nutrients but it can also
involve injury from a windy or a cold climate
causing mechanical wounding to the plant. The
responses of the plant to the latter are more or
less the same as for the herbivores discussed
below. Biotic factors on the other hand refer to
the stress caused by living organisms on the
plant. It could be fungi, bacteria, viruses or
herbivores. Due to a co-evolution of plants and
pathogens, an attacking organism usually needs
to be very specialized to be able to infect a
specific plant species. This commonly gives that
most pathogens only can infect one or a few
related species, because the specific tactics only
work on them, making them their host. On all
other plants, non-host, the tactics are useless
(Slater et al., 2008).
Microbial pathogens (like fungi,
bacteria and viruses) all need to somehow
penetrate the plant to be able to benefit from it.
Fungal pathogens are able to penetrate the cells
of the host by themselves while many bacteria
and viruses are in need of natural openings like
wounds or stomata. The first line of defense is
the surface of the plant involving the thick
cuticle, containing waxes plus other molecules
making the microenvironment inhospitable for
microbes, and the cell wall (Slater et al., 2008).
When a microbe attaches to the
surface, the plant can recognize molecules
specific for that type of microbe by activation of
Pattern Recognition Receptors (PRR). Examples
of these kinds of molecules are chitin and βglucans from fungi. These molecules are part of a
group of compounds classified into a MicrobeAssociated Molecular Pattern (MAMP) and are of
essential role for all the microbes of a certain
group (all fungi for example) of microbes.
Therefore recognition of both pathogenic and
non-pathogenic microbes activates this type of
defense. Activation of PRRs can also occur when
a pathogen tries to penetrate the plant and
thereby piercing the surface. This releases plant
peptides and other molecules from the cell wall,
Danger-Associated Molecular Patterns (DAMP),
which also can act as molecular cues for PRRs
activating defenses. When this line of defense is
enough to stop a pathogen attack it is called
MAMP triggered immunity (MTI) or DAMP
triggered immunity and is often an effect of
thickening and strengthening of the cell wall.
Although this kind of defense is very unspecific,
due to the wide range of molecules that can
activate it, it is very effective (Bent and Mackey,
2007).
The next step of evolutionary
arms race involves the release of effector
molecules (hereafter called effectors) from the
pathogens. These effectors often interact with
the PRR-pathway and inhibit the activation of
defenses. The plants in turn then evolved to have
resistance proteins (R-proteins) that inhibit
directly or indirectly the effects of the effectors
leading to Effector Triggered Immunity (ETI).
The response causing ETI is often due to a form
1
Acylated galactolipids in Arabidopsis thaliana
INTRODUCTION
Today the total population on Earth exceeds 7
billion people. It is predicted to reach 8 billion
before year 2025 and increase by a further 1.6
billion until 2050 (United Nations, 2013). There
are many parts of the food production process
that is in need of improvement to ensure food
security. Many different aspects contribute to
the efficiency of the process, both methods for
growing and harvesting but also the breeding of
plants. Ever since humanity started to cultivate
plants for food production we have selected the
best plants to save for next year’s sowing, slowly
adapting the plants for our needs. This
traditional breeding is a very slow process which
often results in a narrowing of the gene pool
available, making the crops more vulnerable to
for example pathogen attacks. One way of
addressing the problem is to use newer
techniques like genetically modified organism
(GMO) to generate a more efficient production.
The two most common methods classified as
GMO-methods are Agrobacterium-mediated
gene transfer and the biolistic approach (Slater
et al., 2008). Even though the restriction around
GMO is tight there are practical examples of
when these techniques have saved the
production of a specific crop (Tripathi et al.,
2008).
New techniques are needed to
keep up the fight against abiotic and biotic
stresses in order to address the growing need of
food. To be able to do so, understanding of the
underlying structure of the molecular
interactions in plants when they are exposed to
biotic and abiotic stresses are of importance.
Here the GMO-methods are also an important
tool for further research, not just a solution to
the problems. It can, for example, be used to
create null-mutants, by knocking out genes of
interest, to see how phenotypes arise when the
protein is missing. Another application for GMO
techniques are over expression of genes in vivo,
where you can evaluate what happens if you
have too much of a certain protein.
of programmed cell death called hypersensitive
response. The effector and R-proteins are much
more specific for a certain pathogen than the
MTI (Bent and Mackey, 2007).
The response to herbivores has
some overlapping features with the response to
pathogens. Although they cause more physical
damage to the plant they can also be detected by
the PRRs due to the release of DAMPs from the
wounding of the cell walls (Bent and Mackey,
2007). One of the main downstream pathways
activated upon wounding is the octadecanoid
pathway resulting in the production of
Jasmonates. These molecules are involved in
many aspects of regulation in plants, for example
reproduction, root growth and senescence
(Pauwels and Goossens, 2011). All Jasmonates
are synthesized very quickly upon wounding
which is of importance to minimize damage
done upon the tissue. Two of the first
Jasmonates in the octadecanoid-pathway are 2oxo-phytodienoic acid (OPDA) and the C16
analogue dinor-oxo-phytodienoic acid (dnOPDA). These are produced in the chloroplast
and exported to the peroxisome where they are
transformed into jasmonic acid (JA). JA, in turn,
is exported to the cytosol were it is converted
into the active form jasmonic acid-iso leucine
conjugate (JA-Ile). The phytohormone JA-Ile
indirectly induces the transcription of genes
included in pathogen defense among other
genes. This is due to proteolysis of transcription
inhibitors to these genes (Wasternack and
Hause, 2013). It has also been shown that
herbivores chose to eat plants that, due to a
mutation, cannot produce jasmonic acid over
those who can (Mafli et al., 2012). OPDA, besides
being a precursor to JA, also have several
functions of its own, causing changes in
transcription among other things. Even though it
is in the same pathway as JA-Ile, they cause
change in expression of a slightly different set of
genes (Dave and Graham, 2012, Wasternack and
Hause, 2013). These genes are often connected
to pathogen response (Dave and Graham, 2012).
(dn-)OPDA is also found in galactolipids
replacing the non-oxidized fatty acids in the
plastid membranes of Arabidopsis thaliana
(A.thaliana). These complex lipids are named
Arabidopsides.
Chloroplast membrane lipids
The chloroplast is composed mainly of four
types of lipids: monogalactosyldiacylglycerol
(MGDG), digalactosyldiacylglycerol (DGDG),
phosphatidylglycerol
(PG)
and
sulfoquinovosyldiacylglycerol (SQDG). All of
these are made from the same basic backbone
with different polar head groups attached. MGDG
and DGDG, the main focus here, are a type of
glycerolipids called galactolipids. This name is
due to that their head group is one (MGDG) or
two (DGDG) galactose groups (Buchanan et al.,
2002). The two inner membranes (thylakoid and
inner envelope) differ slightly from the
outermost membrane of the chloroplast which
contains a higher proportion of phospholipids
like phosphatidylcholine often found in other
eukaryotic membranes (Li-Beisson et al., 2013).
The fatty acid synthesis of all
plants takes place in the chloroplast, is catalyzed
by a complex called fatty acid synthase and
result in the formation of phosphatidate. To
produce
other
plastid
specific
lipids,
phosphatidate is then modified in the
chloroplast. The glycerolipids can get their fatty
acids modified beside attachments of different
head groups. (dn-)OPDA is found to be esterified
to galactolipids in the plastid membranes of
A.thaliana. OPDA and dn-OPDA are formed by
the oxidation of a trienoic fatty acid, 18 or 16
carbon atoms respectively. The first step results
in an introduction of oxygen to the fatty acid.
This can occur both site-specific with the
enzyme lox or non-enzymatically. Allene oxide
synthase (AOS) is responsible for step two which
results in the creation of an epoxy-group. The
third step involves allene oxide cyclase (AOC)
which produces a (dn-)OPDA molecule. Recent
findings put an end to the discussion whether or
not the fatty acids were esterified to the glycerol
backbone while lox2 were working. It was
shown that no newly synthesized fatty acids are
incorporated as (dn-)OPDA molecules in the
galactolipids, consequently lox2 works on the
fatty acids when they still are bound to lipids
(Nilsson et al., 2012). These lipids, containing
(dn-)OPDA molecules, are called Arabidopsides.
The name originates from the fact that they can
only be found in the Arabidopsis family, with
just a few known exceptions. Arabidopside A and
B are formed on a MGDG and C and D are formed
on DGDG. Some of these lipids were shown to
contain a third dn-OPDA/OPDA molecule
acylated to position 6’ on the galactose molecule.
These were named arabidopside E and G
respectively
(Andersson
et
al.,
2006,
Kourtchenko et al., 2007). Arabidopsides have
been suggested to work as a reservoir for fast
release of OPDA both for direct signaling and
conversion to JA-Ile. Although some of the
Arabidopsides seem to have a direct inhibition
on bacterial growth suggesting a more complex
role (Andersson et al., 2006, Kourtchenko et al.,
2007, Dave and Graham, 2012).
Even if acylation of galactolipid
head groups have been known for over 40 years,
there has not been much research focusing on
2
Acylated galactolipids in Arabidopsis thaliana
MGDG
Acyl-MGDG
Arabidopside A
Arabidopside E
DGDG
Acyl-DGDG
Arabidopside G
Figure 1) Top row: Sowing the structure of MGDG, DGDG and their headgroup acylated forms. Second row: Showing some Arabidopsides.
1
Acylated galactolipids in Arabidopsis thaliana
these species (Heinz, 1967). Part of the reason to
this is that the head group acylated species
occurs in ground tissue and not during normal
conditions, which led to the conclusion that
these species was just an artifact from the
grinding. But unlike (dn-)OPDA containing
lipids, head group acylation of non-oxidized fatty
acids to glycerolipids upon wounding are a
widespread feature in the plant kingdom (Figure
2). This conserved acyl transferring property,
from an MGDG to another MGDG, suggests that
this function is more than just a coincidence.
Preliminary results
The enzyme agap1 is reported to act as a lipase
which cleaves fatty acids from their backbone,
working preferably on phospholipids (Lo et al.,
2004). In this study, the lipase and potential acyl
transfer activity of agap1 was evaluated.
Oat was found to produce a high
amount of these headgroup acylated lipids
following tissue damage and was therefore
chosen for further investigation. A membrane
fraction obtained from oat tissue showed in vitro
acyl transfer activity in the presence of added
MGDG. The fraction with the highest enzymatic
activity was further purified with size exclusion
chromatography and subjected to proteomics.
Among the many peptides detected, one was
annotated as a “phospholipase a1-ii δ-like”.
Lipase function is half of the reaction searched
for, this gene was therefore chosen for further
studies. After the identification in oat it was
Figure 2) Showing presence of headgroup acylated MGDG
and OPDA containing lipids in different species. All species
tested were found to produce headgroup acylated MGDG
upon wounding but only the Brassicaceae family tested
positive for OPDA containing lipids.
1
preferably to find this gene in the model
organism A.thaliana. The gene at the locus
At2G42690 is the nearest gene match in
A.thaliana. The name “Acylated Galactolipid
Associated Phospholipase 1” (agap1) was
suggested for the acyltransferase enzyme.
The purpose of this study was to
establish potential phenotypes of AGAP1
knockout mutants with bacterial and physical
triggers in vivo but also to clarify the biochemical
properties of the enzyme in vitro. To be able to
resolve the interaction between agap1 and head
group acylated galactolipids, both with and
without (dn-)OPDA, the Lox2 mutant were
included in this study.
MATERIAL & METHODS
Heterologous expression of AGAP1
Overexpression of the protein, inserted in a
pGS21α vector, was carried out in E.coli (strain
pBL21 codon+). The vector gives a protein fused
with one GST and two his-tags. A site for
cleaving with enterokinase makes it possible to
remove the GST and one of the his-tags.
Overnight-cultures were grown
in LB media containing chloramphenicol (25
µg/mL) and carbenicillin (100 µg/mL) and then
added to fresh LB media with the same
supplements plus 0.2 % v/v glucose. When the
OD600 for the cultures reached 0.6 the expression
was induced by adding IPTG to a final
concentration of 1 mM. Incubation at 37 °C for
2.5 hour followed. The bacteria were harvested
by centrifugation at 5 000*gmax for 15 min, resuspended in rupture buffer (25 mM Tris-HCl,
250 mM NaCl, pH 7.7) to wash out the culture
medium and centrifuged again. Pelleted bacteria
were stored at -18 °C. When the bacteria were to
be re-suspended for purification of the enzyme
they were first slowly thawed on ice, mixed with
rupture buffer and then crushed in a French
Pressure Cell at 1 000 atm. The suspension was
centrifuged at 14 000*gmax for 30 min. After the
supernatant was poured into a new tube, it was
centrifuged
once
more
to
minimize
contamination from the pellet.
Acyl transferase assay
For each assay 2 µg MGDG purified from spinach
was dried with nitrogen gas and re-suspended in
20 µL 10 mM sodium deoxycholate (pH 7.2) by
10 minutes of sonication. For each assay, 20 µL
acetate buffer (1 M, pH 5.3) and 40 µL enzyme
extract were added to the tubes and the reaction
was carried out in a water bath (25 °C) with
shaking. The reactions were stopped by addition
Acylated galactolipids in Arabidopsis thaliana
of 200 µL ice cold butanol:metanol (3:1, with
0.05 % (w/v) BHT) at different time points (0, 5,
10, 30, 60 and 120 minutes). Incubation of the
samples was carried out on ice for 30 minutes to
extract the lipids. Phase separation was induced
by adding 200 µL heptane:ethyl acetate (3:1,
with 0.05 % (w/v) BHT) and 200 µL 5 % (v/v)
HAc. Samples were then vortexed followed by
centrifugation (2000 rpm, 10 minutes, 10 °C)
before transferring the upper phase to new
tubes and re-extracting the assays with 300 µL
heptane:ethyl acetate (3:1, with 0.05 % (w/v)
BHT). The upper phases were pooled and dried
under nitrogen flow before re-suspension of the
samples in methanol (50 µL) for assaying with
LC/MS-MS as described (Nilsson et al., 2014).
Lipase activity assay
For one assay 2 µg substrate (spinach MGDG or
PC) was dissolved in 40 µL 100 mM potassium
phosphate (0.2 % (v/v) Triton X-100, pH 6.0) by
10 minutes of sonication. The substrate-buffer
solution was mixed 1:1 with enzyme extract. To
keep the temperature constant throughout the
60 min of experiment, the reaction was carried
out in a water bath at 25 °C. Ice cold
butanol:metanol (200 µL with 0.05 % (w/v)
BHT) were added to stop the enzymatic reaction.
Hereafter the rest of the extraction is the same
as for the acyl transferase assay.
For analysis of free fatty acids on
GC, the samples had to be methylated. This was
done according to previous reports (Nilsson et
al., 2012).
Enzyme purification
After rupture of the cells, the supernatant was
diluted 1:10 in solubilization buffer (2 M UREA,
20 mM Tris-HCl, 0.5 M NaCl, 40 mM imidazole,
pH 8) and loaded onto a HisTrapTM column (HP 5
mL, GE Healthcare) using an ÄktaPrime Plus
system (GE Healthcare). To condition the system
before start, 30 mL solubilization buffer were
allowed to run through before loading of the
sample. When the sample had been loaded, the
system was washed with solubilization buffer
until the absorbance flattened out. Elution of the
protein sample was done with elution buffer (2
M UREA, 20 mM Tris-HCl, 0.5 M NaCl, 500 mM
imidazole, pH 8) and 2 mL fractions were
collected. The system was run at a speed of 1
mL/minute throughout the experiment. An SDSPAGE gel was run in order to determine if the
protein was present in the fractions consistent
with the maxima of the absorption curve. Three
fractions, containing the highest concentration
of the protein, were pooled together and loaded
on a size exclusion gel column (HiLoadTM 16/60,
SuperdexTM 200, prepgrade, GE Healthcare,
washed with gel filtrating buffer: 20 mM Tris2
HCl, 75 mM NaCl, pH 7.5). After loading of the
sample, the gel filtration buffer was allowed to
run through the system until all fractions (4 mL)
were collected. Fractions with the highest
absorption were run on a protein gel. The gels
were fixated for 3 h to overnight (50 % (v/v)
EtOH, 2 % (v/v) phosphoric acid, in deionized
water), washed in deionized water and stained
with colloidal Coomassie (170 mL MeOH, 85 g
(NH4)2SO4, 15 mL phosphoric acid (85 % (v/v)),
330 mL deionized water, 330 mg Coomassie
Blue G-250) for 1-4 days. To get a good contrast
the gels were destained in deionized water.
Plant material
A.thaliana were grown in soil and exposed to
short day conditions (8 hours light and 16 hours
dark) with temperatures of 22 °C during daytime
and 18 °C during the night in climate chambers.
Two T-DNA mutant lines were to
be characterized, Agap1-1 in Columbia-0 (Col-0)
and Agap1-2 in Wassilewskija-0 (Ws-0)
background. The Lox2 mutant was also in Col-0
background.
A cross was made, in both
directions using both mutant lines as pollen
donators, between Agap1-1 and Lox2.
DNA extraction
Leaf material was harvested with eppendorf
tubes, using the lid to cut the leaf. First the tubes
were put in -18 °C for 30 minutes whereupon
DNA extraction buffer (750 µL: 200 mM TrisHCl, 250 mM NaCl, 25 mM EDTA, 0.5 % (w/v)
SDS, pH 7.5) was added to the samples. After
incubation at 95 °C for 5 min, the tubes were left
in room temperature overnight. 750 µL
isopropanol
was
added
followed
by
centrifugation at full speed in a microcentrifuge
for 5 minutes, and the supernatant was poured
out. 70 % (v/v) ethanol was used to wash the
pellet where after the tubes were left open at 60
°C until they were completely dry. Before
storing the samples in -18 °C they were resuspended in TE-buffer.
Alternatively DNA was extracted
using a nexttecTM (Biotechnologie GmbH)
according to the manufacturer’s instructions.
Except that instead of a thermoshaker a water
bath and vortexing every 15 min was used.
Genotyping
PCR was used both for characterization of
homozygous
agap1
mutants
and
for
identification of successfully crossed mutants in
the F1 generation (Agap1-1 and Lox2). Different
reactions were carried out for gene specific and
T-DNA specific amplification in the agap1 case.
For identification of Agap1-1 mutants the
recommended primers for the mutant line were
Acylated galactolipids in Arabidopsis thaliana
used. Agap1-2 on the other hand could not be
confirmed with the T-DNA specific band even
though a new primer was designed.
The Lox2 mutant gives a
restriction site for BfmI whilst the wild type
version of the lox2 does not. When the PCR
products of the LOX2 gene are subjected to
digestion with BfmI the mutant lines will give
two bands (864 and 652 bp) instead of one band
as in the wild type (1516 bp). Primers used for
the amplification of LOX2 are the following:
GGATTATCATGATTTGCTTCTACC
and
TCAAATAGAAATACTATAAGGAACAC. Restriction
with BfmI was carried out in 37 °C overnight.
Annealing temperatures for the
different primers used were 63 °C and 58 °C for
Agap1 and Lox2 respectively. Products of the
PCR reactions, mixed with loading dye
containing gel star, were run on 1 % (w/v)
agarose gel (100 V).
Lipid extraction from plant material
Leaf discs were cut out with a cork borer and put
into glass tubes (set 1) containing 0.5 µg di17:0PC. As described (Nilsson et al., 2012), liquid
nitrogen was poured in the tubes to all samples
but the controls. When the nitrogen had
vaporized the tubes were placed in a 25 °C water
bath for 30 min (or a time series of 5, 10, 30 min
was used). Enzyme activity was stopped by
adding hot 2-propanol (with 0.05 % (w/v) BHT)
to the samples and let them boil (block heater at
105 °C for 5 min). When the samples had been
totally dried under N2, 1 mL one-phase solution
(CHCl3, methanol, water at ratio 1:2:0.8 with
0.05 % (w/v) BHT) and 30 µL HAc was added
and the tubes were put in cold room to extract
the lipids for 30 minutes. Extraction continued in
ultrasonic bath for 30 minutes or until the discs
in the samples were completely depigmented.
The samples were phase separated by adding
250 µL CHCl3 and 250 µL 0.4 M K2SO4 and then
vortexed. To speed up the separation the tubes
were centrifuged (10 minutes, 2000 rpm, 10 °C).
The lower phase was transferred to new glass
tubes (set 2). 1 mL CHCl3 was added to the first
set of tubes followed by vortex, centrifugation
and transferring of the lower phase to set 2 of
glass tubes. Set 1 of the tubes were discarded
and 1 mL of 1:1-solution (water:methanol with 5
% (v/v) HAc) was added to set 2. After
vortexing, centrifugation and transferring of the
lower phase to new glass tubes (set 3) the
samples in set 2 were re-extracted with 1 mL
CHCl3 (without BHT). The samples in set 3 were
dried under N2 and dissolved 100 µL CHCl3 and
put in freezer (-20 °C) for storage. Before
analysis with LC-MS/MS as described (Nilsson et
3
al., 2014), the samples were dried and resuspended in 50 µL methanol.
Stress treatments
Rose Bengal was used to test oxidative stress.
Seeds were sterilized by soaking them for 5
minutes in 70 % (v/v) ethanol which were
replaced with sterilizing solution (water solution
of 5 % (v/v) bleach, 0.5 % (w/v) SDS) for 20
minutes. Then the seeds were washed 5 minutes
times 3 in autoclaved water. Sterile seeds were
spread on plates (0.6 % (w/v) agar-agar, ½ MSmedia) and left for germination. Two week old
plants were transferred to plates with rose
bengal (1 mL, 1.66 mM) dispersed on the
surface.
The UV-experiment were carried
out in normal growth conditions with the
addition of UV-B light (Philips narrowband UV-B
fluorescent lamp, at a distance of 60 cm) during
light hours. Amount of exposure per day or the
number of days varied through different
experiments.
During the cold stress the light
hours were the same as in normal growing
conditions but the temperature varied between
the different experiments. Time points for
sampling varied here as well. The plants were
photographed and lipid extraction was made
from leaf discs of them. Controls for both UV and
cold experiments were taken before the stress
was applied in all experiments. To determine the
lipid profile of the different plant lines during
stress the same method was used as for the lipid
extraction for the characterization except that no
liquid nitrogen was used.
Quantification of hypersensitive response
Bacteria (Pseudomonas syringae pv. tomato)
cultures were grown on plates (Kings Broth Agar F, 50 mg/L kanamycin and 100 mg/L
rifamicin) and spread on new plates one day
before the start of the experiments. Three
different strains, expressing three different
effectors were used: AvrRpm1, AvrRps2 and
AvrRps4.
Leaf discs originating from three
plants (per line) were mixed with bacteria
suspended in 10 mM MgCl2 at an OD600=0.1 or
0.01 and vacuum infiltrated (time point zero).
After rinsing with deionized water, sunken discs
(properly infiltrated) were transferred to a 6welled plate (4 discs in each well) (Johansson et
al., 2014). Conductivity were measured during
different time points of the experiments and
plotted against time.
Bacterial growth curves
One day before experiment start, bacteria
(Pseudomonas syringae pv. Tomato) were spread
Acylated galactolipids in Arabidopsis thaliana
on a new plate (Kings Broth - Agar F, 50 mg/L
kanamycin and 100 mg/L rifampicin). Two
different strains, expressing AvrRpm1 or
AvrRps4, were used. At start up, a bacteria
suspension were prepared from 10 mM MgCl2 to
an OD600=0.00002 or 0.0001 for AvrRpm1 and
AvrRps4 respectively) for inoculation of
Arabidopsis leafs. The suspension was equally
distributed into chosen leafs by syringe pressure
infiltration. After three days of incubation, leaf
discs (made from the inoculated leaves) were
ground in MgCl2 (10 mM). Separation of the
supernatant and the remaining tissue, without
pelleting the bacteria, was accomplished by a
short centrifugation. A series of dilutions were
made from the supernatant and placed on agar
plates (Kings Broth - Agar F, 50 mg/L kanamycin
and 100 mg/L rifampicin) to grow for two days
whereafter colonies were counted. Col-0 and
rpm1-3 were used as positive and negative
control, respectively, for Agap1-1 and Lox2 in
these experiments.
RESULTS
In vitro characterization
It was desirable, after the identification in oat, to
find the ortholog in the widely studied model
plant A.thaliana. The gene at the locus
At2G42690 is the nearest match in A.thaliana. It
is 1477 bp long, contains one intron and codes
for a protein consisting of 412 amino acids. The
protein is expressed throughout the A.thaliana
plant and is present during the development
(www.arabidopsis.org). To confirm that the
closest match in A.thaliana actually has an acyl
transferase activity heterologous expression of
the gene were of interest. The protein has a
native molecular weight of ~ 46 kDa but when it
is over expressed in E.coli (using a pGS-21a
vector, containing two his-tags and on GST-tag)
the expected molecular weight is 77 kDa. When
the amino acid sequence is analyzed several
putative domains can be found: several protein
binding
sites,
lipase,
glycosylation,
phosphorylation and myristoylation domains.
The protein lacks targeting-sequence for both
chloroplast and mitochondrial localization
(www.predictprotein.org) (Lo et al., 2004).
After overexpression the E. coli
cells were ruptured and centrifuged for removal
of all insoluble cell extracts and to see where the
enzyme activity were located, if it was soluble or
membrane associated. Both supernatant and
suspension of the pellet were incubated with
spinach MGDG and both fractions showed acyl
transferase enzyme activity, although the
activity was highest in the supernatant (Figure
3). As a negative control both supernatant and
4
Figure 3) A) Protein gel showing uninduced and induced
cultures with or without the plasmid containing the AGAP1.
Also showing supernatant and pellet from ruptured cells. B)
Headgroup acylated MGDG (two types) after incubation with
either; supernatant/pellet from ruptured cells containing the
AGAP1 gene or supernatant/pellet from ruptured cells
containing an empty vector.
pellet from a culture of E. coli, containing an
empty vector, were incubated with MGDG. In
this test no headgroup acylated species could be
found. Only substrate was also analyzed and
confirmed to not give rise to any production of
headgroup acylated species.
The enzyme was purified on a
his-trap column followed by gel filtration. After
this purification the fractions in the absorption
maxima (Figure 4A) did not match with the
clearest band on the protein gels (not shown).
Protein fractions containing the enzyme can be
found later in the plateau visible after the peak
in absorbance. Several of the bands in this
plateau showed bands of similar strength.
Fractions obtained by gel filtration (Figure 4B, C)
did not match the peak in protein maxima either.
Acylated galactolipids in Arabidopsis thaliana
Figure 4) A) Absorption curve of fractions from his column purification. B) Absorption curve of fractions from gel column
purification. C) Fractions from gel column run on protein gel. Numbers corresponds to used fractions from the purification with gel
column. The arrow points at the band corresponding to the protein of interest.
In the SDS-PAGE gel the protein could be found
in fraction 21 to 24 (arrow in picture 4 C). When
an enzyme assay with the fractions from the gel
filtration was carried out, they showed very low
enzyme activity compared to the activity
obtained with the supernatant of the ruptured
cells.
agap1 characterization in vivo
To further analyze the function of agap1 in vivo
characterization of two T-DNA insertion lines,
Agap1-1 and Agap1-2, were carried out. Genespecific and T-DNA-specific PCR combined with
freeze-thaw experiment were used for this
(Figure 5 and 6). As figure 6 A shows, the Agap11 line was homozygous for the T-DNA insertion,
showing a T-DNA-specific band in the mutant
but not on the Col-0 and a gene-specific band on
Col-0 but not the mutant. The T-DNA-specific
band of the Agap1-2 remained absent. Although,
the absence of a band for Agap1-2 with genspecific primers suggests that this is
homozygous as well.
By letting the thaw-part of the
freeze-thaw experiment extend into a time
series, enzyme activity in vivo was obtained
(Figure 6). After 5 minutes the MGDG levels have
been greatly reduced and (dn-)OPDA containing
MGDG have started to rise in Col-0 (wild type).
5
At the time point of 30 minutes thawing the
acylated galactolipids starts to form. The same
was true for Ws-0 (wild type). In both the
mutants (Agap1-1 and Agap1-2) the MGDG levels
still declined and (dn-)OPDA species were
formed in 5 minutes. The acylated galactolipids
on the other hand, never started to rise. These
results could confirm that these agap1-lines
probably were homozygous for the T-DNA
insertion.
The Agap1-1 line was chosen for
further phenotyping. When the plants were
grown in normal conditions no visible
phenotypes were seen as shown in figure 7.
They show the same growth rates and flowered
at the same time as the control plants. The Lox2
mutant on the other hand, flowered a few days
earlier but otherwise behaved like Col-0 (wt).
This feature of the Lox2 mutant was previously
known (REF till lox2 pappret).
Successful crossings between Agap1-1 and Lox2
could be confirmed with PCR of the F1
generation for the LOX2 gene followed by
digestion with BfmI. Those showing three bands,
one band from the wild type version of the gene
(that could not be digested) and two bands
(from the mutant gene that has a cleaving site
for BfmI) were left to produce F2 seeds.
Acylated galactolipids in Arabidopsis thaliana
Figure 5) PCR gels of both Agap1 mutants and their controls.
A) Agap1-1. B) Agap1-2.
Abiotic stress treatments
MGDG acylation is known to be induced by
exposure of freeze-thaw, a treatment that
completely destroys integrity of the tissue
simulating extreme wounding (Nilsson et al.,
2012), but it has also been shown that it could be
induced by exposure to sub-lethal freezing
temperatures (Vu et al., 2014). The aim with
these experiments were to show whether or not
the agap1 can be activated and work on
glycerolipids without the disruption on the
membranes caused by temperatures below zero.
Some activation can be seen in Col-0 when the
plants are exposed to 1 °C. The mutant Lox2 have
a higher degree acylated species from the
beginning and a small increase can be detected
when stressed. When the plants were exposed to
-1 °C for 5 hours the amount of arabidopside E
and G almost doubled in Col-0 compared to nonexposed plants. Here the Lox2 mutant almost
tripled its production of the headgroup acylated
galactolipids (Figure 9).
Plants with down regulated
expression of AGAP1 are reported to handle UVB stress better than wild type (Lo et al., 2004). In
order to see whether this applied to knockout
lines as well, both wild type and mutant were
exposed to UV-B for different length of time
before they were visually compared and lipid
composition was measured. No apparent
differences could be observed (Figure 8). When
the plants were treated lethally with UV-B (not
shown) the newest leaf on the mutant seemed to
be a little more dark green just before the plants
became completely pale and died. The lipid
extraction did not show any direct activation of
agap1 activity. Although, the lipid composition
varied so much that these data probably are
unreliable.
6
Figure 6) Amount of MGDG, OPDA-MGDG, Acyl-OPDA-MGDG
and Acyl-MGDG 0, 5 and 30 min after freeze-thaw for Col-0
(wild type), Agap1-1, Ws-0 (wild type) and Agap1-2.
UV exposure raises the levels of
reactive oxygen species in the plant cells. Rose
Bengal is a compound that creates singlet
oxygen when it is illuminated (Halliwell, 2007).
Trials with Rose Bengals were meant to show
whether or not these acylated species are of
importance during more specific oxidative
stress. After one week of exposure, both of the
mutants (Agap1-1 and Lox2) showed no
differences compared to the wild type Col-0.
HR in Agap1-1 and Lox2
Acylated galactolipid species, both with and
without (dn-)OPDA, are known to be a response
to different stresses. The head group acylated
arabidopside E and G have been shown to have
some anti-bacterial effect leading to the question
if other acylated galactolipids also are involved
in direct or indirect response to bacteria
(Andersson et al., 2006, Kourtchenko et al.,
2007). Performing an ion leakage experiment is
an easy way to determine if agap1 or lox2 are
involved in the response to bacteria that leads to
HR. Discs of the different lines are infiltrated
with a bacterial suspension (time 0) and rinsed
with, and put into de-ionized water. Conductivity
of the water is then measured every hour to see
if there is any ion leakage from the discs. Higher
conductivity means that the infiltration results
in a higher HR. The mutant line rpm1-3 cannot
sense the presence of the effector protein
AvrRpm1, rpm1-3 in figure 10A therefore shows
how the experiment, not the bacteria, affects the
plant. The Lox2 mutant had the most prominent
phenotype during this experiment. The response
was slower than the control the first half of the
experiment but after a while the conductivity
sharply rises and sometimes exceeds the control
(not shown in the figure).
Acylated galactolipids in Arabidopsis thaliana
Figure 7) 8 weeks old A.thaliana plants. Top and bottom row are different sizes of the same age. From left: Col-0, Agap1-1, lox2.
Figure 8) 8 weeks old UV exposed A.thaliana plants. From left: Col-0, Agap1-1, lox2.
7
Acylated galactolipids in Arabidopsis thaliana
Resistance to bacterial growth
Infiltration with bacteria in the mutants seek to
show whether or not these genes are involved in
the later reactions compared to HR. To count the
colonies of the surviving bacteria gives a
comprehension about how hostile the microenvironment inside the plant is. Three days after
the syringe pressure infiltration leaf discs were
harvested. The bacteria present in these discs
are collected, re-suspended and allowed to grow
on agar plates. The colonies were counted after
two days. Col-0 was used as negative control. In
the experiment with the bacteria AvrRpm1 the
rpm1-3 mutant, used as a positive control, has a
higher amount of living bacteria in its tissue than
in the other plant lines. There were no
measureable differences in between Col-0 and
the other mutants (Figure 11). In the first
experiment with bacterial growth the colony
forming units (CFU) of Agap1-1 seemed to
exceed the one of Col-0. This was however not
consisting with follow up experiments were it
also could be lower.
Relativ Mass spectrometric signal
0,3
0,2
0,1
0
Col-0 Col-0 agap1-1 agap1-1 lox2
lox2
Control Minus1 Control Minus1 Control Minus1
Figure 9) Relative masspectometric signal of acyl-MGDG in
the different Arabidopsis strains in response to minus 1
degree celsius.
100
Col-0
agap1-1
80
Conductivity (S/m)
The Agap1-1 mutant seems to have the opposite
phenotype. Even though it could not be shown
statistically significant the HR was always a bit
higher in the Agap1-1 mutant than in the control.
More experiments are needed to confirm the
phenotype of this mutant. The phenotypes of
both of the mutants were most visible when the
bacteria expressing AvrRpm1 was used. The
effect of AvrRpt2 and AvrRps4 were similar but
lower, although the first had highest response of
those two.
lox2
rpm1
60
40
20
0
0
100
200
300
400
Time (minutes)
Figure 10) Effector AvrRpm1. Conductivity (x-axis) is
representing HR over time (y-axis). rpm1-3 is used as a
negative control. Agap1-1 is showing a possible phenotype
by having a faster raise in conductivity. lox2 on are slower in
the beginning but catches up later on.
DISCUSSION
8
8
7
6
Log 10 CFU cm-1
The first article about headgroup acylated MGDG
was published 1967 (Heinz, 1967). Not until
now, over 40 years later, the enzyme responsible
for the acyltransfer finally has been identified
and isolated. Earlier studies have pointed out the
function of this gene in the direction of a
phospholipase activity. Therefore previous
experiments were designed to test lipase
function, looking for accumulation of free fatty
acids as a function of time (Lo et al., 2004). Only
looking at agap1’s lipase function would be an
underestimation of the efficiency of the enzyme.
Biochemical evaluation of agap1’s functions,
with the knowledge of its acyltransferase
activity, has just begun.
AGAP1 was cloned into a vector
and overexpressed in E.coli. The protein
suspension obtained from the E.coli cells showed
an acyl transfer activity when mixed with MGDG.
Protein suspension of E.coli cells containing an
empty vector however showed no enzymatic
5
4
3
2
1
0
Col-0
agap1-1
lox2
rpm1
Figure 11) Bacterial growth (effector AvrRpm1) in Col-0
(wild type), Agap1-1, lox2 and rpm1-3 after three days of
inoculation. rpm1-3 is used as a positive control. Data are
displayed as log10 of colony forming units (CFU) of each line.
No significant data were obtained.
Acylated galactolipids in Arabidopsis thaliana
activity. Thereby showing that the effect seen
here in fact were an effect of the cloned gene.
This data confirm that AGAP1 codes for an
enzyme responsible for acyl transfer in vitro.
The agap1 protein was known to
be induced by grinding the plant tissue (Heinz,
1967). To test this both wild type and AGAP1
were snap-frozen in liquid nitrogen to disrupt all
membranes thereby causing an equivalent
damage as when the tissue is ground. Headgroup
alyclated galactolipids could be found in wild
type plants but not in the AGAP1 mutant. These
results show that agap1 indeed is the missing
protein responsible for the enzymatic reaction
creating headgroup acylated galactolipids upon
extreme wounding.
Overexpression of the enzyme in
these experiments was quite low which make it
more important to purify it properly. To be able
to continue the work, optimization of the
purification was needed to get a more
concentrated fraction of the enzyme. The
fractions obtained after cleaning both with histrap column and with gel filtration showcased
plenty of different bands on the protein gels. The
fact that the over expressed enzyme contains
two his tags gives opportunity to wash harsher
during his-trap purification. It also seems like
the enzyme is scattered throughout many of the
his-trap
fractions.
Increasing
imidazole
concentration in the elution buffer could
possibly result in a steeper release of the
enzyme giving a higher concentration in fewer
fractions. It is important that key substances are
new and fresh. New IPTG made no difference in
the expression. There are however other
substances that can be in need of renewal, the
antibiotic for example. If these steps fail to
provide a high concentration of the enzyme, the
reason could be that the translation machinery
of E.coli has trouble matching the eukaryotic
codons.
At present, there are different
reports regarding where the enzyme is located,
within cytosol, chloroplast or associated to the
chloroplast envelope has been suggested as
candidates (Bertrams and Heinz, 1981,
Kleffmann et al., 2004, Lo et al., 2004). Due to the
widespread ability to acylate galactolipids in the
plant kingdom it is not credibly that the
response to stresses, involving production of
these lipids, happens just by chance. The nonfreezing cold experiment presented here failed
to show an activation of the enzyme before
freezing temperatures. This suggests that the
activation is somehow induced by mechanical
wounding, giving the enzyme access to its
substrate, rather than just activation by low
temperatures. This could suggest that the
enzyme is located in the cytosol and gains access
to the galactolipids when the freezing disrupts
the membranes of the chloroplasts which are
consistent with the in vitro results of this study.
The in vitro results also point in the direction of
a localization in the cytosol due to the fact that
the enzyme activity was highest in the
supernatant from ruptured centrifuged E.coli. If
the enzyme were to be membrane associated the
activity are expected to end up in the pellet.
Enzyme activity of the gene from oat tissue was
on the other hand pelletable thereby suggesting
a membrane associated location.
The Agap1-1 line was purchased
as a homozygote whilst Agap1-2 was a so called
segregating population. This means that the
seeds can be homozygous, heterozygous or wild
type. PCR was used to genotype these lines.
Proposed homozygous plants could be selected
with the evidence that the gene-specific PCR did
not show any band at all in the mutant but were
present in the wild type. These results were to
be verified with T-DNA-specific PCR. Both the
lines were delivered with a proposed T-DNA
specific primer which in both cases turned out to
be a poor choice for PCR. Agap1-1 could be
confirmed after adjustment of the PCR program.
Even though a new primer was designed for the
T-DNA of the Agap1-2 line, selected plants of this
mutant line could not be confirmed with PCR. To
characterize the lines, a phenotypic approach
with freeze-thawing was used as a complement
to the genotypic mapping. In this case, plant
materials were frozen with liquid nitrogen,
thawed and after 0, 5 or 30 minutes all
enzymatic activity was stopped by boiling the
samples. In 5 minutes (dn)OPDA-containing
galactolipids starts to rise in the control plants
(ecotypes: Col-0 and Ws-0). After 30 minutes the
(dn)OPDA-containing
galactolipids
have
declined a bit whilst the headgroup acylated
species have started to form. The reason that the
(dn-)OPDA containing MGDG decreases after 5
minutes in the controls are that they have been
converted to the acylated form (arabidopside E
or G). The same trend is found in both Agap1-1
and Agap1-2. Most of the headgroup acylated
species contains (dn)OPDA molecules but some
headgroup acylated, with only non-oxidized fatty
acids, can also be found. Both of the mutant lines
(Agap1-1 and Agap1-2) follow the control at the
time point of 5 minutes. At 30 minutes however,
the mutants have a higher degree of (dn)OPDA
containing galactolipids and both the types of
headgroup acylated species remains low. Even
though the levels are low, some headgroup
acylated species are present in the mutants. This
could be due to a leaky mutant (still have some
protein present due to post-translation
9
Acylated galactolipids in Arabidopsis thaliana
modification) or that something else is
responsible for these headgroup acylated
species. The fact that the production has
declined with 90 % (compared to the wild type)
and that the trend looks the same in two
independent mutant lines points to the
conclusion that these are actual knock-out lines.
This means that the acylated species probably
are formed by some other reaction. These
mutant lines are here from considered as
homozygous for the T-DNA insertion which
makes them unable to produce the agap1
enzyme.
During normal growth there are
little acylated galactolipids present in a wild type
plant which make it very similar to the Agap1-1
mutant. Therefore it is not surprising that no
phenotype could be observed during these
conditions. UV and cold treatments in this study
aimed to activate this enzyme in the wild type
without causing membrane disruptions by
freezing. If the enzyme were to be activated the
differences between control and mutant would
be much bigger making it easier to screen for
occasions when the acylated galactolipids are of
importance.
Exposures
to
non-freezing
temperatures did not seem to have a big impact
on the amount of headgroup acylated species
formed. The exposure to temperatures just
below zero on the other hand seemed to activate
the enzyme’s acyltransferase activity. This
exposure could be a future tool to map the
functions of the enzyme’s products. It could also
be that the response, resulting in acylated
species, are most important at an earlier stage of
cold exposure. The shortest sampling time, in
non-freezing experiments, was 24 hours. Minus
1 °C (sampled after 5 hours) showed activation
but plus 1 °C (sampled after 24 hours) did not. In
the plus 1 °C experiment, the production of
acylated galactolipids and recovery back to
normal could have taken place before the
sampling was made. The high amount of
headgroup acylated MGDG in the Lox2 mutant
could suggest that normally when the membrane
ruptures, lox2 and agap1 compete over the same
substrates. When lox2 is missing, agap1 has
more substrate available to work on.
Arabidopside E and G have been
shown to have a reduction in bacterial growth in
vitro which gives the question if these
headgroup acylated galactolipids containing
non-oxidized fatty acids that can have similar
effects (Andersson et al., 2006, Kourtchenko et
al., 2007). Induction of the HR was tested to see
if headgropup acylated or (dn-)OPDA containing
galactolipids were generally involved in
bacterial response. lox2 have a slower response
to the bacteria at the start but caches up as the
time goes. (dn-)OPDAs can be formed nonenzymatically, although this reaction is slower
than the one catalyzed by the lox2 enzyme. This
may account for the slow start of the HR. In this
mutant headgroup acylation of galactolipids by
agap1 is still possible. Agap1-1 mutant on the
other hand showed an increased (although not
statistical significant) HR. In this mutant nonacylated Arabidopsides are created (lox2 is
active) but none of the headgroup acylated
forms are made. This proposes that the agap1
and lox2 enzyme compete over the same
substrates. (dn-)OPDA are classed as reactive
electrophilic species which means that they
probably are quite chemically reactive. Acylated
variants of these molecules could be more stable
thereby reducing the signal for cell death. The
crossing of Agap1-1 and Lox2 can possibly
answer some of the questions in the future.
10
Acylated galactolipids in Arabidopsis thaliana
CONCLUSIONS
This study showed that agap1 indeed can work
both as a lipase and an acyl transferase. More
evaluation of the enzyme with focus on acyl
transfer activity is needed to understand its
purposes during mechanical stress and why it
has been highly conserved during the evolution
of plants. Loss of agap1 function in A.thaliana
does not seem to affect the plants normal
growth. Although, plants lacking agap1 seems to
have a faster HR upon bacterial stress. The Lox2
mutant has a slower start in the HR, but recovers
and sometimes exceeds the control in response.
Several findings in this study suggest that agap1
and lox2 are competing over the same substrate.
ACKNOWLEDGEMENTS
I want to say thanks to the plant pathogen group
for all guidance and support. To my supervisors;
Mats X Andersson for all the great input on both
my report and my presentation, to Per Fahlberg
for the laughs and fun times in the lab and
especially huge thanks for putting up with me
and everything else to Oskar Johansson!
Thanks to Anders Tryggvesson,
Erik Selander, Börn Lundin, Anders Nilsson and
Panos Lymperopoulos for showing me new
methods even though I was not your student.
My time at Botan would not have
been half as entertaining without all my new
friends from the “fika-table”, thank you for
letting me in!
REFERENCES
Andersson MX, Hamberg M, Kourtchenko O,
Brunnstrom A, McPhail KL, Gerwick WH,
Gobel C, Feussner I, Ellerstrom M (2006)
Oxylipin profiling of the hypersensitive
response in Arabidopsis thaliana. Formation
of a novel oxo-phytodienoic acid-containing
galactolipid, arabidopside E. The Journal of
biological chemistry 281:31528-31537.
Bent AF, Mackey D (2007) Elicitors, effectors, and R
genes: the new paradigm and a lifetime
supply of questions. Annual review of
phytopathology 45:399-436.
Bertrams M, Heinz E (1981) Positional Specificity and
Fatty Acid Selectivity of Purified sn-Glycerol
3-Phosphate Acyltransferases from
Chloroplasts. Plant physiology 68:653-657.
Buchanan B, Gruissem W, Jones R (2002)
Biochemistry and Plant Molecular Biology of
Plants: American Society of Plant Biologist.
Dave A, Graham IA (2012) Oxylipin Signaling: A
Distinct Role for the Jasmonic Acid Precursor
cis-(+)-12-Oxo-Phytodienoic Acid (cisOPDA). Frontiers in plant science 3:42.
Halliwell G (2007) Free radicals in biology and
medicine: Oxford University Press.
Heinz E (1967) [Acylgalactosyldiglyceride from leaf
homogenates]. Biochimica et biophysica acta
144:321-332.
Johansson ON, Fantozzi E, Fahlberg P, Nilsson AK,
Buhot N, Tor M, Andersson MX (2014) Role
of the penetration-resistance genes PEN1,
PEN2 and PEN3 in the hypersensitive
response and race-specific resistance in
Arabidopsis thaliana. The Plant journal : for
cell and molecular biology 79:466-476.
Kleffmann T, Russenberger D, von Zychlinski A,
Christopher W, Sjolander K, Gruissem W,
Baginsky S (2004) The Arabidopsis thaliana
chloroplast proteome reveals pathway
abundance and novel protein functions.
Current biology : CB 14:354-362.
Kourtchenko O, Andersson MX, Hamberg M,
Brunnstrom A, Gobel C, McPhail KL, Gerwick
WH, Feussner I, Ellerstrom M (2007) Oxophytodienoic acid-containing galactolipids in
Arabidopsis: jasmonate signaling
dependence. Plant physiology 145:16581669.
Li-Beisson Y, Shorrosh B, Beisson F, Andersson MX,
Arondel V, Bates PD, Baud S, Bird D, Debono
A, Durrett TP, Franke RB, Graham IA,
Katayama K, Kelly AA, Larson T, Markham JE,
Miquel M, Molina I, Nishida I, Rowland O,
Samuels L, Schmid KM, Wada H, Welti R, Xu
C, Zallot R, Ohlrogge J (2013) Acyl-lipid
metabolism. The Arabidopsis book /
American Society of Plant Biologists
11:e0161.
Lo M, Taylor C, Wang L, Nowack L, Wang TW,
Thompson J (2004) Characterization of an
ultraviolet B-induced lipase in Arabidopsis.
Plant physiology 135:947-958.
11
Mafli A, Goudet J, Farmer EE (2012) Plants and
tortoises: mutations in the Arabidopsis
jasmonate pathway increase feeding in a
vertebrate herbivore. Mol Ecol 21:25342541.
Nilsson AK, Fahlberg P, Ellerstrom M, Andersson MX
(2012) Oxo-phytodienoic acid (OPDA) is
formed on fatty acids esterified to
galactolipids after tissue disruption in
Arabidopsis thaliana. Febs Lett 586:24832487.
Nilsson AK, Johansson ON, Fahlberg P, Steinhart F,
Gustavsson MB, Ellerstrom M, Andersson MX
(2014) Formation of oxidized
phosphatidylinositol and 12-oxophytodienoic acid containing acylated
phosphatidylglycerol during the
hypersensitive response in Arabidopsis.
Phytochemistry 101:65-75.
Pauwels L, Goossens A (2011) The JAZ proteins: a
crucial interface in the jasmonate signaling
cascade. The Plant cell 23:3089-3100.
Slater, Scott, Fowler (2008) Plant Biotechnology - the
genetic manipulation of plants. United
States: Oxford University Press Inc.
Tripathi S, Suzuki JY, Ferreira SA, Gonsalves D (2008)
Papaya ringspot virus-P: characteristics,
pathogenicity, sequence variability and
control. Molecular plant pathology 9:269280.
United Nations DoEaSA (2013) World Population
Prospects: The 2012 Revision, Highlights
and Advance Tables.
Wasternack C, Hause B (2013) Jasmonates:
biosynthesis, perception, signal transduction
and action in plant stress response, growth
and development. An update to the 2007
review in Annals of Botany. Annals of botany
111:1021-1058.
Vu HS, Roth MR, Tamura P, Samarakoon T, Shiva S,
Honey S, Lowe K, Schmelz EA, Williams TD,
Welti R (2014) Head-group acylation of
monogalactosyldiacylglycerol is a common
stress response, and the acyl-galactose acyl
composition varies with the plant species
and applied stress. Physiologia plantarum
150:517-528.
Acylated galactolipids in Arabidopsis thaliana