RESEARCH LETTER
Expression of the PitA phosphate/metal transporter of Escherichia
coli is responsive to zinc and inorganic phosphate levels
Rachel J. Jackson1, Marie R. B. Binet1, Lucy J. Lee1, Renli Ma2, Alison I. Graham1, Cameron W. McLeod2 &
Robert K. Poole1
1
Department of Molecular Biology and Biotechnology, The University of Sheffield, Western Bank, Sheffield, UK; and 2Department of Chemistry, Centre
for Analytical Sciences, The University of Sheffield, Sheffield, UK
Correspondence: Robert K. Poole,
Department of Molecular Biology and
Biotechnology, The University of Sheffield,
Western Bank, Sheffield S10 2TN, UK. Tel.:
144 114 222 4447; fax: 144 114 272 8697;
e-mail: [email protected]
Present addresses: Rachel J. Jackson, School
of Health and Related Research, The
University of Sheffield, Regent Court,
Sheffield S1 4DA, UK.
Lucy J. Lee, School of Medicine and
Biomedical Sciences, The University of
Sheffield, Beech Hill Road, Sheffield S10 2RX,
UK.
Renli Ma, School of Applied Sciences,
Northumbria University, A311 Ellison
Building, Newcastle upon Tyne, NE1 8ST, UK.
Abstract
Escherichia coli possesses two major systems for inorganic phosphate (Pi) uptake.
The Pst system (pstSCAB) is inducible by low phosphate concentrations whereas
the low-affinity transporter (pitA) has been described as constitutively expressed.
PitA catalyses transport of metal [Mg(II), Ca(II)]–phosphate complexes, and
mutations in pitA confer Zn(II) resistance. Here we report that pitA transcription
is not constitutive; activity of a single-copy pitA–lacZ transcriptional fusion
(monolysogen) was maximal at high extracellular Zn(II) (150 mM), in the absence
of added Pi, and in a well-defined pitA mutant strain. Intracellular zinc levels were
unaffected by adding Zn(II) to the medium for both the wild-type and mutant
strains. However, in the wild-type strain, Mg levels (per gram of dry biomass) fell
by eightfold in cells grown with added Zn(II) and by 20-fold when Zn(II) and Pi
were added to cultures. Mutation of pitA reduced the effects of external Zn(II) and
phosphate levels on Mg pools, consistent with competition or inhibition by Zn(II)
of PitA. The mechanism of pitA regulation by extracellular Zn(II) and Pi is
unknown but appears not to involve Fur or other well-characterized regulators.
Received 31 July 2008; accepted 26 September
2008.
First published online 22 October 2008.
DOI:10.1111/j.1574-6968.2008.01386.x
Editor: Klaus Hantke
Keywords
phosphate transport; zinc transport; metal
homeostasis; Escherichia coli .
Introduction
The biological functions of inorganic phosphate (Pi) and zinc
are well defined: both are essential elements for all life forms
and their transport mechanisms may be linked. Zinc has
distinctive structural and thermodynamic properties: it has no
redox functions, but is a good Lewis acid and fulfils a number
of control, regulatory and structural roles (Berg & Shi, 1996;
Frausto da Silva & Williams, 2001). Although normally
classed as a trace element, zinc accumulates in Escherichia coli
cells to levels comparable to those of calcium and iron
(Outten & O’Halloran, 2001) and zinc-binding proteins
FEMS Microbiol Lett 289 (2008) 219–224
account for 5–6% of the total proteome (Andreini et al.,
2006). The major inducible high-affinity Zn(II) uptake system
is the ABC transporter, ZnuABC (Patzer & Hantke, 1998), but
a further broad substrate, low affinity, constitutive zinc uptake
system exists, ZupT (Grass et al., 2005), and Zn(II) also enters
via the Pit system (Beard et al., 2000). Because Zn(II) is an
essential element, its sequestration may be an antimicrobial
mechanism: the principal E. coli-killing protein of human
skin, psoriasin, shows diminished antimicrobial activity when
the protein is Zn(II)-saturated (Glaser et al., 2005).
Phosphate occurs always in oxidation state V as phosphate, free or combined, and plays a decisive role in
2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
220
numerous metabolic processes (Frausto da Silva & Williams,
2001). Free phosphate (HPO
4 ), typically at millimolar
concentrations within cells, must be imported from outside
to sustain these levels for functioning of acid–base reactions.
Escherichia coli possesses two major systems for Pi uptake.
The pst operon is part of the pho regulon and is inducible by
below millimolar concentrations of phosphate. The Pst
system is a complex of four proteins energized by ATP and
is a member of the ABC superfamily (Webb et al., 1992;
Chan & Torriani, 1996) with a high affinity for Pi (apparent
Km around 0.2 mM) (Rosenberg et al., 1977; Willsky &
Malamy, 1980). In contrast, the low-affinity Pi transporter
(Pit) is dependent on the proton motive force for energization and has been described as constitutively expressed
(Willsky et al., 1973; Rosenberg et al., 1977, 1979). When Pi
is plentiful, this is the major uptake pathway with an
apparent Km of 25–38 mM, when measured in intact cells
(Rosenberg et al., 1977; Willsky & Malamy, 1980). A third Pi
transport gene, pitB, encodes a functional Pi transporter that
may be repressed at low Pi levels by the pho regulon (Harris
et al., 2001). Two further transporters (encoded by glpT and
uhpT) accept Pi with low affinity (Hayashi et al., 1964; Pogell
et al., 1966; Winkler, 1966) but, in the absence of Pst and Pit,
these systems cannot support growth when phosphate is
provided as Pi (Sprague et al., 1975).
Uptake of Pi via the Pit system is reliant on cotransport
with divalent metal cations such as Mg(II) or Ca(II) through
the formation of a soluble, neutral, metal–phosphate complex, which is the transported species (van Veen et al., 1994).
There is evidence that the PitA transporter is capable of
transporting alternative metals, such as Zn(II), because a
pitA mutant accumulates reduced amounts of the metal and
confers resistance to external zinc (Beard et al., 2000).
Because Pit activity contributes to both phosphate and
metal uptake, and because mutations of pitA confer resistance to zinc, we investigated whether the pitA gene was
under transcriptional control. Here we report for the first
time that pitA transcription is not constitutive, as previously
supposed, but regulated in response to levels in the medium
of zinc and phosphate and also a functional pitA gene. We
also report major changes in cellular metal content, particularly Mg(II), under these conditions, which suggest that
Zn(II) competes with, or inhibits, Mg(II) uptake.
Materials and methods
Bacterial strains and construction of a pitA
operon fusion
Escherichia coli strain RKP2914 is a monolysogen harbouring the F(pitA–lacZ) transcriptional fusion. The operon
fusion was constructed on a plasmid and then transferred to
l phage by recombination in vivo (Simons et al., 1987). The
2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
R.J. Jackson et al.
promoter was amplified by PCR using Accuzyme and oligonucleotide primers RP105 (5 0 -TTGGAATTCGGGATTCTG
GCTCAGATAAGCGCCTG) and RP106 (5 0 -TGCGGATCC
GTTGAATACCGCCGCCATAACCACGGCG) (EcoRI and
BamHI sites underlined) from chromosomal DNA extracted
from E. coli strain MG1655. The resulting purified fragment
was ligated into the site created by digestion of pRS528 with
the same enzymes and the required recombinant plasmid
isolated by transformation of strain RK4353 (Dlac) (Poole
et al., 1996). The fusion was combined onto lRS45 (Simons
et al., 1987) and single-copy fusions to the chromosome of
strain VJS676 (Dlac) were isolated and verified using bgalactosidase assays and Ter tests as before (Poole et al.,
1996). Strain RKP2935, in the same background [F(pitA–
lacZ)], carries additionally a pitA mutation, constructed by
P1 transduction from the pitA::Tn10dCam mutant, obtained
after random transposon mutagenesis and selection for
resistance to zinc (Beard et al., 2000). The precise location of
Tn10dCam has been determined by sequencing and is consistent with Hfr mapping. The downstream ORF (yhiO, now
uspB) is transcribed towards pitA and therefore most unlikely
to be subject to polar effects (Beard et al., 2000).
Media and culture conditions
Cells were grown in sidearm flasks at 37 1C, in a shaker at
150 r.p.m., in glycerol–glycerophosphate medium (GGM) in
which all sources of Pi were eliminated (Beard et al., 1997).
Buffering was achieved by MES, a zwitterionic buffer with
low metal-chelating constants (Good et al., 1966), and
phosphate was provided by b-glycerophosphate. The medium contained (all final concentrations): 40 mM glycerol,
40 mM 2-(N-morpholino)ethanesulfonic acid (MES),
18.7 mM NH4Cl, 13.4 mM KCl, 4.99 mM K2SO4, 68 mM
CaCl2, and trace elements [134 mM EDTA disodium salt,
18.5 mM FeCl3 6H2O, 6.1 mM ZnO, 0.59 mM CuCl2 2H2O,
0.34 mM Co(NO3)2 6H2O, 1.6 mM H3BO3] in distilled
MilliQ water, essentially as described before (Poole et al.,
1979). After adjusting the pH to 7.4 and autoclaving,
1.0 mM MgCl2 and 7.64 mM b-glycerophosphate (final
concentrations) were added aseptically. Chloramphenicol
(30 mg mL1) was added to plates for selection of
pitA::Tn10dCam. For b-galactosidase assays, cultures were
harvested by centrifugation at 4400 g for 10 min when they
had reached exponential phase (50 Klett units; red filter,
Manostat Corporation). Spectinomycin was added (final
concentration 300 mg mL1) 10 min before harvest to inhibit
protein synthesis, because the pitA mutant is chloramphenicol-resistant.
b-Galactosidase assay
Assays were performed at room temperature as described
previously (Poole et al., 1996). Activities are expressed in
FEMS Microbiol Lett 289 (2008) 219–224
221
Expression of PitA phosphate/metal transporter of E. coli
terms of the OD600 nm of the cell suspensions used for
permeabilization using the formula of Miller (1972). Each
culture was assayed in triplicate and using a range of sample
volumes to ensure linearity of the assay.
Trace element analysis using emission
spectroscopy
Aliquots (80 mL) of GGM, supplemented where specified
with up to 150 mM Zn(II) and 1 mM Pi, were inoculated
with starter cultures (1.5% by volume) of strains RKP2914
and RKP2935 (also grown in GGM but without supplements). Cells were collected by centrifugation and resuspended in 1 mL MilliQ water, then transferred to Eppendorf
tubes. Samples were vortexed for 30 s before centrifugation
using a Sigma microcentrifuge for 2 min at 15 000 g. The
wash with water was repeated, and then the pellet was
washed twice with 1 mL 0.5% HNO3 (Aristar nitric acid,
69% v/v) to preferentially remove metal bound to the cell
surface as established before (Beard et al., 1997). Supernatants collected from the washes were retained for analysis.
Pellets were digested by resuspension in 750 mL conc HNO3
before transfer to nitric acid-washed test tubes previously
sterilized by heating to 200 1C. Samples were heated for
45 min at 60 to 90 1C, taking care to prevent excessive
bubbling to minimize expulsion of phosphorus and sulphur.
Samples were analysed by inductively coupled plasma emission spectroscopy (ICP-ES) using a Spectro CIROSCCD
(Spectroanalytical UK Ltd) with background correction.
Calibration curves were established for each test element
using standard solutions of 0.1, 0.2, 1, 5 and 10 mg L1.
Wavelengths tested for each element were as follows: Mn
(293.930 nm), Fe (259.940 nm), Cu (224.700 nm), Zn
(213.856 nm), Mg (285.213 nm), Ca (183.856 nm), Co
(228.615 nm), P (178.287 nm) and S (182.034 nm), using
MilliQ water as a blank solution and to dilute cell digests
before ICP analysis.
To allow calculation of element concentrations on a dry
mass basis, the weights of cells were determined by filtering
10–30 mL culture, grown to OD600 nm 0.55–0.65 (Jenway
6100 spectrophotometer, 1 cm path length) in GGM,
through preweighed cellulose nitrate filters (47 mm diameter; pore size, 0.45 mm) that had been dried at 105 1C for
25 h to constant weight. Filters were then reweighed to
calculate dry cell mass per millilitre of culture.
Results
U(pitA--lacZ ) activities in the presence of zinc
and phosphate
The widely accepted view of regulation of phosphate transport in E. coli is that Pit is constitutively expressed (Rosenberg et al., 1977). Nevertheless, the finding that divalent
FEMS Microbiol Lett 289 (2008) 219–224
cations, particularly Mg(II) and Ca(II) (van Veen et al.,
1994), are essential for Pit activity and that Zn(II) ions can
be transported via this system (Beard et al., 2000), prompted
an investigation of transcriptional regulation of pitA in
response to Zn(II) and phosphate provision. Previous
studies with the zntA promoter have emphasized the importance of employing single-copy fusions rather than
plasmid-based constructs. Thus, use of a F(zntA–lacZ)
monolysogen revealed marked regulation of zntA [encoding
the Zn(II) exporter] by Zn(II), Cd(II) and Pb(II), consistent
with the ATP-driven transport of these ions (Beard et al.,
1997; Rensing et al., 1997, 1998). In contrast, a pUC-based
fusion did not respond even to 0.5 mM Cd(II) and only
slightly to 0.5 mM Pb(II) (Brocklehurst et al., 1999). The
discrepancies in these data sets may also include a contribution from the complex Luria broth medium used (Brocklehurst et al., 1999), the constituents of which can dramatically
influence metal bioavailability (Hughes & Poole, 1991).
For the present work, we therefore constructed a
F(pitA–lacZ) monolysogen using well-established methods,
and grew this strain in a chemically-defined medium
(GGM) to explore the effects of extracellular Zn(II) and Pi
on pitA expression. This medium (Beard et al., 1997; Lee
et al., 2005) not only allows phosphate concentrations to be
experimentally manipulated, but also minimizes formation
of metal phosphates and consequent unintentional loss of
metal bioavailability (Hughes & Poole, 1991). b-Galactosidase activities of strain RKP2914 [F(pitA–lacZ), pitA1] are
shown in Fig. 1a. Fusion activity (c. 250 Miller units) was
unaffected by decreasing phosphate concentration (from 1
to 0 mM added phosphate) both when the medium was not
supplemented with Zn(II) [nominally 6.1 mM Zn(II)] and
with 50 mM additional zinc. However, when the Zn(II) was
increased to 150 mM, particularly in the absence of added Pi,
there was a significant increase (typically 1.9-fold over the
basal level, P o 0.001) in F(pitA–lacZ) activity.
The Pst system is repressed at Pi concentrations 4 1 mM
and so Pit is considered to be physiologically relevant at
these higher Pi concentrations. We therefore tested the effect
of a mutation in Pit on pitA gene expression at a range of Pi
concentrations. In a pitA mutant (Fig. 1b), there was a marked
increase in F(pitA–lacZ) activity under all conditions tested.
In the absence of Zn(II) or at 50 mM Zn(II), irrespective of
phosphate concentration, there was typically a twofold increase in F(pitA–lacZ) activity relative to basal levels (Fig. 1a).
However, maximal F(pitA–lacZ) activity occurred at high
added Zn(II) (150 mM) and increased further as the phosphate concentration was reduced; maximal F(pitA–lacZ)
activity was observed without additional phosphate and was
approximately fivefold higher than basal levels.
In GGM, all phosphorus detected by ICP-ES could be
accounted for by the organic phosphate (data not shown);
because of the low Pi concentration, the Pst transport system
2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
222
R.J. Jackson et al.
Fig. 1. b-Galactosidase activities reflecting
F(pitA–lacZ) transcription in Pit1 (a) and Pit
(b) Escherichia coli strains RKP2914 and
RKP2935. Zn(II) concentrations added to GGM
[with a basal Zn(II) content of 6.1 mM Zn(II)] are
shown above each set of columns. Within each
set, decreasing phosphate concentrations
(1.0, 0.3, 0.1 and 0 mM, respectively) are shown
by the wedges. Each culture was assayed in
triplicate. Data are mean values derived from at
least three cultures; SDs are shown by the bars.
Additions of Zn(II) or Pi were without effect on
cell growth.
Table 1. Elemental composition of cells harvested from GGM supplemented with Zn and Pi and the effects of a pitA mutation
Element concentration (mg g1 dry mass cells)
GGM additions
Strain
1
2
3
4
5
6
Pit
1
Pit
Zn (mM)
Pi (mM)
Zn
Cu
Mg
Ca
P
S
–
150
150
–
150
150
–
–
1
–
–
1
0.056 0.0064
0.077 0.032
0.072 0.018
0.13 0.047
0.076
0.13 0.013
0.011 0.0057
0.028 0.011
0.021 0.013
0.0075 0.0064
0.010
0.034 0.018
0.60 0.021
0.072 0.0252
0.031 0.00141
0.27 0.0573
0.10
0.093 0.018
0.30 0.11
0.17 0.011
0.11 0.018
0.13 0.062
0.083
0.13 0.028
23 0.99
18 1.84
15 0.883
18 0.554
22
22 0.203
2.6 0.18
2.5 0.31
2.0 0.184
2.4 0.22
3.0
3.1 0.0644
Values are means of two growths and, for each, five replicate assays of the cell digests. Superscripts indicate statistical significance using the Student’s t-test:
1
P o 0.001, 2P o 0.01, 3P o 0.02, 4P o 0.05. For rows 2 and 3, the values are compared with row 1 (wild-type strain, no supplements); for row 6, the
values are compared with row 4 (pitA mutant, no supplements); for row 4, the values are compared with row 1.
will be derepressed (Rosenberg et al., 1977) and, even in the
pitA mutant, intracellular phosphate levels will be adequate.
The data of Fig. 1 are therefore consistent with pitA expression being positively regulated by Zn(II), not by phosphate
depletion. The explanation for the higher F(pitA–lacZ)
activities in the pitA mutant (Fig. 1b) is unclear but might
be linked to a reduced level of Pi in that strain; in the wildtype strain, Zn(II) is transported as a soluble, neutral
metal phosphate complex, MeHPO4, where Me represents
the divalent cation (van Veen et al., 1994). That maximal
F(pitA–lacZ) activity was observed in the absence of added
Pi, but in the presence of additional Zn(II), probably reflects
maximal bioavailability of Zn(II) in the medium allowed by
the lack of formation of metal phosphate complexes.
Trace element analyses of strains RKP2914 and
RKP2935 in the presence of zinc and phosphate
To correlate pitA transcription with total cellular levels of
zinc and phosphate, we analysed cell digests prepared after
2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
careful washing of cells to remove adventitious and looselybound metals and nutrients according to established procedures. We recognize that all elements will be determined in
these analyses, irrespective of discrete subcellular pools or
compartments, and that metal binding to cell walls is not
quantified. Intracellular zinc levels were unaffected in the
wild-type strain by Zn(II) added to the medium (Table 1).
This is anticipated, given (1) the Zn(II) homoeostatic
mechanisms employed by E. coli and (2) the presence of
adequate zinc levels in Zn(II)-unsupplemented GGM
(6.1 mM calculated; typically 5.2 mM on analysis, not shown).
The most marked change in elemental composition elicited
by added Zn(II) was in Mg: levels (per gram dry biomass)
fell by eightfold in cells grown with added Zn(II) and by 20fold when Zn(II) and Pi were added (Table 1). Because
Mg(II) is cotransported with Pi by the PitA system, the data
are consistent with competition or inhibition by Zn(II)
of this route of metal uptake. Presumably, if Zn(II) is taken
up in competition with Mg, export mechanisms such as
ZntA maintain intracellular Zn(II) homoeostasis. Cellular
FEMS Microbiol Lett 289 (2008) 219–224
223
Expression of PitA phosphate/metal transporter of E. coli
phosphorus also fell on supplementation with Zn(II) and Pi;
although the fold differences were not large, they were
statistically significant.
In the pitA mutant, zinc levels appeared to be elevated
relative to the mutant but the differences were not significant (P 4 0.05). Previously (Beard et al., 2000), we showed
that the pitA mutant accumulated higher levels of zinc when
in Zn-supplemented media [ 4 2.5 mM Zn(II)] but that
work was conducted on cultures grown in Luria–Bertani,
where medium constituents markedly reduce metal bioavailability (Hughes & Poole, 1991). Table 1 shows that the
most striking change was again in Mg levels; in the mutant,
the values (0.27 mg g1 dry cell mass) were less than one half
of the wild type (0.6 mg g1 dry cell mass) and decreased
further on addition of Zn(II) and Pi. Phosphorus levels in
the pitA mutant were slightly reduced compared with the
wild-type strain but restored on growth with Zn(II) and Pi.
Discussion
Divalent cations, such as Zn(II), Mg(II) and Ca(II) are
essential for Pi uptake via Pit (Russell & Rosenberg, 1980).
These cations, together with Co(II) and Mn(II), form with
PO3
4 a soluble, neutral metal phosphate complex, MeHPO4,
where Me represents the divalent cation (van Veen et al.,
1994). In Bacillus subtilis, uptake of these metal ions is
stimulated by Pi and a pitA mutant exhibited reduced
transport of Ca(II) and Co(II) (Kay & Ghei, 1981).
Although transport of Zn(II) via Pit was not initially
reported (van Veen et al., 1994), we showed that a Zn(II)resistant mutant carried a single insertion in pitA, and the
mutant accumulated less zinc when grown at elevated Zn(II)
levels (Beard et al., 2000). These data are consistent with the
involvement of PitA in Zn(II) uptake, probably via formation of a ZnHPO4 complex. Thus, Zn(II), Mg(II) and Ca(II)
are potential cosubstrates (with Pi) for PitA. The major
alternative route for Pi transport is the inducible Pst system
(Rosenberg et al., 1977; Willsky & Malamy, 1980). In
Salmonella, Mg(II) enters via CorA, MgtA or MgtB (Smith
& Maguire, 1998). We propose that, in a Pit1 strain, the
elevation of extracellular Zn(II) dramatically diminishes
cellular Mg levels (Table 1) by competing with these cations
and elicits a modest increase in pitA transcription. Increasing Zn(II) concentration to 150 mM is not sufficient
for elevated pitA transcription and requires additionally
reduced phosphate provision, perhaps to maximize Zn(II)
bioavailability.
Under all conditions tested, a mutation in pitA significantly increased F(pitA–lacZ) activity. In this mutant, the
major route for Pi uptake will presumably be via Pst; in
addition, Pi may enter as an analogue for either glycerol-3phosphate or glucose-6-phosphate Pi via glpT or uhpT,
respectively (Hayashi et al., 1964; Pogell et al., 1966; Winkler,
FEMS Microbiol Lett 289 (2008) 219–224
1966). In the pitA mutant, intracellular levels of Mg were less
than one half of wild-type levels and further depressed in the
presence of 150 mM zinc. This suggests that Zn(II) also
affects a Pit-independent divalent cation transport pathway.
Further work is required to explore this effect.
The mechanism of regulation of pitA transcription is not
understood. In the putative promoter (200 bp upstream of
the pitA start codon), no DNA-binding sites for the following transcription factors are evident: MerR, CueR, ZntR (all
MerR family), Zur, NikR, CusR, ZraR, CpxR and ModE.
There is a partial, poor match to the Fur consensus centred
at 33.5: GATAATGCGCCGCGTTCAT (underlining representing a match with the published site; Lavrrar & McIntosh,
2003). However, microarray ChIP-on-Chip (chromatin immunoprecipitation-on-chip) data, combined with Prodoric
prediction (http://prodoric.tu-bs.de/) of Fur sites does not
reveal any Fur site for pitA (S. Andrews, pers. commun.).
In conclusion, the data in this paper demonstrate for the
first time that pitA expression in E. coli is not constitutive.
Transcription is modulated in a chemically-defined medium
by the availability of Pi and of Zn(II), and is upregulated in a
pitA deletion mutant. The possibility of interactions between metal ions and added phosphate and the failure to
correlate readily intracellular element levels with F(pitA–
lacZ) activity makes an understanding of the mechanism
difficult. Nevertheless, the evidence points to positive regulation of pitA by free, intracellular Zn(II), with phosphate
starvation being an additional determining factor. The data
also support a model in which Zn(II), as well as other
divalent cations, is cotransported with phosphate by PitA.
Acknowledgements
We are grateful to the BBSRC for a Research Grant to R.K.P.
and C.W.McL. We are most grateful to Dr Simon Andrews
for communicating his unpublished data on Fur sites.
References
Andreini C, Banci L, Bertini I & Rosato A (2006) Zinc through
the three domains of life. J Proteome Res 5: 3173–3178.
Beard SJ, Hashim R, Membrillo-Hernández J, Hughes MN &
Poole RK (1997) Zinc(II) tolerance in Escherichia coli K-12:
evidence that the zntA gene (o732) encodes a cation transport
ATPase. Mol Microbiol 25: 883–891.
Beard SJ, Hashim R, Wu GH, Binet MRB, Hughes MN & Poole
RK (2000) Evidence for the transport of zinc(II) ions via the
Pit inorganic phosphate transport system in Escherichia coli.
FEMS Microbiol Lett 184: 231–235.
Berg JM & Shi YG (1996) The galvanization of biology: a growing
appreciation for the roles of zinc. Science 271: 1081–1085.
Brocklehurst KR, Hobman JL, Lawley B, Blank L, Marshall SJ,
Brown NL & Morby AP (1999) ZntR is a Zn(II)-responsive
2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
224
MerR-like transcriptional regulator of zntA in Escherichia coli.
Mol Microbiol 31: 893–902.
Chan FY & Torriani A (1996) PstB protein of the phosphatespecific transport system of Escherichia coli is an ATPase.
J Bacteriol 178: 3974–3977.
Frausto da Silva JJR & Williams RJP (2001) The Biological
Chemistry of the Elements. The Inorganic Chemistry of Life.
Oxford University Press, Oxford.
Glaser R, Harder J, Lange H, Bartels J, Christophers E & Schroder
JM (2005) Antimicrobial psoriasin (S100A7) protects human
skin from Escherichia coli infection. Nat Immunol 6: 57–64.
Good NE, Winget GD, Winter W, Connolly TN, Izawa S & Singh
RM (1966) Hydrogen ion buffers for biological research.
Biochemistry 5: 467–477.
Grass G, Franke S, Taudte N, Nies DH, Kucharski LM, Maguire
ME & Rensing C (2005) The metal permease ZupT from
Escherichia coli is a transporter with a broad substrate
spectrum. J Bacteriol 187: 1604–1611.
Harris RM, Webb DC, Howitt SM & Cox GB (2001)
Characterization of PitA and PitB from Escherichia coli.
J Bacteriol 183: 5008–5014.
Hayashi S, Koch JP & Lin EC (1964) Active transport of
L-a-glycerophosphate in Escherichia coli. J Biol Chem 239:
3098–3105.
Hughes MN & Poole RK (1991) Metal speciation and microbial
growth – the hard (and soft) facts. J Gen Microbiol 137:
725–734.
Kay WW & Ghei OK (1981) Inorganic cation transport and the
effects on C4 dicarboxylate transport in Bacillus subtilis. Can
J Microbiol 27: 1194–1201.
Lavrrar JL & McIntosh MA (2003) Architecture of a Fur binding
site: a comparative analysis. J Bacteriol 185: 2194–2202.
Lee LJ, Barrett JA & Poole RK (2005) Genome-wide
transcriptional response of chemostat-cultured Escherichia
coli to zinc. J Bacteriol 187: 1124–1134.
Miller JH (1972) Experiments in Molecular Genetics. Cold Spring
Harbor Laboratory, Cold Spring Harbor, New York.
Outten CE & O’Halloran TV (2001) Femtomolar sensitivity of
metalloregulatory proteins controlling zinc homeostasis.
Science 292: 2488–2492.
Patzer SI & Hantke K (1998) The ZnuABC high-affinity zinc
uptake system and its regulator Zur in Escherichia coli. Mol
Microbiol 28: 1199–1210.
Pogell BM, Maity BR, Frumkin S & Shapiro S (1966) Induction
of an active transport system for glucose 6-phosphate in
Escherichia coli. Arch Biochem Biophys 116: 406–415.
Poole RK, Waring AJ & Chance B (1979) The reaction of
cytochrome o in Escherichia coli with oxygen. Low-
2008 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
R.J. Jackson et al.
temperature kinetic and spectral studies. Biochem J 184:
379–389.
Poole RK, Anjum MF, Membrillo-Hernández J, Kim SO, Hughes
MN & Stewart V (1996) Nitric oxide, nitrite, and Fnr
regulation of hmp (flavohemoglobin) gene expression in
Escherichia coli K-12. J Bacteriol 178: 5487–5492.
Rensing C, Mitra B & Rosen BP (1997) The zntA gene of
Escherichia coli encodes a Zn(II)-translocating P-type ATPase.
P Natl Acad Sci USA 94: 14326–14331.
Rensing C, Sun Y, Mitra B & Rosen BP (1998) Pb(ll)translocating P-type ATPases. J Biol Chem 273: 32614–32617.
Rosenberg H, Gerdes RG & Chegwidden K (1977) Two systems
for the uptake of phosphate in Escherichia coli. J Bacteriol 131:
505–511.
Rosenberg H, Gerdes RG & Harold FM (1979) Energy coupling to
the transport of inorganic phosphate in Escherichia coli K12.
Biochem J 178: 133–137.
Russell LM & Rosenberg H (1980) The nature of the link between
potassium transport and phosphate transport in Escherichia
coli. Biochem J 188: 715–723.
Simons RW, Houman F & Kleckner N (1987) Improved single
and multicopy lac-based cloning vectors for protein and
operon fusions. Gene 53: 85–96.
Smith RL & Maguire ME (1998) Microbial magnesium transport:
unusual transporters searching for identity. Mol Microbiol 28:
217–226.
Sprague GF Jr, Bell RM & Cronan JE Jr (1975) A mutant of
Escherichia coli auxotrophic for organic phosphates: evidence
for two defects in inorganic phosphate transport. Mol Gen
Genet 143: 71–77.
van Veen HW, Abee T, Kortstee JJ, Konings WN & Zehnder JB
(1994) Translocation of metal phosphate via the phosphate
inorganic transport system of Escherichia coli. Biochemistry 33:
1766–1770.
Webb DC, Rosenberg H & Cox GB (1992) Mutational analysis of
the Escherichia coli phosphate-specific transport system, a
member of the traffic ATPase (or ABC) family of membrane
transporters – a role for proline residues in transmembrane
helices. J Biol Chem 267: 24661–24668.
Willsky GR & Malamy MH (1980) Characterization of 2
genetically separable inorganic phosphate transport systems in
Escherichia coli. J Bacteriol 144: 356–365.
Willsky GR, Bennett RL & Malamy MH (1973) Inorganic
phosphate transport in Escherichia coli – involvement of two
genes which play a role in alkaline phosphatase regulation.
J Bacteriol 113: 529–539.
Winkler HH (1966) A hexose-phosphate transport system in
Escherichia coli. Biochim Biophys Acta 117: 231–240.
FEMS Microbiol Lett 289 (2008) 219–224