close

Enter

Log in using OpenID

Beta Talassemia

embedDownload
17/03/2014
Controllo Esterno di Qualità dei test genetici
Schema Beta Talassemia
Scheda campioni: IX Turno - 2013
Valutatori : Maria Cristina Rosatelli & Anna Ravani
ISS-CNMR
Roma 07 Marzo 2014
CAMPIONI INVIATI
DATI ANAGRAFICI*
DATI CLINICI
GENOTIPO
Si richiede caratterizzazione molecolare del feto.
Genotipo paterno: βcd6 [-A] in eterozigosi
(HBB:c.[20delA];[=])
Genotipo materno: βcd76 [- C] in eterozigosi
(HBB:c.[230delC];[=])
N.B. Materiale da analizzare DNA genomico estratto
da villi coriali
β cd6 (-A) in
eterozigosi
HBB:c.[20delA];[=]
Simpieti Enzo
nato a Forlì il
18/12/1985
Soggetto di sesso maschile risultato portatore di Beta
talassemia allo screening ematologico. La moglie alla 10°
settimana di gravidanza è portatrice della mutazione in
HBB βcod39C>T in eterozigosi (HBB:c.[118C>T];[=]).
Il consulente genetista richiede il test molecolare per
diagnosi prenatale in coppia a rischio.
IVS1-110 [G>A] in
eterozigosi
HBB:c.[93-21G>A];[=]
Ordectio Gino
nato a Udine il
28/02/1963
Soggetto di sesso maschile risultato portatore all’esame
ematologico chiede caratterizzazione molecolare
IVS1-6 [T>C] in
eterozigosi
HBB:c.[92+6T>C];[=]
Statenti Paolo
nato a Baghdad
(Iraq) il 15 marzo
2012
Soggetto di sesso maschile, nato a Baghdad da genitori
iracheni e adottato a Palermo da genitori italiani; affetto
da Beta talassemia major in attesa di trapianto.
IVS1-25bp del
[25bp del]
Β °omozigote
[HBB:c93-22_95del]
Piclilma Anna
nata a Roma il
27/06/1977
11a settimana di
gravidanza
* I dati anagrafici sono fittizi
1
17/03/2014
La diagnosi di β-talassemia è ematologica
Principali scopi dell’indagine molecolare sono:
Diagnosi prenatale
Correlazione genotipo-fenotipo e prognosi
Ausilio diagnostico nelle forme atipiche
Per il CEQ 2013 sono state definite due categorie di performance: sufficiente e insufficiente
La performance di un laboratorio è stata ritenuta insufficiente quando,
anche per un solo campione, si sia verificata anche una sola delle
seguenti situazioni:
Errore di Genotipizzazione:
Genotipo errato o mutazione non analizzata
Mancato raggiungimento dell’efficienza diagnostica richiesta per lo schema
(99,9%)
Dati grezzi non interpretabili
Errori di interpretazione:
Interpretazione errata del dato grezzo corretto
Assenza di Interpretazione rispetto all’indicazione clinica al test genetico
richiesto
La performance di un laboratorio è ritenuta insufficiente anche quando, pur non verificandosi
nessuna delle situazioni su menzionate, la qualità generale delle informazioni contenute nel
referto è tale per cui non si raggiunga nella valutazione dei parametri di genotipizzazione e
interpretazione un punteggio di almeno 5/10.
2
17/03/2014
media tot per lab su
max 14 punti
SCHEMA 2013
LABORATORI PARTECIPANTI: 16
POOR PERFORMANCE (errori
Critici): 2 (12.5%)
1 Poor performance per difetto di
genotipizzazione
1 Poor performance per difetto di
interpretazione
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
poor
poor
11.1
11.9
11.9
13.3
13.4
13.4
13.5
13.7
13.8
13.8
13.8
13.9
13.9
14.0
Turno (2013) Performance dei
16 laboratori partecipanti
Turno (2012) Performance dei 22
laboratori partecipanti
SCHEMA 2012:
LABORATORI PARTECIPANTI: 22
Errori critici: 12 (54.54%)
Poor performance: 2 (12.5%)
• 1 laboratorio non ha testato la mutazione materna, βcd76[-C] nel
caso “Anna Piclilma”. L’efficienza diagnostica del laboratorio era
al di sotto del valore richiesto (99,9%) dai criteri di valutazione.
• 1 laboratorio non ha correttamente valutato il dato grezzo (di
scarsa qualità, ma corretto) dando indicazioni errate nel caso
“Anna Piclilma”
3
17/03/2014
Errore di genotipizzazione
RISULTATO
Presenza, in eterozigosi della mutazione c.[20del[A] (nomenclatura tradizionale
βcd6 [-A]). Genotipo in HGVS HBB: c.[20del[A]; [?]
INTERPRETAZIONE:
L’analisi molecolare del gene HBB, eseguita sul feto di Piclilma Anna, ha
identificato la presenza, in eterozigosi, della mutazione c.[20del[A] di origine
paterna.
CONCLUSIONI
Poiché il kit utilizzato non
permette di identificare la
mutazione di origine materna,
l’esame non è conclusivo ed è
necessario eseguire un ulteriore
approfondimento diagnostico.
Si procede, pertanto, ad inviare
DNA fetale presso un altro laboratorio.
Mancato
raggiungimento
dell'efficienza
diagnostica del 99,9%
come da criteri di
valutazione*.
Chi accetta di fare
diagnosi prenatale
deve essere in grado
di eseguire l'analisi.
Se si manda in service
ad altra struttura si
deve garantire la
qualità della struttura
e del referto nonché
tempi compatibili con
la Diagnosi prenatale.
Errore di interpretazione
Mut
Il laboratorio
dichiara di non
aver analizzato
la mutazione
materna (Beta
cod76(-C), ma
nella versione
del kit utilzzato
sono presenti le
sonde
corrispondenti
(sequenza
normale
-linea 34
corrispettiva
mutata
-linea 21).
WT
4
17/03/2014
ERRORE RILEVATO SOLTANTO PER L’ANALISI IN SEQUENZA ( -0.50)
ERRATA ANNOTAZIONE DELLA MUTAZIONE:
LA MUTAZIONE PORTATA DAL PROBANDO E’ LA
HBB:c.93-22_95del
VARIANTE MOLTO MENO FREQUENTE DELLA
HBB:c.93-21_96del
MA EGUALMENTE RICONOSCIUTA DAI SISTEMI RDB COMMERCIALI
HbVar: A database of Human Hemoglobin Variants and Thalassemias
http://globin.cse.psu.edu/globin/hbvar/menu.html
25 bp deletion beta°
HbVar ID 974
HGVS name HBB:c.93-21_96del
Category :Thalassemias
Type of Thalassemia: Beta°
Clinical presentation
Heterozygote
beta nts 252 - 276 deleted
HbVar riporta solo la
mutazione più
frequente
Laboratory findings
Comments
•Hb 10.8 g/dL
•Hb A2 5.2 %
•MCH 19.5 pg
•MCV 74.5 fL
Nts GGTCTATTTTCCCACCCTTAGGCTG deleted from (252 thru 276) in the Beta gene.
Defective mRNA; no normal beta chain synthesis
5
17/03/2014
Short genetic variation:
http://www.ncbi.nlm.nih.gov/SNP/
si cercano le variazioni inserendo la sigla del gene, HBB.
sono annoverate entrambe le delezioni: (n.329. rs63750223; n.379. rs193922563)
HBB:c.93-21_96del
rs63750223 [Homo sapiens]
AGGCACTGACTCTCTCTGCCTATT [-/GGTCTATTTTCCCACCCTTAGGCTG] CTGGTGGTCTACCCTTGG ACCCAGA
Chromosome: 11:5248026
Gene: HBB (GeneView)
Functional Consequence: intron variant
Clinical significance: pathogenic
Validated: no info
HGVS: NC_000011.9:g.5248026_5248050del25, NG_000007.3:g.70796_70820del25, NM_000518.4:c.93-21_96del,
NT_009237.18:g.5188026_5188050del25
rs193922563 [Homo sapiens]
HBB:c.93-22_95del
AGGCACTGACTCTCTCTGCCTAT [-/TGGTCTATTTTCCCACCCTTAGGCT] GCTGGTGGTCTACCCTTGG ACCCAG
Chromosome: 11:5248027
Gene:HBB (GeneView)
Functional Consequence: intron variant
Clinical significance: pathogenic
Validated: no info
HGVS: NC_000011.9:g.5248027_5248051del25, NG_000007.3:g.70795_70819del25, NM_000518.4:c.93-22_95del25,
NT_009237.18:g.5188027_5188051del25
Genotipizzazione - Piclilma
5
4
3
2
1
0
Cause performance insufficiente 2 (2 lab)
media
genotip. su
max 5: 4.2
2 poor
Performance
1
2
3
4
5
6
7
8
2 laboratorio non ha testato la mutazione materna,
bcd76[-C] nel caso “Anna Piclilma”. L’efficienza
diagnostica del laboratorio era al di sotto del valore
richiesto (99,9%) dai criteri di valutazione
9 10 11 12 13 14 15 16
Genotipizzazione - Simpieti
5
4
3
2
1
0
media
genotip. su
max 5: 4.8
0 poor
Performance
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16
Genotipizzazione - Ordectio
5
4
3
2
1
0
1 Il laboratorio non ha testato la mutazione materna
Beta cod76(-C) nel campione “Anna Piclilma”, il
laboratorio dichiara di non aver analizzato la mutazione
materna ma nella versione del kit utilizzato sono
presenti le sonde corrispondenti
media
genotip. su
max 5: 4.8
2
laboratori
Carenze più frequenti nella genotipizzazione
8 campioni
(2 lab)
Sensibilità e/o specificità del test assente
Genotipizzazione Statenti:
Errata annotazione della mutazione:
la mutazione portata dal paziente è una HBB: c.9322_95del variante molto meno frequente della
HBB:c.93-21_96del. Con l’RDB non può essere
rilevata la differenza (non penalizzato) , ma
sequenziando dovrebbe essere identificata la
posizione esatta.
4 lab.
0 poor
Performance
1
2
3
4
5
6
7
8
9
Genotipizzazione
10 11 12 13 14 15 16
Genotipizzazione - Statenti
5
4
media
genotip. su
max 5: 4.67
0 poor
Performance
3
2
1
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16
Turno 2012
Turno 2013
Errore Critico 20 su
88 genotipiz. (12
lab su 22)
Performance
insufficiente 2 su
64 genotipiz. (2 lab
su 16)
Media punteggio
Media punteggio
Genotip.: 3.63
Genotip.:
su 5
4.62 su 5
6
17/03/2014
Interpretazione - Piclilma
5
4
3
2
1
0
N.V.: Non valutati per errore di genotipizzazione
media interpret.
su max 5: 4.2
0 poor
Performance
2 non valutati
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16
Interpretazione - Simpieti
5
4
3
2
1
0
media interpret.
su max 5: 4.79
Carenze più frequenti nell’interpretazione e
descrizione del risultato
Efficienza diagnostica assente o
inappropriata (<99,9%)
5 laboratori
Assenza della richiesta di esame genetico di
partner e familiari nel campione Ordectio
6 laboratori
0 poor
Performance
0 non valutati
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16
Interpretazione
Interpretazione - Ordectio
5
4
3
2
1
0
media interpret.
su max 5: 4.69
0 poor
Performance
0 non valutati
1
2
3
4
5
6
7
8
Turno 2012
Turno 2013
Errore Critico 0 su
68 interpretaz. (20
interpr. Non
valutate)
Performance
insufficiente 0 su 62
interpretaz. (2
interpr. Non
valutate)
Media punteggio
Media punteggio
9 10 11 12 13 14 15 16
Interpretazione - Statenti
Interpret.: 3.35
5
4
3
2
1
0
su 4
Interpret.:
4.68 su 5
media interpret.
su max 5: 4.72
0 poor
Performance
0 non valutati
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16
Refertazione - Piclima
N.V.: Non valutati per errore di genotipizzazione
4
3
media refertaz.
su max 4: 3.43
2
2 non valutati
1
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16
Refertazione - Simpieti
4
3
media refertaz.
su max 4: 3.76
2
1
0 non valutati
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16
Carenze nel referto
Lab
Inadeguatezza generale del referto
1
Struttura del referto poco chiara
2
Numerazione di pagine
2
Il titolo del referto è inappropriato.
Piclima: Manca qualsiasi indicazione che
indichi che si tratta di un'indagine
7
prenatale
Campione analizzato (sangue, tessuto...)
(indicare DNA estratto in altra sede)
2
Refertazione - Ordectio
4
3
media refertaz.
su max 4: 3.79
2
1
0 non valutati
Refertazione
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16
Refertazione - Statenti
Turno 2012
Turno 2013
20 Non valutate
2 Non valutate
Media punteggio
Media punteggio
4
3
media refertaz.
su max 4: 3.78
2
Interpret.: 3.43
su 4
Interpret.:
3.69 su 4
1
0 non valutati
0
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16
7
17/03/2014
Soglia - Piclima
10
5
Interpretazione
Genotipizzazione
0
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16
Soglia - Simpieti
10
SOMMA DEI PUNTEGGI
OTTENUTI DALLA
VALUTAZIONE DELLA
GENOTIPIZZAZIONE E
INTERPRETAZIONE.
5
Interpretazione
La performance di un laboratorio viene
ritenuta insufficiente anche quando non sia
stato raggiunto un punteggio di almeno 5/10
nella
valutazione
dei
parametri
di
genotipizzazione e interpretazione
Genotipizzazioe
0
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16
Soglia - Ordectio
10
Interpretazione
5
Genotipizzazioe
0
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16
Soglia - Statenti
10
A differenza dei risultati dello
schema per Fibrosi Cistica,
nessun laboratorio ha avuto un
giudizio di Performance
insufficiente per il non
raggiungimento della soglia!
Interpretazione
5
Genotipizzazioe
0
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15 16
RACCOMANDAZIONI
- Genotipizzazione
•
identificare tutte le “mutazioni obbligate” nei soggetti già
diagnosticati ematologicamente
•
eseguire il sequenziamento del gene
•
affiancare alla nomenclatura classica quella internazionale HGVS v.2
•
nelle indagini prenatali è raccomandata la ricerca delle mutazioni con
due metodi distinti
•
eseguire le analisi di sequenza sia forward che reverse e, per il CEQ,
allegare gli elettroferogrammi di entrambi i filamenti sequenziati.
Sarebbe di notevole aiuto per i valutatori indicare la regione con la
mutazione, e la base mutata (o non mutata): eviterebbe di dover
analizzare ogni volta gli interi elettroferogrammi .
8
17/03/2014
RACCOMANDAZIONI
- Interpretazione
• L’efficienza diagnostica riportata nel referto non dovrebbe essere
riferita alla singola metodica utilizzata, ma alla capacità teorica del
laboratorio di identificare le mutazioni in una data etnia.
Tutti i laboratori che offrono il test genetico per la diagnosi
molecolare di Beta Talassemia dovrebbero arrivare ad una
efficienza diagnostica del 99.9%
• Quando non è possibile definire con certezza lo stato di
omozigosi attraverso l'analisi dei genitori, sarebbe consigliabile
utilizzare un secondo metodo di conferma e indicare il risultato come
"genotipo compatibile con omozigosi".
RACCOMANDAZIONI
-
Refertazione
1. Si raccomanda di numerare le pagine del referto anche se questo
rientra in un’unica pagina.
2. Si consiglia, inoltre, di indicare chiaramente nel referto la
provenienza del campione e il tipo di campione esaminato. Ad
esempio, nel caso del CEQ si dovrebbe riportare DNA estratto in
altra sede.
3. E’ opportuno utilizzare, oltre alla nomenclatura tradizionale, la
nomenclatura HGVS. Questa ovviamente è indispensabile per la
definizione univoca delle nuove mutazioni.
9
17/03/2014
Esempi di Nomenclatura HGVS
Genomic reference sequences
For genomic reference sequences, nucleotide numbering is simple 1, 2, 3, ....etc. from the first to the last
nucleotide of the reference seqence. No "+", "-" or other signs are used
Coding DNA reference sequences
In a coding DNA reference sequence nucleotide "1" is the A of the ATG translation initiation codon.
The main reason why most people prefer a coding DNA reference sequence is that from the description one
immediately gets some information regarding the location of the variant;
c.78T>C > protein coding
since the nucleotide "c.78" has no signs attached and is not followed by a "+" or "-" and a second number, it is
located in the protein coding part of the gene. NOTE: this rules does not hold for alternative transcripts where
exons might reside 5' of the translation initiation side, in an intron or 3' of the 3'-terminal exon
c.-78G>A
since the nucleotide "c.-78" has a "-" prefix it is located 5' of the ATG translation initiation codon. NOTE: the
length of the 5'UTR determines whether this position is still part of the transcript or upstream of the
transcription initiation site (cap site)
c.*78T>A
since the nucleotide "c.*78" has a "*" prefix it is located 3' of the translation termination codon. NOTE: the
length of the 3'UTR determines whether this position is still part of the transcript or downstream of the polyAaddition site
c.78+45T>G
since the nucleotide "c.78" is followed by "+" and a second number ("45") the nucleotide is in an intron, 3' of the
splice donor site and before (5') of the middle of the intron
c.79-45G>T
since the nucleotide "c.79" is followed by "-" and a second number ("45") the nucleotide is in an intron, 5' of the
splice acceptor site and after (3') of the middle of the intron
Dividing the nucleotide number by 3 gives the number of the amino acid residue affected, in the example
amino acid 26 (78:3 = 26).
Nomenclatura classica e HGVS a confronto
-136
62051
ctagggttgg ccaatctact cccaggagca gggagggcag gagccagggc
-86
62101
tgggcataaa agtcagggca gagccatcta ttgcttacat ttgcttctga
-36
62151
cacaactgtg ttcactagca acctcaaaca gacaccatgg tgcacctgac
+12
62201
tcctgaggag aagtctgccg ttactgccct gtggggcaag gtgaacgtgg
+62
62251
atgaagttgg tggtgaggcc ctgggcaggt tggtatcaag gttacaagac
IVS1 22
62301
aggtttaagg agaccaatag aaactgggca tgtggagaca gagaagactc
IVS1 72
62351
ttgggtttct gataggcact gactctctct gcctattggt ctattttccc
IVS1 122
62401
acccttaggc tgctggtggt ctacccttgg acccagaggt tctttgagtc
+133
62451
ctttggggat ctgtccactc ctgatgctgt tatgggcaac cctaaggtga
HbDoha
Initiation codon ATG>GTG Beta°
Beta 1Val>Glu
Beta Initiation codon Met>Val
-29A>G Beta+
5’UTR; +20(C>T)
HBB:c.5T>A
HBB:c.1A>G
Beta nt -29 A>G
HBB:c.-79A>G
Beta nt 20 C>T
Codon 39(C>T); CAG(Gln)>TAG(Stop codon) Beta°
IVS1-6(T>C); the portuguese type Beta+
HBB:c.-31C>T
Beta 39 Gln>Stop
beta nt 148 T>C
HBB:c.118C>T
HBB:c.92+6T>C
10
17/03/2014
RINGRAZIAMENTI
Maria Cristina Rosatelli
Anna Ravani
Federica Censi, Fabrizio Tosto, Giovanna Floridia
Vincenzo Falbo
Domenica Taruscio e
11
Author
Document
Category
Uncategorized
Views
0
File Size
881 KB
Tags
1/--pages
Report inappropriate content