African Journal of Microbiology Research Volume 8 Number 8, 19 February, 2014 ISSN 1996-0808 ABOUT AJMR The African Journal of Microbiology Research (AJMR) (ISSN 1996-0808) is published Weekly (one volume per year) by Academic Journals. African Journal of Microbiology Research (AJMR) provides rapid publication (weekly) of articles in all areas of Microbiology such as: Environmental Microbiology, Clinical Microbiology, Immunology, Virology, Bacteriology, Phycology, Mycology and Parasitology, Protozoology, Microbial Ecology, Probiotics and Prebiotics, Molecular Microbiology, Biotechnology, Food Microbiology, Industrial Microbiology, Cell Physiology, Environmental Biotechnology, Genetics, Enzymology, Molecular and Cellular Biology, Plant Pathology, Entomology, Biomedical Sciences, Botany and Plant Sciences, Soil and Environmental Sciences, Zoology, Endocrinology, Toxicology. The Journal welcomes the submission of manuscripts that meet the general criteria of significance and scientific excellence. Papers will be published shortly after acceptance. All articles are peer-reviewed. Submission of Manuscript Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given the last name of the first author Click here to Submit manuscripts online If you have any difficulty using the online submission system, kindly submit via this email [email protected]. With questions or concerns, please contact the Editorial Office at [email protected]. Editors Prof. Dr. Stefan Schmidt, Applied and Environmental Microbiology School of Biochemistry, Genetics and Microbiology University of KwaZulu-Natal Private Bag X01 Scottsville, Pietermaritzburg 3209 South Africa. Dr. Thaddeus Ezeji Assistant Professor Fermentation and Biotechnology Unit Department of Animal Sciences The Ohio State University 1680 Madison Avenue USA. Prof. Fukai Bao Department of Microbiology and Immunology Kunming Medical University Kunming 650031, China Associate Editors Dr. Jianfeng Wu Dept. of Environmental Health Sciences, School of Public Health, University of Michigan USA Dr. Ahmet Yilmaz Coban OMU Medical School, Department of Medical Microbiology, Samsun, Turkey Dr. Seyed Davar Siadat Pasteur Institute of Iran, Pasteur Square, Pasteur Avenue, Tehran, Iran. Dr. J. Stefan Rokem The Hebrew University of Jerusalem Department of Microbiology and Molecular Genetics, P.O.B. 12272, IL-91120 Jerusalem, Israel Prof. Long-Liu Lin National Chiayi University 300 Syuefu Road, Chiayi, Taiwan N. John Tonukari, Ph.D Department of Biochemistry Delta State University PMB 1 Abraka, Nigeria Dr. Mamadou Gueye MIRCEN/ Laboratoire commun de microbiologie IRD-ISRA-UCAD, BP 1386, DAKAR, Senegal. Dr. Caroline Mary Knox Department of Biochemistry, Microbiology and Biotechnology Rhodes University Grahamstown 6140 South Africa. Dr. Hesham Elsayed Mostafa Genetic Engineering and Biotechnology Research Institute (GEBRI) Mubarak City For Scientific Research, Research Area, New Borg El-Arab City, Post Code 21934, Alexandria, Egypt. Dr. Wael Abbas El-Naggar Head of Microbiology Department, Faculty of Pharmacy, Mansoura University, Mansoura 35516, Egypt. Dr. Abdel Nasser A. El-Moghazy Microbiology, Molecular Biology, Genetics Engineering and Biotechnology Dept of Microbiology and Immunology Faculty of Pharmacy Al-Azhar University Nasr city, Cairo, Egypt Editorial Board Dr. Barakat S.M. Mahmoud Food Safety/Microbiology Experimental Seafood Processing Laboratory Costal Research and Extension Center Mississippi State University 3411 Frederic Street Pascagoula, MS 39567 USA Prof. Mohamed Mahrous Amer Poultry Disease (Viral Diseases of poultry) Faculty of Veterinary Medicine, Department of Poultry Diseases Cairo university Giza, Egypt Dr. Xiaohui Zhou Molecular Microbiology, Industrial Microbiology, Environmental Microbiology, Pathogenesis, Antibiotic resistance, Microbial Ecology Washington State University Bustad Hall 402 Department of Veterinary Microbiology and Pathology, Pullman, USA Dr. R. Balaji Raja Department of Biotechnology, School of Bioengineering, SRM University, Chennai India Dr. Aly E Abo-Amer Division of Microbiology, Botany Department, Faculty of Science, Sohag University. Egypt. Dr. Haoyu Mao Department of Molecular Genetics and Microbiology College of Medicine University of Florida Florida, Gainesville USA. Dr. Rachna Chandra Environmental Impact Assessment Division Environmental Sciences SГЎlim Ali Center for Ornithology and Natural History (SACON), Anaikatty (PO), Coimbatore-641108, India Dr. Yongxu Sun Department of Medicinal Chemistry and Biomacromolecules Qiqihar Medical University, Qiqihar 161006 Heilongjiang Province P.R. China Dr. Ramesh Chand Kasana Institute of Himalayan Bioresource Technology Palampur, Distt. Kangra (HP), India Dr. S. Meena Kumari Department of Biosciences Faculty of Science University of Mauritius Reduit Dr. T. Ramesh Assistant Professor Marine Microbiology CAS in Marine Biology Faculty of Marine Sciences Annamalai University Parangipettai - 608 502 Cuddalore Dist. Tamilnadu, India Dr. Pagano Marcela Claudia Post doctoral fellowship at Department of Biology, Federal University of CearГЎ - UFC, Brazil. Dr. EL-Sayed E. Habib Associate Professor, Dept. of Microbiology, Faculty of Pharmacy, Mansoura University, Egypt. Dr. Pongsak Rattanachaikunsopon Department of Biological Science, Faculty of Science, Ubon Ratchathani University, Warin Chamrap, Ubon Ratchathani 34190, Thailand Dr. Gokul Shankar Sabesan Microbiology Unit, Faculty of Medicine, AIMST University Jalan Bedong, Semeling 08100, Kedah, Malaysia Dr. Kwang Young Song Department of Biological Engineering, School of Biological and Chemical Engineering, Yanbian Universityof Science and Technology, Yanji, China. Dr. Kamel Belhamel Faculty of Technology, University of Bejaia Algeria Dr. Sladjana Jevremovic Institute for Biological Research Sinisa Stankovic, Belgrade, Serbia Dr. Tamer Edirne Dept. of Family Medicine, Univ. of Pamukkale Turkey Dr. R. Balaji Raja M.Tech (Ph.D) Assistant Professor, Department of Biotechnology, School of Bioengineering, SRM University, Chennai. India Dr. Minglei Wang University of Illinois at Urbana-Champaign,USA Dr. Mohd Fuat ABD Razak Institute for Medical Research Malaysia Dr. Davide Pacifico Istituto di Virologia Vegetale – CNR Italy Prof. Dr. Akrum Hamdy Faculty of Agriculture, Minia University, Egypt Egypt Dr. Ntobeko A. B. Ntusi Cardiac Clinic, Department of Medicine, University of Cape Town and Department of Cardiovascular Medicine, University of Oxford South Africa and United Kingdom Prof. N. S. Alzoreky Food Science & Nutrition Department, College of Agricultural Sciences & Food, King Faisal University, Saudi Arabia Dr. Chen Ding College of Material Science and Engineering, Hunan University, China Dr Svetlana Nikolid Faculty of Technology and Metallurgy, University of Belgrade, Serbia Dr. Sivakumar Swaminathan Department of Agronomy, College of Agriculture and Life Sciences, Iowa State University, Ames, Iowa 50011 USA Dr. Alfredo J. Anceno School of Environment, Resources and Development (SERD), Asian Institute of Technology, Thailand Dr. Iqbal Ahmad Aligarh Muslim University, Aligrah India Dr. Josephine Nketsia-Tabiri Ghana Atomic Energy Commission Ghana Dr. Juliane Elisa Welke UFRGS – Universidade Federal do Rio Grande do Sul Brazil Dr. Mohammad Nazrul Islam NIMR; IPH-Bangalore & NIUM Bangladesh Dr. Okonko, Iheanyi Omezuruike Department of Virology, Faculty of Basic Medical Sciences, College of Medicine, University of Ibadan, University College Hospital, Ibadan, Nigeria Dr. Giuliana Noratto Texas A&M University USA Dr. Phanikanth Venkata Turlapati Washington State University USA Dr. Khaleel I. Z. Jawasreh National Centre for Agricultural Research and Extension, NCARE Jordan Dr. Babak Mostafazadeh, MD Shaheed Beheshty University of Medical Sciences Iran Dr. S. Meena Kumari Department of Biosciences Faculty of Science University of Mauritius Reduit Mauritius Dr. S. Anju Department of Biotechnology, SRM University, Chennai-603203 India Dr. Mustafa Maroufpor Iran Prof. Dong Zhichun Professor, Department of Animal Sciences and Veterinary Medicine, Yunnan Agriculture University, China Dr. Mehdi Azami Parasitology & Mycology Dept, Baghaeei Lab., Shams Abadi St. Isfahan Iran Dr. Anderson de Souza Sant’Ana University of SГЈo Paulo. Brazil. Dr. Juliane Elisa Welke UFRGS – Universidade Federal do Rio Grande do Sul Brazil Dr. Paul Shapshak USF Health, Depts. Medicine (Div. Infect. Disease & Internat Med) and Psychiatry & Beh Med. USA Dr. Jorge Reinheimer Universidad Nacional del Litoral (Santa Fe) Argentina Dr. Qin Liu East China University of Science and Technology China Dr. Xiao-Qing Hu State Key Lab of Food Science and Technology Jiangnan University P. R. China Prof. Branislava Kocic Specaialist of Microbiology and Parasitology University of Nis, School of Medicine Institute for Public Health Nis, Bul. Z. Djindjica 50, 18000 Nis Serbia Dr. Rafel Socias CITA de AragГіn, Spain Prof. Kamal I. Mohamed State University of New York at Oswego USA Prof. Isidro A. T. Savillo ISCOF Philippines Dr. Adriano Cruz Faculty of Food Engineering-FEA University of Campinas (UNICAMP) Brazil Dr. How-Yee Lai Taylor’s University College Malaysia Dr. Mike Agenbag (Michael Hermanus Albertus) Manager Municipal Health Services, Joe Gqabi District Municipality South Africa Dr. D. V. L. Sarada Department of Biotechnology, SRM University, Chennai-603203 India. Dr. Samuel K Ameyaw Civista Medical Center United States of America Prof. Huaizhi Wang Institute of Hepatopancreatobiliary Surgery of PLA Southwest Hospital, Third Military Medical University Chongqing400038 P. R. China Prof. Bakhiet AO College of Veterinary Medicine, Sudan University of Science and Technology Sudan Dr. Saba F. Hussain Community, Orthodontics and Peadiatric Dentistry Department Faculty of Dentistry Universiti Teknologi MARA 40450 Shah Alam, Selangor Malaysia Prof. Dr. Zohair I.F.Rahemo State Key Lab of Food Science and Technology Jiangnan University P. R. China Dr. Afework Kassu University of Gondar Ethiopia Dr. Nidheesh Dadheech MS. University of Baroda, Vadodara, Gujarat, India. India Dr. Omitoyin Siyanbola Bowen University, Iwo Nigeria Dr. Franco Mutinelli Istituto Zooprofilattico Sperimentale delle Venezie Italy Dr. Chanpen Chanchao Department of Biology, Faculty of Science, Chulalongkorn University Thailand Dr. Tsuyoshi Kasama Division of Rheumatology, Showa University Japan Dr. Kuender D. Yang, MD. Chang Gung Memorial Hospital Taiwan Dr. Liane Raluca Stan University Politehnica of Bucharest, Department of Organic Chemistry “C.Nenitzescu” Romania Dr. Muhamed Osman Senior Lecturer of Pathology & Consultant Immunopathologist Department of Pathology, Faculty of Medicine, Universiti Teknologi MARA, 40450 Shah Alam, Selangor Malaysia Dr. Mohammad Feizabadi Tehran University of medical Sciences Iran Prof. Ahmed H Mitwalli State Key Lab of Food Science and Technology Jiangnan University P. R. China Dr. Mazyar Yazdani Department of Biology, University of Oslo, Blindern, Oslo, Norway Dr. Ms. Jemimah Gesare Onsare Ministry of Higher, Education Science and Technology Kenya Dr. Babak Khalili Hadad Department of Biological Sciences, Roudehen Branch, Islamic Azad University, Roudehen Iran Dr. Ehsan Sari Department of Plan Pathology, Iranian Research Institute of Plant Protection, Tehran, Iran. Dr. Adibe Maxwell Ogochukwu Department of Clinical Pharmacy and Pharmacy Management, University of Nigeria, Nsukka. Nigeria Dr. William M. Shafer Emory University School of Medicine USA Dr. Michelle Bull CSIRO Food and Nutritional Sciences Australia Prof. Dr. MГЎrcio Garcia Ribeiro (DVM, PhD) School of Veterinary Medicine and Animal ScienceUNESP, Dept. Veterinary Hygiene and Public Health, State of Sao Paulo Brazil Prof. Dr. Sheila Nathan National University of Malaysia (UKM) Malaysia Prof. Ebiamadon Andi Brisibe University of Calabar, Calabar, Nigeria Dr. Snjezana Zidovec Lepej University Hospital for Infectious Diseases Zagreb, Croatia Dr. Julie Wang Burnet Institute Australia Dr. Dilshad Ahmad King Saud University Saudi Arabia Dr. Jean-Marc Chobert INRA- BIA, FIPL France Dr. Adriano Gomes da Cruz University of Campinas (UNICAMP) Brazil Dr. Zhilong Yang, PhD Laboratory of Viral Diseases National Institute of Allergy and Infectious Diseases, National Institutes of Health Dr. Hsin-Mei Ku Agronomy Dept. NCHU 250 Kuo Kuang Rd, Taichung, Taiwan Dr. Dele Raheem University of Helsinki Finland Dr. Fereshteh Naderi Physical chemist, Islamic Azad University, Shahre Ghods Branch Iran Dr. Li Sun PLA Centre for the treatment of infectious diseases, Tangdu Hospital, Fourth Military Medical University China Dr. Biljana Miljkovic-Selimovic School of Medicine, University in Nis, Serbia; Referent laboratory for Campylobacter and Helicobacter, Center for Microbiology, Institute for Public Health, Nis Serbia Dr. Pradeep Parihar Lovely Professional University, Phagwara, Punjab. India Dr. Xinan Jiao Yangzhou University China Dr. Kanzaki, L I B Laboratory of Bioprospection. University of Brasilia Brazil Dr. Endang Sri Lestari, MD. Department of Clinical Microbiology, Medical Faculty, Diponegoro University/Dr. Kariadi Teaching Hospital, Semarang Indonesia Prof. Philippe Dorchies Laboratory of Bioprospection. University of Brasilia Brazil Dr. Hojin Shin Pusan National University Hospital South Korea Dr. Yi Wang Center for Vector Biology, 180 Jones Avenue Rutgers University, New Brunswick, NJ 08901-8536 USA Dr. Heping Zhang The Key Laboratory of Dairy Biotechnology and Engineering, Ministry of Education, Inner Mongolia Agricultural University. China Dr. William H RoldГЎn Department of Medical Microbiology, Faculty of Medicine, Peru Dr. C. Ganesh Kumar Indian Institute of Chemical Technology, Hyderabad India Dr. Farid Che Ghazali Universiti Sains Malaysia (USM) Malaysia Dr. Samira Bouhdid Abdelmalek Essaadi University, Tetouan, Morocco Dr. Zainab Z. Ismail Department of Environmental Engineering, University of Baghdad. Iraq Prof. Natasha Potgieter University of Venda South Africa Dr. Ary Fernandes Junior Universidade Estadual Paulista (UNESP) Brasil Dr. Alemzadeh Sharif University Iran Dr. Papaevangelou Vassiliki Athens University Medical School Greece Dr. Sonia Arriaga Instituto Potosino de InvestigaciГіn CientГficay TecnolГіgica/DivisiГіn de Ciencias Ambientales Mexico Dr. Fangyou Yu The first Affiliated Hospital of Wenzhou Medical College China Dr. Armando Gonzalez-Sanchez Universidad Autonoma Metropolitana Cuajimalpa Mexico Dr. Galba Maria de Campos Takaki Catholic University of Pernambuco Brazil Dr. Kwabena Ofori-Kwakye Department of Pharmaceutics, Kwame Nkrumah University of Science & Technology, KUMASI Ghana Dr. Hans-JГјrg Monstein Clinical Microbiology, Molecular Biology Laboratory, University Hospital, Faculty of Health Sciences, S-581 85 LinkГ¶ping Sweden Prof. Dr. Liesel Brenda Gende Arthropods Laboratory, School of Natural and Exact Sciences, National University of Mar del Plata Buenos Aires, Argentina. Dr. Ajith, T. A Associate Professor Biochemistry, Amala Institute of Medical Sciences, Amala Nagar, Thrissur, Kerala-680 555 India Dr. Adeshina Gbonjubola Ahmadu Bello University, Zaria. Nigeria Dr. Feng-Chia Hsieh Biopesticides Division, Taiwan Agricultural Chemicals and Toxic Substances Research Institute, Council of Agriculture Taiwan Prof. Dr. Stylianos Chatzipanagiotou University of Athens – Medical School Greec Dr. Dongqing BAI Department of Fishery Science, Tianjin Agricultural College, Tianjin 300384 P. R. China Dr. Dingqiang Lu Nanjing University of Technology P.R. China Dr. L. B. Sukla Scientist –G & Head, Biominerals Department, IMMT, Bhubaneswar India Dr. Hakan Parlakpinar MD. Inonu University, Medical Faculty, Department of Pharmacology, Malatya Turkey Dr Pak-Lam Yu Massey University New Zealand Dr Percy Chimwamurombe University of Namibia Namibia Dr. EuclГ©sio Simionatto State University of Mato Grosso do Sul-UEMS Brazil Prof. Dra. Suzan Pantaroto de Vasconcellos Universidade Federal de SГЈo Paulo Rua Prof. Artur Riedel, 275 Jd. Eldorado, Diadema, SP CEP 09972-270 Brasil Dr. Maria Leonor Ribeiro Casimiro Lopes Assad Universidade Federal de SГЈo Carlos - Centro de CiГЄncias AgrГЎrias - CCA/UFSCar Departamento de Recursos Naturais e Proteção Ambiental Rodovia Anhanguera, km 174 - SP-330 Araras - SГЈo Paulo Brasil Dr. Pierangeli G. Vital Institute of Biology, College of Science, University of the Philippines Philippines Prof. Roland Ndip University of Fort Hare, Alice South Africa Dr. Shawn Carraher University of Fort Hare, Alice South Africa Dr. JosГ© Eduardo Marques Pessanha ObservatГіrio de SaГєde Urbana de Belo Horizonte/Faculdade de Medicina da Universidade Federal de Minas Gerais Brasil Dr. Yuanshu Qian Department of Pharmacology, Shantou University Medical College China Dr. Helen Treichel URI-Campus de Erechim Brazil Dr. Xiao-Qing Hu State Key Lab of Food Science and Technology Jiangnan University P. R. China Dr. Olli H. Tuovinen Ohio State University, Columbus, Ohio USA Prof. Stoyan Groudev University of Mining and Geology “Saint Ivan Rilski” Sofia Bulgaria Dr. G. Thirumurugan Research lab, GIET School of Pharmacy, NH-5, Chaitanya nagar, Rajahmundry-533294. India Dr. Charu Gomber Thapar University India Dr. Jan Kuever Bremen Institute for Materials Testing, Department of Microbiology, Paul-Feller-Str. 1, 28199 Bremen Germany Dr. Nicola S. Flanagan Universidad Javeriana, Cali Colombia Dr. AndrГ© Luiz C. M. de A. Santiago Universidade Federal Rural de Pernambuco Brazil Dr. Dhruva Kumar Jha Microbial Ecology Laboratory, Department of Botany, Gauhati University, Guwahati 781 014, Assam India Dr. N Saleem Basha M. Pharm (Pharmaceutical Biotechnology) Eritrea (North East Africa) Prof. Dr. JoГЈo LГєcio de Azevedo Dept. Genetics-University of SГЈo Paulo-Faculty of Agriculture- Piracicaba, 13400-970 Brasil Dr. Julia InГ©s FariГ±a PROIMI-CONICET Argentina Dr. Yutaka Ito Kyoto University Japan Dr. Cheruiyot K. Ronald Biomedical Laboratory Technologist Kenya Prof. Dr. Ata Akcil S. D. University Turkey Dr. Adhar Manna The University of South Dakota USA Dr. CГcero FlГЎvio Soares AragГЈo Federal University of Rio Grande do Norte Brazil Dr. Gunnar Dahlen Institute of odontology, Sahlgrenska Academy at University of Gothenburg Sweden Dr. Pankaj Kumar Mishra Vivekananda Institute of Hill Agriculture, (I.C.A.R.), ALMORA-263601, Uttarakhand India Dr. Benjamas W. Thanomsub Srinakharinwirot University Thailand Dr. Maria JosГ© Borrego National Institute of Health – Department of Infectious Diseases Portugal Dr. Catherine Carrillo Health Canada, Bureau of Microbial Hazards Canada Dr. Marcotty Tanguy Institute of Tropical Medicine Belgium Dr. Han-Bo Zhang Laboratory of Conservation and Utilization for Bioresources Key Laboratory for Microbial Resources of the Ministry of Education, Yunnan University, Kunming 650091. School of Life Science, Yunnan University, Kunming, Yunnan Province 650091. China Dr. Ali Mohammed Somily King Saud University Saudi Arabia Dr. Nicole Wolter National Institute for Communicable Diseases and University of the Witwatersrand, Johannesburg South Africa Dr. Marco Antonio Nogueira Universidade Estadual de Londrina CCB/Depto. De microbiologia LaboratГіrio de Microbiologia Ambiental Caixa Postal 6001 86051-980 Londrina. Brazil Dr. Bruno Pavoni Department of Environmental Sciences University of Venice Italy Dr. Shih-Chieh Lee Da-Yeh University Taiwan Dr. Satoru Shimizu Horonobe Research Institute for the Subsurface Environment, Northern Advancement Center for Science & Technology Japan Dr. Tang Ming College of Forestry, Northwest A&F University, Yangling China Dr. Olga Gortzi Department of Food Technology, T.E.I. of Larissa Greece Dr. Mark Tarnopolsky Mcmaster University Canada Dr. Sami A. Zabin Al Baha University Saudi Arabia Dr. Julia W. Pridgeon Aquatic Animal Health Research Unit, USDA, ARS USA Dr. Lim Yau Yan Monash University Sunway Campus Malaysia Prof. Rosemeire C. L. R. Pietro Faculdade de CiГЄncias FarmacГЄuticas de Araraquara, Univ Estadual Paulista, UNESP Brazil Dr. Nazime Mercan Dogan PAU Faculty of Arts and Science, Denizli Turkey Dr Ian Edwin Cock Biomolecular and Physical Sciences Griffith University Australia Prof. N K Dubey Banaras Hindu University India Dr. S. Hemalatha Department of Pharmaceutics, Institute of Technology, Banaras Hindu University, Varanasi. 221005 India Dr. J. Santos Garcia A. Universidad A. de Nuevo Leon Mexico India Dr. Somboon Tanasupawat Department of Biochemistry and Microbiology, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Bangkok 10330 Thailand Dr. Vivekananda Mandal Post Graduate Department of Botany, Darjeeling Government College, Darjeeling – 734101. India Dr. Shihua Wang College of Life Sciences, Fujian Agriculture and Forestry University China Dr. Victor Manuel Fernandes Galhano CITAB-Centre for Research and Technology of AgroEnvironment and Biological Sciences, Integrative Biology and Quality Research Group, University of TrГЎs-os-Montes and Alto Douro, Apartado 1013, 5001-801 Vila Real Portugal Dr. Maria Cristina Maldonado Instituto de Biotecnologia. Universidad Nacional de Tucuman Argentina Dr. Alex Soltermann Institute for Surgical Pathology, University Hospital ZГјrich Switzerland Dr. Dagmara Sirova Department of Ecosystem Biology, Faculty Of Science, University of South Bohemia, Branisovska 37, Ceske Budejovice, 37001 Czech Republic Dr. Mick Bosilevac US Meat Animal Research Center USA Dr. Nora LГa Padola ImunoquГmica y BiotecnologГa- Fac Cs Vet-UNCPBA Argentina Dr. Maria Madalena Vieira-Pinto Universidade de TrГЎs-os-Montes e Alto Douro Portugal Dr. Stefano Morandi CNR-Istituto di Scienze delle Produzioni Alimentari (ISPA), Sez. Milano Italy Dr Line Thorsen Copenhagen University, Faculty of Life Sciences Denmark Dr. Ana Lucia Falavigna-Guilherme Universidade Estadual de MaringГЎ Brazil Dr. Baoqiang Liao Dept. of Chem. Eng., Lakehead University, 955 Oliver Road, Thunder Bay, Ontario Canada Dr. Ouyang Jinping Patho-Physiology department, Faculty of Medicine of Wuhan University China Dr. John Sorensen University of Manitoba Canada Dr. Andrew Williams University of Oxford United Kingdom Dr. E. O Igbinosa Department of Microbiology, Ambrose Alli University, Ekpoma, Edo State, Nigeria. Dr. Chi-Chiang Yang Chung Shan Medical University Taiwan, R.O.C. Dr. Hodaka Suzuki National Institute of Health Sciences Japan Dr. Quanming Zou Department of Clinical Microbiology and Immunology, College of Medical Laboratory, Third Military Medical University China Prof. Ashok Kumar School of Biotechnology, Banaras Hindu University, Varanasi India Dr. Guanghua Wang Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences China Dr. Chung-Ming Chen Department of Pediatrics, Taipei Medical University Hospital, Taipei Taiwan Dr. Renata Vadkertiova Institute of Chemistry, Slovak Academy of Science Slovakia Dr. Jennifer Furin Harvard Medical School USA Dr. Julia W. Pridgeon Aquatic Animal Health Research Unit, USDA, ARS USA Dr Alireza Seidavi Islamic Azad University, Rasht Branch Iran Dr. Thore Rohwerder Helmholtz Centre for Environmental Research UFZ Germany Dr. Daniela Billi University of Rome Tor Vergat Italy Dr. Ivana Karabegovic Faculty of Technology, Leskovac, University of Nis Serbia Dr. Flaviana Andrade Faria IBILCE/UNESP Brazil Prof. Margareth Linde Athayde Federal University of Santa Maria Brazil Dr. Guadalupe Virginia Nevarez Moorillon Universidad Autonoma de Chihuahua Mexico Dr. Tatiana de Sousa Fiuza Federal University of Goias Brazil Dr. Indrani B. Das Sarma Jhulelal Institute of Technology, Nagpur India Dr. Charles Hocart The Australian National University Australia Dr. Guoqiang Zhu University of Yangzhou College of Veterinary Medicine China Dr. Guilherme Augusto Marietto GonГ§alves SГЈo Paulo State University Brazil Dr. Mohammad Ali Faramarzi Tehran University of Medical Sciences Iran Dr. Suppasil Maneerat Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince of Songkla University, Hat Yai 90112 Thailand Dr. Francisco Javier Las heras Vazquez Almeria University Spain Dr. Cheng-Hsun Chiu Chang Gung memorial Hospital, Chang Gung University Taiwan Dr. Ajay Singh DDU Gorakhpur University, Gorakhpur-273009 (U.P.) India Dr. Karabo Shale Central University of Technology, Free State South Africa Dr. Lourdes ZГ©lia Zanoni Department of Pediatrics, School of Medicine, Federal University of Mato Grosso do Sul, Campo Grande, Mato Grosso do Sul Brazil Dr. Tulin Askun Balikesir University Turkey Dr. Marija Stankovic Institute of Molecular Genetics and Genetic Engineering Republic of Serbia Dr. Scott Weese University of Guelph Dept of Pathobiology, Ontario Veterinary College, University of Guelph, Guelph, Ontario, N1G2W1, Canada Dr. Sabiha Essack School of Health Sciences South African Committee of Health Sciences University of KwaZulu-Natal Private Bag X54001 Durban 4000 South Africa Dr. Hongxiong Guo STD and HIV/AIDS Control and Prevention, Jiangsu provincial CDC, China Dr. Konstantina Tsaousi Life and Health Sciences, School of Biomedical Sciences, University of Ulster Dr. Bhavnaben Gowan Gordhan DST/NRF Centre of Excellence for Biomedical TB Research University of the Witwatersrand and National Health Laboratory Service P.O. Box 1038, Johannesburg 2000, South Africa Dr. Ernest Kuchar Pediatric Infectious Diseases, Wroclaw Medical University, Wroclaw Teaching Hospital, Poland Dr. Hare Krishna Central Institute for Arid Horticulture, Beechwal, Bikaner-334 006, Rajasthan, India Dr. Hongxiong Guo STD and HIV/AIDS Control and Prevention, Jiangsu provincial CDC, China Dr. Anna Mensuali Dept. of Life Science, Scuola Superiore Sant’Anna Dr. Mar Rodriguez Jovita Food Hygiene and Safety, Faculty of Veterinary Science. University of Extremadura, Spain Dr. Ghada Sameh Hafez Hassan Pharmaceutical Chemistry Department, Faculty of Pharmacy, Mansoura University, Egypt Dr. KГЎtia FlГЎvia Fernandes Biochemistry and Molecular Biology Universidade Federal de GoiГЎs Brasil Dr. Abdel-Hady El-Gilany Public Health & Community Medicine Faculty of Medicine, Mansoura University Egypt Dr. Jes Gitz Holler Hospital Pharmacy, Aalesund. Central Norway Pharmaceutical Trust Professor Brochs gt. 6. 7030 Trondheim, Norway Prof. Chengxiang FANG College of Life Sciences, Wuhan University Wuhan 430072, P.R.China Dr. Anchalee Tungtrongchitr Siriraj Dust Mite Center for Services and Research Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University 2 Prannok Road, Bangkok Noi, Bangkok, 10700, Thailand Instructions for Author Electronic submission of manuscripts is strongly encouraged, provided that the text, tables, and figures are included in a single Microsoft Word file (preferably in Arial font). The cover letter should include the corresponding author's full address and telephone/fax numbers and should be in an e-mail message sent to the Editor, with the file, whose name should begin with the first author's surname, as an attachment. Article Types Three types of manuscripts may be submitted: Regular articles: These should describe new and carefully confirmed findings, and experimental procedures should be given in sufficient detail for others to verify the work. The length of a full paper should be the minimum required to describe and interpret the work clearly. Short Communications: A Short Communication is suitable for recording the results of complete small investigations or giving details of new models or hypotheses, innovative methods, techniques or apparatus. The style of main sections need not conform to that of full-length papers. Short communications are 2 to 4 printed pages (about 6 to 12 manuscript pages) in length. Reviews: Submissions of reviews and perspectives covering topics of current interest are welcome and encouraged. Reviews should be concise and no longer than 4-6 printed pages (about 12 to 18 manuscript pages). Reviews are also peer-reviewed. Review Process All manuscripts are reviewed by an editor and members of the Editorial Board or qualified outside reviewers. Authors cannot nominate reviewers. Only reviewers randomly selected from our database with specialization in the subject area will be contacted to evaluate the manuscripts. The process will be blind review. Decisions will be made as rapidly as possible, and the Journal strives to return reviewers’ comments to authors as fast as possible. The editorial board will re-review manuscripts that are accepted pending revision. It is the goal of the AJMR to publish manuscripts within weeks after submission. Regular articles All portions of the manuscript must be typed doublespaced and all pages numbered starting from the title page. The Title should be a brief phrase describing the contents of the paper. The Title Page should include the authors' full names and affiliations, the name of the corresponding author along with phone, fax and E-mail information. Present addresses of authors should appear as a footnote. The Abstract should be informative and completely selfexplanatory, briefly present the topic, state the scope of the experiments, indicate significant data, and point out major findings and conclusions. The Abstract should be 100 to 200 words in length.. Complete sentences, active verbs, and the third person should be used, and the abstract should be written in the past tense. Standard nomenclature should be used and abbreviations should be avoided. No literature should be cited. Following the abstract, about 3 to 10 key words that will provide indexing references should be listed. A list of non-standard Abbreviations should be added. In general, non-standard abbreviations should be used only when the full term is very long and used often. Each abbreviation should be spelled out and introduced in parentheses the first time it is used in the text. Only recommended SI units should be used. Authors should use the solidus presentation (mg/ml). Standard abbreviations (such as ATP and DNA) need not be defined. The Introduction should provide a clear statement of the problem, the relevant literature on the subject, and the proposed approach or solution. It should be understandable to colleagues from a broad range of scientific disciplines. Materials and methods should be complete enough to allow experiments to be reproduced. However, only truly new procedures should be described in detail; previously published procedures should be cited, and important modifications of published procedures should be mentioned briefly. Capitalize trade names and include the manufacturer's name and address. Subheadings should be used. Methods in general use need not be described in detail. Results should be presented with clarity and precision. The results should be written in the past tense when describing findings in the authors' experiments. Previously published findings should be written in the present tense. Results should be explained, but largely without referring to the literature. Discussion, speculation and detailed interpretation of data should not be included in the Results but should be put into the Discussion section. The Discussion should interpret the findings in view of the results obtained in this and in past studies on this topic. State the conclusions in a few sentences at the end of the paper. The Results and Discussion sections can include subheadings, and when appropriate, both sections can be combined. The Acknowledgments of people, grants, funds, etc should be brief. Tables should be kept to a minimum and be designed to be as simple as possible. Tables are to be typed doublespaced throughout, including headings and footnotes. Each table should be on a separate page, numbered consecutively in Arabic numerals and supplied with a heading and a legend. Tables should be self-explanatory without reference to the text. The details of the methods used in the experiments should preferably be described in the legend instead of in the text. The same data should not be presented in both table and graph form or repeated in the text. Figure legends should be typed in numerical order on a separate sheet. Graphics should be prepared using applications capable of generating high resolution GIF, TIFF, JPEG or Powerpoint before pasting in the Microsoft Word manuscript file. Tables should be prepared in Microsoft Word. Use Arabic numerals to designate figures and upper case letters for their parts (Figure 1). Begin each legend with a title and include sufficient description so that the figure is understandable without reading the text of the manuscript. Information given in legends should not be repeated in the text. References: In the text, a reference identified by means of an authorвЂ�s name should be followed by the date of the reference in parentheses. When there are more than two authors, only the first authorвЂ�s name should be mentioned, followed by ’et alвЂ�. In the event that an author cited has had two or more works published during the same year, the reference, both in the text and in the reference list, should be identified by a lower case letter like ’aвЂ� and ’bвЂ� after the date to distinguish the works. Examples: Abayomi (2000), Agindotan et al. (2003), (Kelebeni, 1983), (Usman and Smith, 1992), (Chege, 1998; 1987a,b; Tijani, 1993,1995), (Kumasi et al., 2001) References should be listed at the end of the paper in alphabetical order. Articles in preparation or articles submitted for publication, unpublished observations, personal communications, etc. should not be included in the reference list but should only be mentioned in the article text (e.g., A. Kingori, University of Nairobi, Kenya, personal communication). Journal names are abbreviated according to Chemical Abstracts. Authors are fully responsible for the accuracy of the references. Examples: Chikere CB, Omoni VT and Chikere BO (2008). Distribution of potential nosocomial pathogens in a hospital environment. Afr. J. Biotechnol. 7: 3535-3539. Moran GJ, Amii RN, Abrahamian FM, Talan DA (2005). Methicillinresistant Staphylococcus aureus in community-acquired skin infections. Emerg. Infect. Dis. 11: 928-930. Pitout JDD, Church DL, Gregson DB, Chow BL, McCracken M, Mulvey M, Laupland KB (2007). Molecular epidemiology of CTXM-producing Escherichia coli in the Calgary Health Region: emergence of CTX-M-15-producing isolates. Antimicrob. Agents Chemother. 51: 1281-1286. Pelczar JR, Harley JP, Klein DA (1993). Microbiology: Concepts and Applications. McGraw-Hill Inc., New York, pp. 591-603. Short Communications Short Communications are limited to a maximum of two figures and one table. They should present a complete study that is more limited in scope than is found in full-length papers. The items of manuscript preparation listed above apply to Short Communications with the following differences: (1) Abstracts are limited to 100 words; (2) instead of a separate Materials and Methods section, experimental procedures may be incorporated into Figure Legends and Table footnotes; (3) Results and Discussion should be combined into a single section. Proofs and Reprints: Electronic proofs will be sent (email attachment) to the corresponding author as a PDF file. Page proofs are considered to be the final version of the manuscript. With the exception of typographical or minor clerical errors, no changes will be made in the manuscript at the proof stage. Fees and Charges: Authors are required to pay a $550 handling fee. Publication of an article in the African Journal of Microbiology Research is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance) that the editorial office waive some of the handling fee under special circumstances Copyright: В© 2014, Academic Journals. All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary bibliographic citation, including author attribution, date and article title. Submission of a manuscript implies: that the work described has not been published before (except in the form of an abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the publisher. Disclaimer of Warranties In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any kind arising out of or in connection with the use of the articles or other material derived from the AJMR, whether or not advised of the possibility of damage, and on any theory of liability. This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement. Descriptions of, or references to, products or publications does not imply endorsement of that product or publication. While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or information in this publication or of any other publication to which it may be linked. African Journal of Microbiology Research International Journal of Medicine and Medical Sciences Table of Content: Volume 8 Number 8, February 19, 2014 ARTICLES Morphological and molecular characterization of pathogenic isolates of Fusarium spp. obtained from gladiolus corms and their sensitivity to Jatropha curcas L. oil Liliana CГіrdova Albores, Silvia Bautista BaГ±os, Jorge MartГnez Herrera, Laura Barrera Necha, MГіnica HernГЎndez LГіpez and AndrГ©s Cruz HernГЎndez Screening phosphate solubilizing actinobacteria isolated from the rhizosphere of wild plants from the Eastern Cordillera of the Colombian Andes Luis Daniel Prada Salcedo, Carolina Prieto and Marcela Franco Correa Establishment of EvaGreen qPCR for detecting bovine rotavirus based on VP7 gene Wei Suocheng, Che Tuanjie, Wang Jingming, Li Yukong, Zhang Taojie, Song Changjun and Tian Fengling Nutritional requirements for the production of antimicrobial metabolites from Streptomyces Mariadhas Valan Arasu, Thankappan Sarasam Rejiniemon, Naif Abdullah Al-Dhabi, Veeramuthu Duraipandiyan, Savarimuthu Ignacimuthu, Paul Agastian, Sun-Ju Kim, V. Aldous J. Huxley, Kyung Dong Lee, Ki Choon Choi Incidence of Aspergillus contamination of groundnut (Arachis hypogaea L.) in Eastern Ethiopia Abdi Mohammed and Alemayehu Chala Microencapsulation, survival and adherence studies of indigenous probiotics Ammara Hassan, M. Nawaz Ch and Barbara Rasco Screening novel diagnostic marker of Mycobacterium tuberculosis Xin Pan, Siliang Zeng, Jialin Cai, Bin Zhang, Boju Pan, Zhonglei Pan, Ying Wu, Ying Wang, Yi Zhou, Wei Fang, Min Chen, Wanqing Liao, XiuZhen Yu, Min Tao, Jun Zhang and Wei Song An outbreak of ringworm caused by Trichophyton verrucosum in a group of calves in Vom, Nigeria Dalis, J. S., Kazeem, H. M., Kwaga, J. K. P. and Kwanashie, C. N. African Journal of Microbiology Research Table of Content: Volume 8 Number 8, February 19, 2014 Characteristics of nodule bacteria from Mimosa spp grown in soils of the Brazilian semiarid region Ana Dolores Santiago de Freitas, Wardsson Lustrino Borges, Monaliza Mirella de Morais Andrade, Everardo Valadares de SГЎ Barretto Sampaio, Carolina Etienne de RosГЎlia e Silva Santos, Samuel Ribeiro Passos, Gustavo Ribeiro Xavier, Bruno Mello Mulato and Maria do Carmo Catanho Pereira de Lyra Microbiological assessment of dentists’ hands in clinical performance MГЎrcia Rosental da Costa CARMO, Jorge Kleber CHAVASCO, Solange de Oliveira Braga FRANZOLIN, Luiz Alberto BEIJO, JГєlia Rosental de SOUZA CRUZ and Paulo Henrique WECKWERTH Evaluation of marine macro alga, Ulva fasciata against bio-luminescent causing Vibrio harveyi during Penaeus monodon larviculture Krishnamoorthy Sivakumar, Sudalayandi Kannappan, Masilamani Dineshkumar and Prasanna Kumar Patil Characterization and determination of antibiotic susceptibility pattern of bacteria isolated from some fomites in a teaching hospital in northern Nigeria Aminu Maryam, Usman-Sani Hadiza and Usman M. Aminu Prevalence of different enterococcal species isolated from blood and their susceptibility to antimicrobial drugs in Vojvodina, Serbia, 2011-2013 MihajloviД‡-Ukropina Mira, MediД‡ Deana, JelesiД‡ Zora, Gusman Vera, MilosavljeviД‡ Biljana and RadosavljeviД‡ Biljana Prevalence of anti-Anaplasma phagocytophilum antibodies among dogs from Monterrey, Mexico J. A. Salinas-MelГ©ndez, R. Villavicencio-Pedraza, B. V. Tamez-HernГЎndez, J. J. HernГЎndez-EscareГ±o, R. Avalos-RamГrez, J. J. Zarate-Ramos, F. J. PicГіn-Rubio and V. M. Riojas-ValdГ©s Novel simple diagnostic methods compared to advanced ones for the diganosis of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasmas hominis in patients with complicated urinary tract infections Hala Badawi, Aisha Abu Aitta, Maisa Omar, Ahmed Ismail, Hanem Mohamed, Manal El Said, Doaa Gamal, Samah Saad El Dine and Mohamed Ali Saber Vol. 8(8), pp. 724-733, 19 February, 2014 DOI: 10.5897/AJMR2013.6413 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper Morphological and molecular characterization of pathogenic isolates of Fusarium spp. obtained from gladiolus corms and their sensitivity to Jatropha curcas L. oil Liliana CГіrdova Albores1, Silvia Bautista BaГ±os1, Jorge MartГnez Herrera1, Laura Barrera Necha1, MГіnica HernГЎndez LГіpez1 and AndrГ©s Cruz HernГЎndez2 1 Instituto PolitГ©cnico Nacional-Centro de Desarrollo de Productos BiГіticos. Carr. Yautepec-Jojutla km. 6, San Isidro, CEPROBI 8, Yautepec, Morelos, C. P. 62731, MГ©xico. 2 Universidad AutГіnoma de QuerГ©taro. Laboratorio de MicrobiologГa, Facultad de Ciencias Naturales-BiologГa. Av. de las Ciencias s/n, Juriquilla, QuerГ©taro, DelegaciГіn Santa Rosa Jauregui. C.P. 76230. MГ©xico. Accepted 30 January, 2014 The State of Morelos is the third biggest gladiolus producer in Mexico. However, this ornamental is affected by the disease named corm rot or fusarium yellows, characterized by leaf yellowing, epinasty and wilting, and caused by fungi of the genus Fusarium. The first objective was to corroborate the pathogenicity of the 45 isolates obtained. The second objective was to identify and characterize morphologically and molecularly by polymerase chain reaction-internal transcribed spacer (PCR-ITS), the highly pathogenic isolates and comparatively analyze the fungal species involved with the reference strain Fusarium oxysporum f. sp. gladioli (Fog). The third objective was to quantify the phorbol esters in Jatropha curcas oil and evaluate their antifungal potential on mycelial growth and conidial germination of different Fusarium species. Eleven isolates were highly significant pathogenic (P < 0.001). Three fungal species were identified in basal stems and damaged corms taken from field plants, namely F. oxysporum, Fusarium solani and Fusarium proliferatum. Molecular analyzes corroborated the species identified and their sequences were deposited in the National Center for Biotechnology Information (NCBI) gene bank. The percentage of oil obtained was 61.5 %; the phorbol ester content in the oil was -1 1.52 mg g of 12,13-phorbol myristate. All species identified and the reference strain was sensitive to -1 the 5 mg mL oil concentration. Key words: Corm rot, Fusarium, molecular analysis, phorbol esters, Fusarium development. INTRODUCTION The gladiolus is one of the main crops in the State of Morelos, which ranks as Mexico’s third biggest producer of this flowering plant. Corm rot is caused by Fusarium spp. and results in losses of 60-80% during storage (SAGARPA, 2006). Members of the genus Fusarium are among the most important plant pathogens worldwide. Fusarium species are widely distributed in soil and organic substrates and are abundant in cultivated soils in temperate and tropical regions (Booth, 1985). Some species of this genus produce mycotoxins in stored food *Corresponding author. E-mail: [email protected]. Tel: 52 7353942020. Albores et al. and cause disease in animals and humans (Ortoneda et al., 2003). Like many soil-borne fungi, the genus Fusarium is amply endowed with means of survival, one of its mechanisms being the ability to rapidly change both its host and its morphology and behavior (Booth, 1985; Alves-Santos et al., 1999; Katan and Di Primo, 1999; Ortoneda et al., 2003). Differentiation of Fusarium spp. is based on physiological and morphological characteristics, such as the size and shape of macroconidia, presence or absence of microconidia and chlamydospores, and colony morphology. Subtle differences in a single feature can delineate species. Characterization by molecular techniques using polymerase chain reaction (PCR) to amplify the internal transcribed sequences (ITS) allows identifying organisms that cannot be distinguished morphologically, and they can also help to understand the mechanisms of pathogenic variation and therefore, to develop effective management strategies (Flores-Olivas et al., 1997; Alves-Santos et al., 1999; Baayen, 2000; Haan et al., 2000). Management by synthetic fungicides leads to resistance, environmental pollution, elimination of beneficial entomofauna and operator poisoning. Consequently, there are a large number of reports on the development of alternatives such as the use of essential oils (Pauli and Knobloch, 1987; Pintore et al., 2002; Barrera-Necha and GarcГa-Barrera, 2008; Barrera-Necha et al., 2009; Tripathi et al., 2009); however, there are few reports on the use of vegetable oils. Jatropha curcas belongs to the family Euforbiaceae. In Mexico, the latex of this plant is used to treat mouth infections and digestive problems caused by certain fungi, and to make biodiesel, which gives it considerable economic importance (MartГnez-Herrera, 2006). The seeds contain chemical compounds, among which tannins, saponins and phorbol esters stand out for their possible biological activity. J. curcas oil has insecticidal activity (Wink et al., 1997), and it has also been tested as an antimicrobial agent to treat infections, including sexually transmitted ones, in humans (Aiyelaagbe et al. 2007). Based on this, studies have focused on fungal development in in vitro tests demonstrating that mycelial growth of several fungi, including Alternaria alternata, Aspergillus flavus, A. fumigans, A. niger and Fusarium chladmydosporum, is inhibited when grown on seed oil and crude seed extracts at concentrations of 100 and 500 Вµl (Srivastava et al., 2012). In an attempt to evaluate the fungicidal effect of different plant organs of J. curcas, it was found that seeds followed by the fruit pulp and the whole fruit had significant inhibition of the mycelia of the fungus Colletrotrichum gloeosporioides isolated from papaya fruits (Rahman et al., 2011). Therefore, it is necessary to carry out studies to evaluate the use of different antifungal compounds to control fungal diseases such as phorbol esters contain in seed oil. The aims of this study were to verify the pathogenicity of the isolates obtained from gladiolus corms in the State of Morelos, to morphologically and molecularly characterize Fusarium isolates 725 obtained and evaluate their response to J. curcas seed oil. MATERIALS AND METHODS Sampled material Corms and plants (yellowing of leaves and corms with basal rot) of five varieties (вЂ�White foam’, вЂ�Red ewe’, вЂ�White ewe’, вЂ�Yellow’ and вЂ�Sancerri’) were collected in the field in seven producing municipalities in the State of Morelos. A total of 34 plants showing symptoms of corm rot were collected from August to October 2011 from commercial fields in Cuautla, Yautepec, Ayala, Tlanepantla, Temixco, Yecapixtla and Totolapan. Isolation of fungi Soil and roots were removed from gladiolus corms by washing with running water and then corms were immersed in an acaricide solution (AKВ®20) at a concentration of 15 ml l-1 for 5 min and left to dry. They were disinfected with a sodium hypochlorite solution at 5% for 3 min, rinsed with sterile distilled water and placed in humid chambers for 24 h to promote fungal growth. From mycelium developed in the corms, isolates were made on Potato Dextrose Agar (PDA) medium and incubated at room temperature for 7 days. Monosporic cultures were established as described by Leslie and Summerell (2006). Pathogenicity tests Forty-five isolates showed differences in the color of the colonies and initially they were selected as different species. Healthy corms of the variety вЂ�White foam’, pre-peeled and pre-treated with a contact fungicide (CaptanВ® 2 g L-1), were planted in sterile soil (121В°C, 15 lb pressure for 3 h) under greenhouse conditions. Once the approximately 1-cm stem emerged, 5 mL of the isolated spore solution of each isolate to examine were added at a concentration of 1 Г— 106 spores ml-1. The reference strain used was Fusarium oxysporum f. sp. gladioli (Fog) already molecularly identified (GarduГ±o-PizaГ±a et al., 2010) and it was treated in the same way without inoculation. Plants were assessed three weeks after inoculation. To statistically assess pathogenicity, a damage scale was developed based on the corm rot symptoms observed in the plants, assigning it numerical values: no symptoms (plant and corm) (1); epinasty/stunting (2); yellowing (3); plant did not emerge with root development (4); plant did not emerge (5) (Mendoza, 1977). Data analysis A completely randomized design with 5 replicates for each isolate and a control treatment (reference strain, labeled as Fog) were used. Analysis of variance of repeated means and a multiple comparison against the control were performed with the Holm-Sidak method (P < 0.05) using the Sigma Stat 3.5 statistical package designed by STATCONВ© Witzenhausen, Germany. Morphological characterization For taxonomic identification of the isolates, the classification methodology of Nelson et al. (1983) and Leslie and Summerell (2006) was used. These authors suggest taking as references the A] = 726 Afr. J. Microbiol. Res. colony colors on PDA, and the length of the phialides, chlamydospores, microconidia and macroconidia. The length of the structures was measured using ImageTool В© software for Windows Version 3.0 Alpha 4 designed by the Center for Health Sciences, University of Texas. Morphological observations and measurements were made with a compound microscope at 40x. 52’ 17” North; 92В° 27’ 04” West, at 26 masl. 3) Ejido la Victoria, municipality of MazatГЎn, Chiapas, 14В° 49’ 16” North; 92В° 29’ 56” West, at 10 masl. Location altitudes were taken with a GPS lll (Garmin, GPS lll Plus model, Ronsey, UK). Oil extraction Molecular characterization DNA extraction from 12 monosporic isolates was performed by the method described by Doyle and Doyle (1990), with modifications. The quality of the DNA obtained was verified by electrophoresis on 1% agarose gel stained with ethidium bromide (0.1 Вµg Вµl-1) and observed in a gel documentation system (G BoxВ®; Syngene, England). DNA concentration was calculated by measuring the optical density at 260 nm with the following formula: [DNA] = PCR for ITS primers The ITS regions were amplified with the primers ITS1 (TCCGTAGGTGAACCTGCGG), ITS2 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG) (White et al., 1990; Haan et al., 2000; Abd-Elsalam et al., 2003; Moreno-VelГЎzquez et al., 2005; Teixeira et al., 2005; GonzГЎlez-PГ©rez et al., 2009), as well as the specific primers for the genus Fusarium reported by Adb-Elsalam et al. (2003): ITS-Fu-Fwd (CGCACGATTACCACTAACGA) and ITSFu-Rev (CAACTCCCAAACCCCTGTGA). The primers were synthesized by the Sigma AldrichВ® Company. Each PCR reaction was carried out in a final volume of 25 Ојl; 5.5 Ојl of nuclease-free water were mixed with 2.0 Ојl of DNA of the fungus problem, 2.5 Ојl of each ITS and 12.5 Ојl of Taq 2X Master MixВ® (BioLabsInc, New England). The amplification reaction was carried out in a Perkin Elmer В® thermocycler (GeneAmp PCR System 2400) with the following program: initial denaturation at 95В°C for 5 min; 35 cycles of denaturation, alignment and extension at 95В°C for 1 min and 72В°C for 2 min. respectively, and a final extension at 72В°C for 10 min. The amplified fragments were verified by electrophoresis in 1% agarose gel stained with ethidium bromide (0.1 Ојg Ојl-1). The gel was run at 85 V for 40 min and observed in a gel documentation system (G BoxВ®; Syngene, England). Sequencing The amplified PCR products were purified using the DNA Clean & ConcentratorTM-5 Kit (Zymo Research, USA) and analyzed at the Sequencing Laboratory of the Institute of Biotechnology, belonging to the University National Autonomous of MГ©xico, in Cuernavaca, Morelos. The sequences were aligned and compared with sequences in the National Center for Biotechnology Information (NCBI) database using the Basic Local Alignment Search Tool (BLAST) (Zhang et al., 2000). Collection of J. curcas seeds Seeds were collected from J. curcas plants being used as a living fence in the following locations: 1) Segunda SecciГіn de la Cebadilla, municipality of Tapachula, Chiapas, 14В° 50’ 48” North; 92В° 17’ 00” West, at 109 masl. 2) Villa de MazatГЎn, Chiapas, 14В° The extraction of the seed oil was performed according to the Soxhlet method (NMX-F-089-S-1978), with petroleum ether and hexane and 8-h reflux time. About 2 to 5 g of ground J. curcas seeds were weighed and placed in the extraction thimble. After extraction, the solvent was gently evaporated from the flask and the excess petroleum ether or hexane was removed using a BГњCHI model 114 rotary evaporator (BГњCHIВ® Labortechnik AG, Switzerland) at 60В°C. The calculations to determine the percentage of oil obtained was performed using the formula: Oil (%) = (P-p/M) Г— 100 Where: P = mass in grams of the flask with the oil; p = mass in grams of the flask; M = mass in grams of the sample. Phorbol esters were quantified using the high performance liquid chromatography (HPLC) method described by MartГnez-Herrera (2006). Specifically, 20 ml of methanol were added to a 2 g sample, which was sonicated for 2 min. The sample was centrifuged at 3600 rpm for 10 min and the supernatant was evaporated almost to dryness in a rotary evaporator (the extraction was repeated 3 times). The standard used was 12,13-phorbol myristate (Sigma AldrichВ®), which showed a retention time of 25 min. The results were expressed as mg g-1 of sample equivalent to 12,13-phorbol myristate. This analysis was performed in the food laboratory of the Institute of Animal Production in the Tropics and Subtropics at the University of Hohenheim in Stuttgart, Germany. Mycelial growth Only the 11 isolates mentioned above and the reference strain (Fog) were used to evaluate this parameter. A 5-mm disc of the pathogen was placed on 60 Г— 15 mm Petri dishes containing PDA, Tween 20В® and the oil at different concentrations (2.5, 5 and 10 mg ml-1), as well as 4 controls: PDA, petroleum ether (10 mg ml-1), Tween 20В® (10 mg ml-1) and CaptanВ® (2 g L-1). They were incubated at 25В°C in the dark. Diameter growth was measured daily for 5 days with a Vernier caliper until the control treatments reached the edge of the Petri dish. The experimental design was completely randomized and consisted of 7 treatments with 6 replicates. Analysis of variance (ANOVA) and Tukey’s comparison of means test (P < 0.05) were performed using the Sigma Stat 3.5 software program designed by STATCONВ© Witzenhausen, Germany. Spore germination Ten milliliters of sterile distilled water were added to Petri dishes containing the growth of each isolate, then the surface was scraped with a bent metal rod and the filtrate was passed through cotton gauze. Of this suspension, 20 Вµl were placed on PDA discs of 10 mm in diameter and incubated for 6 to 10 h at room temperature (26В°C). Later, a few drops of lactophenol methylene blue were added and the number of germinated spores was determined by photo analysis with Image ToolВ© software for Windows version 2.01 Alpha 4, developed by the Center for Health Sciences at the University of Texas. Germination was evaluated on nine PDA discs. Mean percentage germination and standard deviations were calculated. Albores et al. 1 2 3 4 5 6 7 727 8 Figure 1. Preliminary classification of isolates according to coloring on PDA medium. RESULTS Number of isolates Their morphological aspect, identified as belonging to the genus Fusarium, obtained a total of 45 isolates. The isolates showed different apparent morphological characteristics, mainly in the color of the culture medium. Nelson et al. (1983) performed a morphological characterization using the coloration on PDA as indicating that each species has a specific color. Based on the coloring obtained, a preliminary classification was conducted, obtaining a total of eight groups as shown in Figure 1. in isolates T9, T11, T12, T20, T24, T30, T32, T34, T35, T39 and T40, which were collected from the municipalities of Yautepec and Cuautla (Figure 2). Isolates that showed highly significant differences in the pathogenicity capacity were used for morphological and molecular characterization and J. curcas oil sensitivity testing. Morphological characterization Some of the typical structures of the 11 isolates and the reference strain (Fog) are summarized in Table 1. Pathogenicity tests Molecular characterization Statistical analysis showed that when compared with the reference strain Fog (T25), isolates T1, T15, T20, T36 and T44 were significantly different (P < 0.01), whereas highly significant differences (P < 0.001) were observed The DNA had a yield of 220 to 670 Вµg g-1 of mycelium, the band of the PCR products containing the primers ITS2-ITS5 was 500 base pairs (bp) and the PCR product for the primers ITS-Fu-Fwd and ITS-Fu-Rev was from 728 Afr. J. Microbiol. Res. Figure 2. Comparison of means against the reference strain Fog (T25) of the pathogenic capacity of isolates of Fusarium spp. Significant difference *P < 0.01; **P < 0.001. 410 to 429 bp (Figure 3). For the multiple alignments, the total amplified portion of the 12-nucleotide sequences is shown in Table 2, which corresponds to the complete sequence of both regions (ITS2 and ITS5). In Genbank, the sequence of F. oxysporum f. sp gladioli and isolates T30, T35 and T39 showed a similarity index of 99% with F. oxysporum. Another five isolates showed a similarity index of 99% with F. proliferatum. Isolates T20 and T34 showed no similarity to other sequences (Table 2). Oil extraction The oil percentage obtained for both solvents was 61.5%. Phorbol esters in the kernel meal and the oil extracted with petroleum ether were 0.94 and 1.52 mg g-1, respectively, while the oil extracted with hexane was 0.24 and 0.67 mg g-1, respectively. Mycelium growth Comparison of means of mycelial growth on the last day of each treatment indicated that the eleven Fusarium isolates and the reference strain (Fog) were more -1 sensitive to the concentration of 5 mg ml . Isolates T9, T11, T20, T32, T34, T35 and T40 were also sensitive to the concentration of 2.5 mg ml-1. For isolate T9, it was observed that the concentration of 5 mg ml-1 showed less mycelial growth than the fungicide CaptanВ®, while for the isolate T11 incubated at the same concentration (5 mg ml-1) and the control with TweenВ®20 there were no significant differences. The isolate most susceptible to the fungicide CaptanВ® was the reference strain (Fog) (Table 3). Spore germination Treatment susceptibility depended on the isolate, as no trend was observed for any specific treatment (Table 4). Isolate T9 presented the lowest germination rate with J. curcas oil at concentrations of 2.5 and 10 mg ml-1 with a percentage germination of 14.40 and 14.43%, respectively, as compared to 98.44% for the PDA treatment. Isolate T24 also showed a low germination rate, which was 12.62 and 17.28% for the concentrations of 2.5 and 5 mg ml-1, respectively. Isolate T24 was the most susceptible to the treatment with the fungicide CaptanВ®, presenting a germination of 33.79% while the PDA treatment had 99.77% germination. DISCUSSION The highly pathogenic isolates were characterized morphologically, identifying at least 2 species: F. oxysporum and Fusarium solani, which had different morphological features, both gross and microscopic, and which were associated with the afore mentioned species. GonzГЎlez-PГ©rez et al. (2009) reported that these species caused rot in gladiolus in San Martin Texmelucan, Puebla. They also reported that these species differed in terms of colony color and morphological characteristics, coinciding with the results obtained in this work for descriptions of macro- and micro-conidia, phialides and chlamydospores. For their part, Montiel-Gonzalez et al. (2005) described the morphological characteristics of F. oxysporum, F. solani, Fusarium lateritium, Fusarium reticulatum, Fusarium equiseti, Fusarium verticillioides, Fusarium culmorum, Fusarium crookwellense, Fusarium proliferatum and Fusarium sporotrichioides present in bean roots in five Albores et al. 729 Table 1. Morphological characteristics of isolates of the genus Fusarium collected in gladiolus-growing areas of the state of Morelos. Isolate Color Anverse Reverse Fog* White Violet T9 White T11 Microconidia Macroconidia Size (пЃm) Chlamydospore Species 3 No F. oxysporum 48.72-64.51 3-4 No F. solani Distinctly notched 69.63-73.19 3-4 Single and paired verrucose F. oxysporum Blunt Barely notched 55.37-82.54 3-4 No F. solani Oval Oval with one septa Papillate Barely notched 56.35-67.68 3-4 Single verrucose F. solani Papillate Barely notched 54.77-87.51 3-4 Single verrucose Paired smoothwalled F. solani Apical Basal Oval with one septa Oval Hooked Distinctly notched 50.50-67.49 Orange Oval with one septa Reniform Blunt Barely notched White Brown Oval Oval with one septa Hooked T12 White and orange Brown Oval with one septa Oval T20 White Cream # septa T24 Cream Cream Oval Pyriform Globose Oval with one septa T30 White Cream Obovoid with a truncate base NO NO NO NO Single and paired verrucose Fusarium spp. T32 White Cream Oval Obovoid with a truncate base Oval with one septa Blunt Foot shaped 57.31-69.52 3 Single verrucose Paired smoothwalled F. oxysporum T34 White Cream Oval Obovoid with a truncate base NO NO NO NO Single verrucose Paired Fusarium spp. T35 White Violet Oval Oval with one septa NO NO NO NO Single smooth Fusarium spp. T39 White and orange Cream Globose oval Oval with one septa NO NO NO NO Chains 2,3 and 4 verrucose Fusarium spp. T40 Cream Yellow Globose Oval Obovoid with a truncate base NO NO NO NO Single verrucose Fusarium spp. *Reference strain. 730 Afr. J. Microbiol. Res. Figure 3. 1% agarose gel electrophoresis of the PCR products of the regions ITS-Fu-Fwd and ITS-Fu-Rev of the isolates of Fusarium spp. Line: M) Molecular marker 100 bp (BioLabsInc, New England), 1) Fog, 2) T9, 3) T11, 4) T12, 5) T20, 6) T24, 7) T30, 8) T32, 9) T34, 10) T35, 11) T39, 12) T40. Table 2. Morphological and molecular characterization of highly pathogenic isolates from gladiolus corms. Color Isolate Species Similarity percentage (%) Morphological Molecular Molecular Anverse Reverse characterization characterization size (bp) Accession number NCBI FOG* White Violet Fusarium oxysporum Fusarium oxysporum 537 99 GU724514.1 T9 White Orange Fusarium solani Fusarium solani 538 99 EU982942.1 T11 White Brown Fusarium oxysporum Fusarium proliferatum 553 99 EU839366.1 T12 T20 T24 White White Cream Brown Cream Cream Fusarium solani Fusarium solani Fusarium solani Fusarium solani No identified Fusarium solani 539 435 456 86 EU625405.1 78 GU355660.1 T30 White Cream Fusarium spp Fusarium oxysporum 526 99 GU445378.1 T32 White Cream Fusarium oxysporum Fusarium solani 541 99 FJ460589.1 T34 White Cream Fusarium spp No identified 433 T35 White Violet Fusarium spp Fusarium oxysporum 516 99 GU724514.1 T39 White Cream Fusarium spp Fusarium oxysporum 515 99 GU724514.1 T40 Cream Yellow Fusarium spp Fusarium solani 557 99 EU625405.1 states of central Mexico. The descriptions made for the species isolated in this study also agreed with those reported by these authors. Molecular taxonomic results by PCR: ITS confirm the morphological identification of ten isolates, which corresponded to F. oxysporum, F. solani and F. proliferatum. The two isolates that showed no similarity when aligning them using BLAST could be Fusarium species, where genetic variation has occurred due to the indiscriminate use of fungicides in the region. Alternatively, these unidentified isolates could be species not yet reported. The percentage of J. curcas seed oil reported by MartГnez-Herrera et al. (2010) coincides with the values obtained in this research in seeds from the state of Chiapas, with a value of 60.4%. The same author reports phorbol ester values of 2.03 mg g-1 in oil and 0.16 mg g-1 in kernel meal. The differences in phorbol ester Albores et al. 731 Table 3. Effect of J. curcas oil on mycelial growth of isolates of Fusarium spp. Treatment PDA В® Tween 20 В® Captan Petroleum ether -1 Oil 2.5 mg mL -1 Oil 5 mg mL -1 Oil 10 mg mL Isolate Fog* a T9 4.08 (0.82) a 3.45 (0.61) b 0.78 (0.08) a 3.91 (0.75) a 3.61 (0.72) b 1.28 (0.17) a 3.39 (0.72) a T11 4.51 (0.82) bc 3.10 (0.53) d 1.31 (0.17) bc 3.0 (0.56) c 2.78 (0.54) d 1.26 (0.15) ab 3.70 (0.77) a 4.95 (1.01) c 2.86 (0.47) d 1.43 (0.20) b 3.93 (0.76) c 2.81 (0.47) d 1.83 (0.28) bc 3.11 (0.61) T12 T20 a a 4.19 (0.87) 4.76 (0.96) bc d 3.55 (0.5) 2.91 (0.48) d e 1.43 (0.19) 1.50 (0.21) bc bc 3.11 (0.6) 3.78 (0.74) bc cd 3.23 (0.6) 3.55 (0.70) d e 1.92 (0.28) 2.06 (0.34) ab ab 3.67 ( 0.6) 4.50 (0.92) T24 a 3.70 (0.79) bc 2.61 (0.46) d 1.08 (0.13) ab 3.03 (0.53) ab 3.33 (0.68) cd 1.95 (0.28) ab 3.05 (0.61) T30 a 4.26 (0.84) ab 3.56 (0.89) d 1.23 (0.19) ab 3.96 (0.81) ab 3.60 (0.68) c 2.61 (0.45) bc 3.38 (0.68) T32 a T34 4.68 (0.96) bc 3.0 (0.56) e 0.90 (0.09) b 3.66 (0.72) cd 2.23 (0.40) de 1.23 (0.14) b 3.35 (0.66) a 4.16 (0.88) abc 3.56 (0.70) e 0.98 (0.09) bcd 3.31 (0.66) cd 2.76 (0.52) d 2.56 (0.46) ab 3.78 (0.79) T35 T39 a a 4.91 (0.99) 4.23 (0.90) bc b 3.30 (0.59) 2.95 (0.54) e d 1.41 (0.23) 1.66 (0.26) ab ab 3.91 (0.79) 3.51 (0.74) cd ab 2.8 (0.49) 3.55 ( 0.70) de c 1.98 (0.41) 2.48 (0.42) bc ab 3.58 (0.73) 3.68 (0.76) T40 a 4.80 (0.99) b 3.76 (0.75) d 1.33 (0.20) b 3.63 (0.70) b 3.51 (0.67) c 2.33 (0.42) b 3.55 (0.76) -1 *Reference strain. Means followed by different letters in each column are significantly different by Tukey test at (О± 0.05). Values in parenthesis indicate growth rate (mm day ). Table 4. Effect of J. curcas oil on percentage conidial germination of isolates of Fusarium spp. Treatment Isolate Fog* T9 T11 T12 T20 T24 T30 T32 T34 T35 T39 T40 В® PDA Tween 20 97.92 В± 3.77 98.44 В± 1.66 97.55 В± 3.95 99.55 В± 0.88 99.55 В± 0.88 99.77 В± 0.66 97.55 В± 3.97 99.55 В± 0.88 99.77 В± 0.66 100.0 В± 0.00 99.22 В± 1.16 99.77 В± 0.66 97.56 В± 5.20 68.44 В± 14.27 95.55 В± 3.12 44.44 В± 22.70 93.96 В± 6.04 86.00 В± 12.84 92.22 В± 7.03 44.44 В± 22.70 97.77 В± 2.10 98.44 В± 2.51 92.06 В± 7.67 98.20 В± 2.18 В® Captan 96.26 В± 5.15 65.35 В± 28.05 83.33 В± 17.37 83.33 В± 35.35 41.95 В± 15.71 33.79 В± 21.46 92.07 В± 4.77 83.33 В± 35.35 91.66 В± 17.67 100.00 В± 0.00 99.77 В± 0.66 89.94 В± 12.53 Petroleum ether 96.05 В± 4.68 36.44 В± 25.43 97.11 В± 2.84 97.17 В± 5.65 42.15 В± 10.42 34.25 В± 11.09 90.00 В± 7.28 97.17 В± 5.65 91.31 В± 8.52 100.00 В± 0.00 96.92 В± 4.89 98.97 В± 2.06 J. curcas oil (mg ml-1) 2.5 5 10 61.34 В± 18.52 90.06 В± 14.62 39.87 В± 20.86 14.40 В± 9.45 44.64 В± 30.46 14.43 В± 11.44 96.00 В± 3.00 96.24 В± 4.69 98.22 В± 2.90 44.44 В± 22.75 90.74 В± 18.84 97.77 В± 6.66 91.55 В± 7.46 52.41 В± 19.90 98.66 В± 1.73 12.62 В± 15.46 17.28 В± 6.03 82.66 В± 30.53 89.33 В± 5.19 91.85 В± 7.78 55.37 В± 26.10 44.44 В± 22.75 90.74 В± 18.84 97.77 В± 6.66 89.13 В± 7.54 64.53 В± 33.37 89.58 В± 6.40 98.22 В± 3.93 97.22 В± 4.39 91.15 В± 11.99 96.33 В± 4.03 60.81 В± 15.04 94.41 В± 5.29 91.00 В± 16.78 70.17 В± 20.16 90.54 В± 12.54 *Reference strain. Means and SD. content for each solvent, obtained in this study, could be because the two solvents have a different boiling point (68.85 for hexane and 60В°C for petroleum ether) and because the phorbol esters in the oil are thermolabile, which means that by applying a higher temperature to obtain the oil with the solvents used, the phorbol esters are degraded. The greatest effect on mycelial growth for the isolates evaluated was with the J. curcas oil treatment at the concentration of 5 mg ml-1. Growth -1 rates between 0.140 and 0.462 mm day were obtained, when compared with 0.820 to 1.018 mm day-1 for the PDA control. Some authors reported that the effect on the mycelial growth of the compounds present in the essential oils may be due to 732 Afr. J. Microbiol. Res. two factors: the first involves inhibition of extracellular enzyme synthesis, and the second the alteration of the cell wall structure (Tripathi et al., 2009). Siva et al. (2008) evaluated the antifungal effect of aqueous, acetone and ethanol extracts of 20 medicinal plants against F. oxysporum f. sp. melongenae. J. curcas was one of the plants evaluated and showed inhibition percentages of 100% for all extracts used. Donlaporn and Suntornsuk (2010) evaluated the antifungal activity of ethanol extracts of J. curcas seeds and the importance of phorbol esters present in the extracts on F. oxysporum, F. semitectum, Colletotrichum capsici, C. gloeosporioides, Pythium aphanidermatum, Lasiodiplodia theobromae and Curvularia lunata, using concentrations of 0 to 10,000 mg -1 -1 L . Concentrations from 6,000 mg L showed 100% inhibition of mycelial growth for all tested pathogens. These authors are the first to report that phorbol esters are responsible for the fungicidal activity of the extracts, as they note that by removing these compounds from the extracts there were no significant differences as compared to the control. As for the germination of conidia, the three concentrations used in this study were effective for only two isolates (T9 and T24) with germination between 12.62 and 17.28%. Ogbebor and Adekunle (2008) assessed the germination of Drechslera heveae conidia on PDA with J. curcas extracts, attaining a 20% germination rate with the 100% concentration. The three species identified showed symptoms of the disease in the plant, such as leaf yellowing, epinasty and some-times late flowering in the field. It is suggested that in different parts of Morelos, corm rot in gladiolus is caused by three fungal species, which showed morphological, molecular and pathogenic differences, plus different sensitivity to J. curcas oil. All three species were capable of causing the disease. The results of this research demonstrate the antifungal potential of J. curcas oil to control fungi that cause diseases in ornamental plants. ACKNOWLEDGEMENTS This work was funded by the Secretary of Postgraduate and Research (Projects 20090234 and 20100783) and by the Commissions of Operation and Support to Academic Activities from the National Polytechnic Institute. REFERENCES Abd-Elsalam AK, Aly IN, Abdel-Satar MA, Khalil MS, Verreet JA (2003) PCR identification of Fusarium genus based on nuclear ribosomalDNA sequence data. Afr. J. Biotechnol. 2:82-85. Aiyelaagbe OO, Adeniyi BA, Fatunsin OF, Arimah BD (2007) In Vitro antimicrobial activity and phytochemical analisis of Jatropha curcas roots. Int. J. Pharmacol. 3:106-110. Alves-Santos FM, Benito EP, Elsava AP, DГaz-MГnguez JM. (1999) Genetic diversity of Fusarium oxysporum strains from common bean fields in Spain. Appl. Environ. Microbiol. 65:3335-3340. Baayen RP (2000). Diagnosis and detection of host-specific forms of Fusarium oxysporum. EPPO Bull. 30:489-491. Barrera-Necha L, GarcГa-Barrera L (2008) Antifungal activity of essential oils and their compounds on growth of Fusarium sp. isolated from papaya (Carica papaya). Rev. UDO Agric. 8:33-41. Barrera-Necha L, GarduГ±o-PizaГ±a C, GarcГa-Barrera LJ (2009) In vitro antifungal activity of essential oils and their compounds on mycelia growth of Fusarium oxysporum f.sp. gladioli (Massey) Snyder and Hansen. Plant Pathol. J. 8:17-21. Booth C (1985) The genus Fusarium. Ed. Commonweath Mycological Institute. p. 237. Donlaporn S, Suntornsuk W (2010) Antifungal Activities of Ethanolic Extract from Jatropha curcas Seed Cake. J. Microbiol. Biotechnol. 20:319-324. Doyle JJ, Doyle JL (1990). A rapid total DNA preparation procedure for fresh plant tissue. Focus 12:13-15. Flores-Olivas A, MartГnez-Soriano JP, MartГnez-Espinoza AD (1997) Use of technology new in detection and genetic analysis of phytopathogens. Phytopathology 32:96-111. GarduГ±o-PizaГ±a C, Barrera-Necha LL, RГos-GГіmez MY (2010). Evaluation of the fungicidal activity of leaves powders and extracts of fifteen Mexican plants against Fusarium oxysporum f. sp. gladioli (Massey) Snyder & Hansen. Plant Pathol. J. 9:79-87. GonzГЎlez-PГ©rez E, YaГ±ez-Morales MJ, Ortega-Escobar H, VelГЎzquezMendoza J (2009) Comparative Analysis among Pathogenic Fungal Species that Cause Gladiolus (Gladiolus grandiflorus Hort.) Corm Rot in Mexico. Mex. J. Phytopathol. 27:45-52. Haan LAM, Numansen A, Roebroeck EJA, van Doorn J. (2000) PCR detection of Fusarium oxysporum f.sp. gladioli race 1, causal agent of Gladiolus yellows disease, from infected corms. Plant Pathol. 49:89100. Katan T, Di Primo P (1999). Current status of vegetative compatibility groups in Fusarium oxysporum: Supplement (1999). Phytoparasitica 27:1-5. Leslie J, Summerell BA (2006). The Fusarium laboratory manual. Ed. Blackwell publishing. p. 388. MartГnez-Herrera J (2006) Genetic and nutritional diversity of piГ±Гіn (Jatropha curcas L.) in MГ©xico. PhD dissertation, Instituto PolitГ©cnico Nacional, MГ©xico. MartГnez-Herrera J, MartГnez-Ayala AL, Makkar H, Francis H, Becker K (2010) Agroclimatic conditions, Chemical and Nutritional Characterization of Differents provenances of Jatropha curcas L. from Mexico. Eur. J. Sci. Res. 39:396-407. Mendoza-Zamora C (1997). CertificaciГіn de estudios de efectividad biolГіgica de plaguicidas. Ed. Cecilio Mendoza Zamora-Universidad AutonГіma de Chapingo. Texcoco, Mexico. 279 p. Montiel-GonzГЎlez L, GonzГЎlez-Flores F, SГЎnchez-GarcГa BM, GuzmГЎnRivera S, GГЎmez-VГЎzquez FP, Acosta-Gallegos JA, RodrГguezGuerra R, Simpson-Williamson J, Cabral-Enciso M, Mendoza-Elos M. (2005). Species of Fusarium occurring on bean (Phaseolus vulgaris L.) roots affected with rots in five states of Central MГ©xico. Mex. J. Phytopathol. 23:1-7. Moreno-VelГЎzquez M, YГЎГ±ez-Morales MJ, Rojas-MartГnez RI, ZavaletaMejГa E, Trinidad-Santos A, Arellano-Vazquez JL (2005). Diversity of fungi of amaranthus (Amaranthus hypochondriacus L.) seed and their molecular characterization. Mex. J. Phytopathol. 23:111-118. Nelson P E, Toussoun T A, Marasas WFO (1983) Fusarium species: an illustration manual for identification. University Park, Pennsylvania State University Press, Pensylvania, USA. p. 193. Ogbebor ON, Adekunle AT (2008). Inhibition of Drechslera heveae (Petch) M. B. Ellis, causal organism of Bird’s eye spot disease of rubber (Hevea brasiliensis Muell Arg.) using plant extracts. Afr. J. Gen. Agric. 4:19-26. Ortoneda M, Guarro J, Madrid M, Caracuel Z, Roncero MI, Mayayo E, Di Pietro A. (2003). Fusarium oxysporum as a Multihost Model for the Genetic Dissection of Fungal Virulence in Plants and Mammals. Infect. Immun. 72:1760–1766. Pauli A, Knobloch K (1987) Inhibitory effects of essential oil components on growth of food-contamining fungi. Z. Leb.-Unt. und-For. 185:1013. Pintore G, Chessa M, Boatto GP, Cerri G, Usai M, Trillini B (2002) Essential oil Hypericum perforatum L. var. angustifolium DC growing wild in Sardinia (Italy). J. Essential Oil Res. 17:533-535. Rahman M, Ahmad SH, Mohamed MTM, Rahman MZA (2011). Extraction of Jatropha curcas fruits for antifungal activity against anthracnose (Colletotrichum gloeosporioides) of papaya. Afr. J. Biotechnol. 10:9796-9799. Albores et al. SAGARPA (2006). Manual TГ©cnico fitosanitario del cultivo de gladiolo. Ed. ComitГ© Estatal de Sanidad Vegetal del Estado de Morelos. p. 13. Siva N, Ganesan S, Banumathy N, Muthuchelia (2008). Antifungal Effect of Leaf Extract of Some Medicinal Plants Against Fusarium oxysporum Causing Wilt Disease of Solanum melogena L. Ethnobot. Leaflets 12:156-163. Srivastava S, Kumar R, Sinha A. (2012). Antifungal Activity of Oil Against Some Seed-borne Fungi. Plant Pathol. J. 11:120-123. Teixeira M, Figueira G, Sartoratto A, Garcia V, Delarmelina C (2005). Anti-Candida activity of Brazilian medicinal plants. J. Ethnopharmacol. 97:305-311 Tripathi A, Sharma N, Sharma V (2009). In vitro efficacy of Hyptis suaveolens L. (Poit.) essential oil on growth and morphogenesis of Fusarium oxysporum f.sp. gladioli (Massey) Snyder & Hansen. World J. Microbiol. Biotechnol. 25:503-512. 733 White TJ, Bruns T, Lee S, Taylor J (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Chapter 38. PCR protocols: A guide to methods and applications. Ed. Academic Press Inc, pp. 315-323. Wink M, Koshmieder C, Saverwein M, Sporer F (1997). Phorbol esters of Jatropha curcas. In G.M. GГјbitz, M. Mittelbach, & M. Trabi (Eds.), Biofuels and Industrial products from Jatropha curcas Austria, DbvVerlag Univ. pp.160-166. Zhang Z, Schwartz S, Wagner L, Miller W (2000) A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 7:203-14. Vol. 8(8), pp. 734-742, 19 February, 2014 DOI: 10.5897/AJMR2013.5940 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper Screening phosphate solubilizing actinobacteria isolated from the rhizosphere of wild plants from the Eastern Cordillera of the Colombian Andes Luis Daniel Prada Salcedo1*, Carolina Prieto2 and Marcela Franco Correa3 1 Luis Daniel Prada Salcedo: Unidad de investigaciones agropecuarias. Facultad de Ciencias. Pontificia Universidad Javeriana, Department of Microbiology Carrera 7ВЄ 43-82 Edificio FГ©lix Restrepo, S. J. 3В° Piso BogotГЎ - Colombia. 2 Centro de investigaciГіn de la caГ±a de azucar, CenicaГ±a. Cali - Colombia. 3 Marcela Franco Correa: Grupo de BiotecnologГa ambiental e industrial. Facultad de Ciencias. Pontificia Universidad Javeriana, Department of Microbiology Carrera 7ВЄ 43-82 Edificio FГ©lix Restrepo, S. J. 3В° Piso BogotГЎ - Colombia. Accepted 20 January, 2014 Colombia is a tropical country with high diversity and an agricultural economy, yet their soils are characterized by low pHs and poor phosphorus concentrations. Soil supplementation with chemical fertilizers containing soluble phosphorus is a costly and contaminating practice and for this reason, the aim of this study was to isolate actinobacteria that are able to release soluble phosphate from wild plants of the Eastern Cordillera of Colombia and select strains with high phosphorus solubilizing activity. To screen the isolates of actinobacteria, we used two qualitative assays to determine the efficiency of solubilization by measuring the halo of hydrolysis in a Pikovskaya’s agar plate (PVK). A second assay was performed on broth with National Botanical Research Institute's phosphate growth (NBRIP) medium containing bromophenol blue (BPB). Finally, the released soluble phosphate by actinobacteria was quantified using insoluble Ca3(PO4)2 or AlPO4 as sole sources of P. Only five of the tested strains were the best solubilizing strains in the two qualitative assays. The strains T1C, T1H, T3A, T3C, P3E, F1A, F2A and V2B solubilized significantly more phosphorus than the other strains, which was shown for the quantitative assay. Strains T1C, T3A, T3C and F1A are candidates for future studies and to evaluate other plant growth promoting activities. Key words: Screening, phosphate solubilizing, actinobacteria, Colombia. INTRODUCTION Colombia is one of the five countries in the world with the largest diversity of genes, species, and ecosystems. The Colombian Andes are located in one of the world biodiversity hotspots and the savannahs of the Llanos are listed as one of the world eco-regions with rare, rich and biologically important habitats (Myers et al., 2000; Herzog et al., 2011). Soils within these areas are characterized by low pHs and low phosphorus concentrations (Rao et al., 2004; Fassbender and Bornemisza, 1994; Malagon et al., 2003). Soil phosphorus dynamics is characterized by physicochemical (sorption-desorption) and biological (immobilization-mineralization) processes. Phosphate anions can be immobilized by precipitation with cations such as Ca2+, Mg2+, Fe3+ and Al3+ providing a high phosphorus fixation capacity to soils (Oliveira et al., 2009; Khan et al., 2009). In Colombia’s agricultural tradition, to prepare soils by adding manure, chemical fertilizers or organic amendments, any of them is supplemented with phosphate in order to compensate the phosphorus deficiency is a common practice (LeГіn, 1991; Guimaraeset *Corresponding author. E-mail: [email protected]. Tel: 5701 3208320 ext: 4150 – 4069. Fax: 3208320 ext. 4047. Salcedo et al. 735 et al., 2001). Soil supplementation with chemical fertilizers containing soluble phosphorus is thus a costly and conta-minating practice, not only because of their way of use but because of the highly polluting mode in which they are industrially produced, requiring the use of sulphuric acid at high temperatures. Furthermore, wrong fertilizer applications can cause problems of eutrophication and erosion (Whitelaw, 2000; Vassilev et al., 2006). Many studies have been done on phosphate solubilizing micro-organisms (PSM) as an alternative in the prevention of environmental and agricultural issues mentioned above (Rodriguez and Fraga, 1999; Krishnaraj and Goldstein, 2001; Kumar et al,. 2010; Bhattacharyya and Jha, 2012). There are reports on studies with microorganisms capable of solubilizing phosphate, especially bacteria and some fungi, which have experimentally demonstrated their capacity to improve phosphorus availability to plants in laboratory, greenhouse and field experiments (Rudresh et al., 2005; Deubel et al., 2005; Pandey et al., 2008; Hamdali et al., 2012). To a lesser extent, actinobacteria have been reported as microorganisms with the capacity to release phosphorus into the soil (Mba, 1994, 1997; Hamdali et al., 2008, El-Tarabily et al., 2006). Actinobacteria have special interest because these filamentous sporulating bacteria are able to thrive in extremely different soils, play important ecological roles in soil nutrient cycling and are recently being regarded as plant growth promoting rhizobacteria (Jiang et al., 2005; Pathom-Aree et al., 2006; Franco-Correa et al., 2010). The selection of PSM is carried out by rapid qualitative methods. The most common method is to determine the efficiency of solubilization by measuring the halo of hydrolysis in a Pikovskaya’s agar plate (1948), but results are not always consistent and in some cases this method is insufficient to detect all the PSM (Nautiyal 1999; Mehta and Nautiyal, 2001; Rashid et al., 2004). Mehta and Nautiyal (2001) developed a system that includes a broth - the National Botanical Research Institute's phosphate growth medium (NBRIP) medium and a qualitative assay in liquid medium, which is more accurate and reliable in the selection of PSM and therefore makes the screening process more quick, efficient and with low cost (Khan et al., 2009). The aim of this study was to isolate actinobacteria able to release soluble phosphate from wild plants of the Eastern Cordillera of Colombia and to select strains with high phosphorus solubilizing activity with the purpose of suggesting those microorganisms as potential biofertilizers and hence help to use less chemical fertilizers in agricultural practices. (Figure 1). These habitats included the rhizospheres of wild plants growing in natural protected areas and forests; samples were taken from forest species associated with Vallea, Weinmannia, Vaccinium, Drimys, Rosmarinus, plus samples from legumes grasses (Rye Grass or Bromus) and clovers (Trifolium repens and Trifoliumpratense). Soil pH, total P, available P, and organic matter were characterized (Table 1). The samples were taken at a depth of 15-30 cm and were placed in polyethylene bags, closed tightly and stored in a refrigerator at 4В°C. Actinobacteria were isolated by dilution plate method using oat-meal agar. These media were supplemented with nistatin (0.1 % V/V). Plates were incubated at 26В°C, and monitored daily. Subcultures led to purified bacterial colonies that’s howed an actinobacteria-like appearance. Gram staining indicated that they were Gram positive mycelia sporulating bacteria. A classical approximation was used for the characterization like aerial mass colour, reverse side pigments, melanoid pigments, soluble pigments. We did determination of micro morpho-logical characteristics of the spore-bearing hyphae, the number of spores at the end of mature hyphae and the spore chain Morphology. The strains were stored in 20% sterile glycerol at -20В°C. MATERIALS AND METHODS Statistical analysis Soil samples and isolation of Actinobacteria All of the experiments were performed with four replicates. The data were analyzed with a One Way Analysis of Variance (ANOVA) and a Duncan’s multiple range test to determine any significant differences between groups at p < 0.05. All the statistical analyses were performed using the SPSS 11.0 for WindowsВ® software. Soil samples were collected from various localities from the Eastern Cordillera between 2010 and 2011. Diverse habitats at different altitudes were selected for the isolation of actinobacteria strains Screening of phosphate-solubilizing actinobacteria The solid plate assay was done to measure the halo zone formed surrounding the bacteria after being inoculated on agar and incubated for 72 h at 26В°C on PVK growth medium containing 5 g of tricalcium phosphate as sole phosphorus source and pH 7.2 (Pikovskaya 1948). Halo-forming colonies were recorded as positive. The solubilization index was calculated as the ratio between the total diameter (colony + halo) and the colony diameter (Kumar and Narula, 1999). A second assay was performed on broth with NBRIP medium containing BPB following the protocol of Mehta and Nautiyal (2001). In brief, 5 ml of NBRIP-BPB medium in a 30-ml test tube was inoculated with the actinobacterial strain (50 ml inoculum with approximately 3 X 107cfu/ml), and the isolates were grown for 4 days at 26В°C with continuous agitation at 120 rpm. At the end of the incubation period, the final OD-600 values were subtracted from the initial values. The medium pH was measured by immersing a glass electrode into the culture broth. Release soluble phosphate Solubilization of P by Actinobacteria was quantified using insoluble 5 g/L of Ca3(PO4)2 or 1 g/L of AlPO4 as sole sources of P in the NBRIP broth medium. In each autoclaved flask, 2 ml of bacterial suspension (approximately 3 X 107cfu/ml) were transferred to 100 ml Erlenmeyer flask containing 20 ml of NBRIP broth medium. The actinobacteria cultures were placed on a rotary shaker at 120 rpm for 4 days and pH was measured after incubation with a pH meter. Suspensions were centrifuged to remove bacterial cells and other insoluble materials. The resulting supernatants were passed through a 0.45 Ојm filter and the inorganic phosphate content of the culture filtrate was determined by the molybdenum blue method (Murphy and Riley, 1962). The available phosphorous was determined using a spectrophotometer at 880 nm and calibrated with a standard KH2 PO4 curve. 736 Afr. J. Microbiol. Res. Figure 1. Map of Colombia with coordinates, altitude, humidity and temperature of the localities sampled. Table 1. Characteristics of the soil from the different regions in Colombia. Region Tota* Paipa* Mani* Fusagasuga* La vega* Villleta* Andina Caribe Pacific Orinoquia Amazonica Soil pH 5.06 В± 0.3 5.52 В± 1.0 4.8 В± 0.5 5.1 В± 1.4 4.06 В± 0.6 5.9 В± 1.6 5.5 В± 0.2 6 В± 1.1 4.5 В± 2.1 7 В± 2.4 5 В± 0.8 Total P (mg/kg) 360 В± 283.6 614 В± 311.1 407.2 В± 408.6 2830.6 В± 1554.0 1504.4 В± 417.7 949.25 В± 880.8 922 В± 1143 1343 В± 1143 315 В± 456 541 В± 626 815 В± 717 Available P (mg/kg) 118.4 В± 126.5 8 В± 2.6 17.04 В± 31.3 55.52 В± 56.8 86.52 В± 171.4 8.725 В± 7.6 83 В± 83 101 В± 123 37 В± 28 116 В± 84 43 В± 86 Organic matter % 13 В± 16.9 5.96 В± 5.3 2.2 В± 1.3 13.52 В± 13.5 4.6 В± 0.6 2.95 В± 1.7 8 В± 3.2 9 В± 1.8 8.5 В± 5.5 2.8 В± 4.5 3 В± 4.6 *Data of this work. 30 soil cores from random location. Values are Average В±standard deviation. RESULTS Soil samples and isolation of Actinobacteria We isolated 57 strains of actinobacteria from six different sampling areas from October 2010 to July 2011. Soil characterization showed pH ranges from 4.0 to 5.9, total P from 360 to 2830 mg/kg, available P from 8.7 to 118.4 mg/kg, and organic matter from 2.95 to 13.52% (Table 1). Figure 2 shows a greater abundance of actinobacteria in localities at the highest elevations: 56% of the isolates belong to Tota and Paipa, 40% to the towns of Fusagasuga, La Vega and Villeta; and the remaining 4% of the isolates were from Mani, a locality at a lower elevation that is located on tropical plains. The use of oatmeal agar allowed the recovery of large numbers of actinobacteria that showed growth and sporulation results after 7 days of culture. Preliminary morphological characterization of the isolates showed typical structures, like aerial and substrate mycelium, conidia chains, some Salcedo et al. 737 Figure 2. Efficiency of solubilization of the isolates. A clear zone around a growing colony indicate phosphate solubilization and was measured as phosphate solubilazation index. mycelium with coccoid elements, and spore chain morphologies namely Rectiflexibiles, Retinaculiaperti and Spirales. In addition, other characteristics as melanoid pigments, reverse side pigments and soluble pigments were observed. Macroscopically, all have a dry appearance granular, powdery or velvety, characteristic of the actinobacteria. Additionally, there were several colors: white (T1B, T3B, P2R, L4C and M2A), heavy or light gray (T3A, T3C, T3D, L3A, P3E, F2A), beige (F1A, F2C), blue-green (V1B) and pink (V2B and V1E), and diffusible pigment production (F1A, F2C). Finally, we recognized the smell of wet soil, representative characteristic of this group of microorganisms for the production of geosmina. Some genera of actinobacteria were identified as Streptomyces, Nocardia and Actinomadura, among unidentified isolates. obtained with the test, the pH present in the culture medium was low for the majority of the strains selected. The best solubilizing strains with low pH are from the town of Tota, which was the sampling zone with highest elevation and lowest temperature in addition to a relatively low moisture percentage. In this area, a large number of actinobacteria were isolated from five samples collected in the surroundings of the lake, near an area known as Playa Blanca where the few remnants of wild forests are influenced by agriculture and tourism. The town Fusagasuga has strains with high activity but not a decrease in pH; this locality has a lower humidity and higher temperatures. Release soluble phosphate Screening of phosphate-solubilizing actinobacteria Figures 2 and 3 show which isolates belong to strains with the best phosphorus solubilizing capacity as well as two control strains deposited at the Pontificia Universidad Javeriana: Streptomyces sp. MCR26 labelled as negative control and Streptomyces sp. MCR24 as positive control. These control strains were characterized as Plant growthpromoting rhizobacteria (PGPR) (Franco-Correa et al., 2010). The plate assay revealed that strains with the highest values of phosphorus solubilization are F2A, F1A, F1B, F1C, F4C, T3F, T1A, T1D, and T3A. These strains have the same activity as that of the control strain Streptomyces sp. MCR24. On the other hand, the liquid evaluation exhibited that isolates with higher solubilizing capacity are those that produce changes greater than 1.5 optical density units at 600 nm, which were F1A, F1B, F1C, F2D, F4B, F4D, M2A, M4B, T1B, T1C, T1D, T1G, T1H, T3A, T3B and T3C. In addition to the activity results The results of the two qualitative assessments are not totally consistent. Seven of the tested strains F1A, F1B, F1C, F4C, T1A, T1D and T3A were the best solubilizing strains in both the solid and liquid evaluation media. We made a quantitative assessment to find which of the strains has the highest solubilizing capacity and which of the two methods is more reliable. Figure 4 shows that the strains T1C, T1H, T3A, T3C,P3E, F1A, F2A and V2B are as good as Streptomyces sp. MCR24 for Ca3(PO4)2 and that these strains solubilized significantly more phosphorus than the other strains. Strains T1H, T1C, T3A, T3C and F1A are present only in the selection obtained with the methodology reported by Mehta and Nautiyal (2001) suggesting that this test can choose more strains with true solubilizing ability and for this reason, it is more reliable. These strains also lowered pH at around 4 or less with exception of F1A. This result is supported by the change in coloration in the medium caused by the presence of BPB pH indicator,which turns from purple to Afr. J. Microbiol. Res. 3.0 6.5 2.5 6.0 2.0 5.5 1.5 5.0 1.0 4.5 0.5 4.0 0.0 3.5 pH of activity in the medium Optical density shift at 600 nm+/- standard deviation 738 Figure 3. Change in optical density at 600 nm. The dotted line indicates the cut-off for the selection of microorganisms with high tricalcium phosphate solubilizing capacity. 500.00 2 Ca3(PO4) 600.00 400.00 300.00 200.00 100.00 0.00 0.00 5.00 10.00 15.00 20.00 25.00 ALPO4 Figure 4. Released soluble phosphate. Activity with Ca3(PO4)2 5gВ·L-1 source is shown in Y and activity with AlPO4 1gВ·L-1 source is shown in X. Salcedo et al. green, a fact related to the secretion of organic acids by actinobacteria. No tests were made with aluminum phosphate because Mehta and Nautiyal (2001) evaluation methodology was designed for tricalcium phosphate. We observed that only in the quantitative assessment strains T1J and T3A can solubilize phosphorus significantly from AlPO4. In addition, the control strain Streptomyces sp. MRC24 had a very low activity with this source of phosphorus. DISCUSSION Soil samples and isolation of Actinobacteria The abundance of the isolates in the locality of Tota can be explained by the environmental conditions of this area, such as an average temperature of 18В°C, sandy soils with low water content, and pH of 5.0 to 7.2; characteristics that facilitate growth and colonization of actinobacteria. On the other hand, the towns of Mani and La Vega have clay soils with low organic matter content, low oxygen tension and pH below 5.0 (Table 1). These soil characteristics can decrease the abundance of actinobacteria (Goodfellow and Williams, 1983; Alexander 1977; El-Tarabily and Sivasithamparam, 2006). Actinobacteria occurs in a wide range of environments, but soil is the most common ecological niche because the role of these microorganisms is to recycles oil nutrients. Isolates reflect abundant numbers and variety of morphologies in each of the localities sampled, but due to the isolation methodology used, the predominant genus was Streptomyces spp. (Xu et al., 1996; Ghodhbane-Gtari et al., 2010). Actinobacteria isolates show that fertile soils with high concentrations of nitrogen and carbon are not always necessary to isolate these microorganisms. Although growth of these microorganisms is optimum with pH close to neutrality; our findings show that they can be isolated from sandy soils with low pH and high aluminum concentrations; results that are consistent with those of Shirokikh et al. (2002) and Norovsuren et al. (2007). Screening of phosphate-solubilizing actinobacteria In order to perform the screening for an adequate selection of phosphorus solubilizing actinobacteria from Colombian native soils, the isolates were subjected to the traditional test used by PVK and the test reported by Mehta and Nautiyal (2001). Although both qualitative tests use different measurement units, there is a slight correlation pattern between them. Figure 2 shows high bars for the locality of Tota and locality of Fusagasuga, respectively. These results are similar to those in Figure 3, where the highest strain bars belong to the same localities with the greatest activity strains shown in Figure 2. The two methodologies are used, but the assay by Mehta and Nautiyal (2001) is currently more reported, because it reveals strains with good phosphorus-solubilizing capacity which is not detected in the plate assay 739 (Leyval and Barthelin, 1989; Louw and Webley, 1959; Gupta et al., 1994; Mehta and Nautiyal, 2001; Liu et al., 2011). In our work, the advantage of the liquid assay methodology was observed with strains Tota, Fusagasuga, La Vega and Villeta, which showed a major shift in the NBRIP-BPB broth decolorization and a high release of soluble phosphorus in the quantitative assessment. Figures 2, 3 and 4 show these strains are not equally distributed in all the six sampled localities; on the contrary, they are found mostly in the locality of Tota. This locality is a lake of 56.2 km2 surrounded by crop fields of onions, potatoes, beans, peas and carrots, and a few small high Andean forests. The constantly chemically fertilized crops are affecting forests and causing eutrophication in water bodies. The soil analysis of the Tota locality showed a 13% of organic matter, a cation-exchange capacity of 6 cmol/kg, a pH around 5 or less, and a total phosphorus concentration of 360 mg/kg with only 118 mg/kg available phosphorus. These results suggest that only 33% of phosphorus applied to the soil may be taken up by plants, on the other hand the remaining 67% is not used and can cause environmental problems. The latter phosphorus parameters reveal excessive chemical fertilization. Probably, excess phosphorus is adsorbed or precipitated and organic matter is removed as the crop itself, so microorganisms are forced to use mainly inorganic forms of phosphorus. Release soluble phosphate Perez et al. (2007) propose that isolates causing a shift of > 1.5 units be selected for further studies. In order to confirm the usefulness of this cut-off point proposed by Perez et al. (2007) and therefore to select the best strains, we implemented the quantitative assay measuring the release of soluble phosphorus in the NBRIP broth (Baig et al., 2010). Figure 4 shows that strains T1C, T1H, T3C, P3E, and V2B have a significantly higher activity to other isolates, a result that was not observed in the plate assay possibly because one or more acids involved in the process did not diffuse into the agar so that there was no presence of a solubilization halo. The evaluation in NBRIP-BPB broth revealed that isolates decolorizing the broth more than 1.5 units were also more efficient in the quantitative assay. Also, the assay by Mehta and Nautiyal (2001) contribute to reduce costs and efforts in the search of microorganisms with biofertilizing potential. Studies based on physiology of actinobacteria in Colombia are scarce, especially those focused on agriculture (JoaquГn et al., 2006; Cardona et al., 2009; Franco-Correa et al., 2010); in addition, there has been little research on biofertilizer-based clean technologies as a valuable input for agricultural development (Burbano and Silva, 2010). Developing native biofertilizers contributes to the management of tropical soils with high absorption and fixation of phosphorus due to their high cation concentrations, usually low pH and clay texture, characteristics that have traditionally been amended with an increased use of che- 740 Afr. J. Microbiol. Res. mical fertilizers resulting in a negative impact on ecosystems. Strains T1C, T1H, T3A, T3C, P3E, F1A, F2A and V2B have phosphorus solubilizing capacities between 396 and 520 Ојg/ml with tricalcium phosphate; these results are good when compared with other bacteria from similar soils reported as phosphorus solubilizers,s uch as Bacillus spp., and Azotobacter spp (Narula et al., 2000; Chatli et al., 2008; Saharan and Nehra, 2011). Using similar soil isolates, Perez and co-workers reported an activity with tricalcium phosphate as high as 97 Ојg/ml by Burkholderia and with iron phosphate of 42 Ојg/ml by Serratia. Regarding actinobacteria, El-Tarabily (2008) reported that Micromonospora has an activity of 218 Ојg/ml with phosphate rock and Gupta (2010) reported that Streptomyces has an activity of 46 Ојg/ml with tricalcium phosphate. The values obtained are similar to the results of Chen et al. (2006) that evaluated this activity in actinobacteria belonging to the genera Rhodococcus sp. and Arthrobacter sp. which had 186 and 519 activities Ојg/ml, respectively. Those activities reported show that our isolates have a great potential and an acceptable activity. Differences in the reported values by other authors may be due to the measurement techniques employed or to the source of phosphorus evaluated. Occasionally, the measurements with rock phosphate may overestimate the values of in vitro solubilization because this source of phosphorus is composed of several insoluble as well as soluble forms of phosphorus (Zapata and Roy, 2007). One of the most valuable achievements of our research is having isolated an actinobacteria with the ability to solubilize both tricalcium phosphate and aluminum phosphate; the latter is a source difficult to solubilize because aluminum phosphate is rapidly absorbed in acid soils. Its fixation rate per unit area is twice the rate in neutral or calcareous soils. Aluminum is also the leading cause of phosphorus precipitation in acid soils (Olsen and Watanabe, 1957; Holford, 1983). The source of phosphorus in the AlPO4 test had a concentration of 1 g/L in NBRIP broth because this compound is highly toxic to many microorganisms. The greatest in vitro resistance to aluminum by actinobacteria reported in the scientific literature is of 5 g/L AlPO4 (Sayed et al., 2000); therefore, several authors have been working with lower concentrations (Illmer, 1995; Prijambada et al., 2009). In addition, it is known that AlPO4 toxicity varies by the complexity of the soils and that actinobacteria have good resistance to aluminum thus their soil colonization is facilitated in presence of this element (Shirokikh et al., 2002; Rueda et al., 2009). Strains with improved phos-phorus solubilizing activity lowered the pH probably due to the production of organic acids, which is one of the phosphorus releasing mechanisms reported in scientific literature (Khan et al., 2009; Saharan and Nehra 2011). Soils with these characteristics predominate in the Colombian tropics, hence strain T3A is important because it can release phosphorus from different sources. All the facts mentioned above, render these strains good candidates for the production of new bio-fertilizers with the ability of colonizing crop rhizospheres in tropical soils. Strains T1C, T3A, T3C and F1A are candidates for future studies. These strains have similar activity to the positive control strain Streptomyces sp. MCR24, which was previously characterized by Franco-Correa et al. (2010) who reported a broad variety PGPR activities besides phosphorus solubilizing capacity. Prior studies have reported that strain swith good phosphorus solubilizing capacity have also a variety of mechanisms to promote plant growth like the strain Streptomyces sp. MCR24. For this reason, further studies with these strains designed to evaluate other plant growth promoting activeties, like nitrogen fixation, degradation of complex carbohydrates, synergistic activities, antagonisms and production of plant growth promoting hormones, can make an important contribution to agriculture. ACKNOWLEDGEMENTS This study was partially supported by the Internal Financial (Vicerrectoria Academica - Pontificia Universidad Javeriana - Colombia). The authors would like to thank the Dra. Sandra Constantino Chuaire for her contribution on the translation of this paper. REFERENCES Alexander M (1977). Introduction to soil Microbiology.2nd edn. John wiley and sons. ISBN0-85226-013X. New York Baig KA, M, Zahir ZA, Cheema MA (2010).Comparative efficacy of qualitative and quantitative methods for rock phosphate solubilization with phosphate solubilizing rhizobacteria. Soil Environ. 29:82-86. Baig KS, Arshad M, Zahir ZA, Cheema MA (2010). Comparative efficacy of qualitative and quantitative methods for rock phosphate solubilization with phosphate solubilizing rhizobacteria. Soil Environ. 29(1):82-86. Bhattacharyya PN, Jha DK (2012). Plant growth-promoting rhizobacteria (PGPR): emergence in agriculture. World J. Microbiol. Biotechnol. 28:1327-1350. Burbano H, Silva F (2010). Ciencia del suelo: principios bГЎsicos. Sociedad Colombiana de la Ciencia del suelo., BogotГЎ, D.C., Colombia. 594. Cardona G, PeГ±a. Cardona G, Venegas CP, Ruiz-Garcia M (2009). Comunidades de hongos actinomicetos en tres tipos de vegetaciГіn de la Amazonia colombiana: abundancia, morfotipos y el gen 16s ADNr. Rev. Biol. Trop. 57:1119-1139. Chatli A, Beri V, Sidhu B (2008). Isolation and characterisation of phosphate solubilizing microorganisms from the cold desert habitat of Salix alba Linn. in trans Himalayan region of Himachal Pradesh. Indian J. Microbiol. 48:267-273. Chen YP, Rekha PD, Arun AB, Shen FT, Lai WA, Young CC (2006). Phosphate solubilizing bacteria from subtropical soil and their tricalcium phosphate solubilizing abilities. Appl. Soil Ecol. 34:33-41. Deubel A, Merbach W, Varma A, Buscot F (2005). Influence of Microorganisms on Phosphorus Bioavailability in Soils Microorganisms in Soils: Roles in Genesis and Functions. In. Springer Berlin Heidelberg, pp. 177-191. El-Tarabily KA, Nassar AH, Sivasithamparam K (2008).Promotion of growth of bean (Phaseolus vulgaris L.) in a calcareous soil by a phosphate-solubilizing, rhizosphere-competent isolate of Micromonospora endolithica. Appl. Soil Ecol. 39:161-171. El-Tarabily KA, Sivasithamparam K (2006). Non-streptomycete actino- Salcedo et al. mycetes as biocontrol agents of soil-borne fungal plant pathogens and as plant growth promoters.Soil Biol. Biochem. 38:1505-1520. Fassbender H, Bornemisza E (1994). QuГmica de suelos, con Г©nfasis en suelos de AmГ©rica Latina, San JosГ©, Costa Rica. ColecciГіn de libros y materiales educativos/ IICA n 81. 420. Franco-Correa M, Quintana A, Duque C, Suarez C, Rodriguez MX, Barea J-M (2010).Evaluation of actinomycete strains for key traits related with plant growth promotion and mycorrhiza helping activities. Appl. Soil Ecol. 45:209-217. Ghodhbane-Gtari F, Essoussi I, Chattaoui M, Chouaia B, Jaouani A, Daffonchio D, Boudabous A, Gtari M (2010). Isolation and characterization of non-Frankia actinobacteria from root nodules of Alnus glutinosa, Casuarina glauca and Elaeagnus angustifolia. Symbiosis 50:51-57. Goodfellow M, Williams S (1983).Ecology of Actinomycetes. Annu. Rev. Microbiol. 37:189-216. Guimaraes ES, Rao Y, Amezquita MC, Amezquita E (2001). Sistemas agropastoriles en sabanas tropicales de AmГ©rica Latina.CIAT: Cali, Colombia and EMBRAPA: Brasilia, Brasil p. 328. Gupta N, Sahoo D, Basak U (2010). Evaluation of in vitro solubilization potential of phosphate solubilising Streptomyces isolated from phyllosphere of Heritiera fomes (mangrove). Afr. J. Microbiol. Res. 4:136-142. Gupta R, Singal R, Shankar A, Kuhad RC, Saxena RK(1994).A modified plate assay for screening phosphate solubilizing microorganisms. J. Gen. Appl. Microbiol. 40:255-260. Hamdali H, Bouizgarne B, Hafidi M, Lebrihi A, Virolle MJ, Ouhdouch Y (2008). Screening for rock phosphate solubilizing Actinomycetes from Moroccan phosphate mines. Appl. Soil Ecol. 38:12-19. Hamdali H, Moursalou K, Tchangbedji G, Ouhdouch Y, Hafidi M (2012). Isolation and characterization of rock phosphate solubilizing actinobacteria from a Togolese phosphate mine. Afr. J. Biotechnol.11: 312-320. Herzog SK, Martinez R, JГёrgensen PM, Tiesse H (2011). Climate change and biodiversity in the tropical Andes. Inter-American Institute for Global Change Research (IAI) and Scientific Committee on Problems of the Environment (SCOPE), 348 pp. ISBN: 978-8599875-05-6. Holford I (1983). Differences in the efficiency of various soil phosphate tests for white clover between very acidic and more alkaline soils. Austr. J. Soil Res. 21:173-182. Illmer P, Barbato A, Schinner F (1995). Solubilization of hardly-soluble AlPO4 with P solubilizing microorganisms.Soil Biol. Biochem. 27:265270. Jiang Y, Li WJ, Xu P, Tang SK, Xu LH (2005). Study on diversity of Actinomycetes saltand alkaline environments. WeiShengWuXueBae. 46(2):191-195. JoaquГn L, Benavides L, Gladys M, Quintero O, Ostos O (2006). Aislamiento eidentificaciГіn de diez cepas bacterianas desnitrificantes a partir de un suelo agrГcolacontaminado con abonos nitrogenados proveniente de una finca productora decebolla en la Laguna de Tota, BoyacГЎ, Colombia nova - publicaciГіn cientГfica.4(6):50-54. Khan A, Ajgam S, Naqvi SM, Rasheed M (2009). Phosphorus solubilizing bacteria:occurrence, mechanisms and their role in crop production. J. Agric. Biol. Sci. 1:48-58. Krishnaraj PU, Goldstein AH (2001). Cloning of a Serratia marcescens DNA fragment thatinduces quinoprotein glucose dehydrogenasemediated gluconic acid production inEscherichia coli in the presence of stationary phase Serratia marcescens. FEMS Microbiol. Lett. 205:215-220. Kumar A, Bhargava P, Rai L (2010). Isolation and molecular characterrization of phosphatesolubilizing Enterobacter and Exiguobacterium species from paddy fields of EasternUttar Pradesh. Afr. J. Biotechnol. 4:820-829. Kumar V, Narula N (1999).Solubilization of inorganic phosphates and growth emergenceof wheat as affected by Azotobacter chroococcum mutants.Biol. Fert. Soils 28:301-305. LeГіn LA (1991). La experiencia La experiencia del centro internacional para el desarrollode fertilizantes en el uso de rocas fosfГіricas en AmГ©rica Latina. Rev. Fac. Agron. 17:49-66. Leyval C, Berthelin J (1989). Interactions betweenLaccarialaccata, Agrobacteriumradiobacterand beech roots: Influence on P, K, Mg, 741 and Fe mobilization fromminerals and plant growth. Plant Soil 117:103-110. Liu H, Wu X-Q, Ren J-H, Ye J-R (2011). Isolation and Identification of Phosphobacteria inPoplar Rhizosphere from Different Regions of China. Pedosphere 21:90-97. Louw HA, Webley DM (1959).A study of soil bacteria dissolving certain mineral phosphatefertilizers and related compounds.J. Appl. Microbiol. 22:227-233. Malagon DC (2003). Ensayo sobre tipologГa de suelos colombianos. Г‰nfasis en gГ©nesis yensayos ambientales Revista de la Academia Colombiana de Ciencias Exactas, FГsicas y Naturales 27: 319 - 341. Mba C (1994). Field studies on two rock phosphate solubilizing actinomycete isolates asbiofertilizer sources. Environ. Manage. 18:263-269. Mba C (1997). Rock phosphate solubilizing Streptosporangium isolates from casts oftropical earthworms. Soil Biol. Biochem. 29:381-385. Mehta S, Nautiyal CS (2001). An Efficient Method for Qualitative Screening of Phosphate-Solubilizing Bacteria. Curr. Microbiol. 43:5156. Murphy J, Riley JP (1962).A modified single solution method for the determination ofphosphate in natural waters. Anal. Chim. Acta. 27:31-36. Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GA, Kent J (2000).Biodiversityhotspots for conservation priorities. Nature 403: 853-858. Narula N, Kumar V, Behl RK, Deubel A, Gransee A, Merbach W (2000).Effect of PsolubilizingAzotobacter chroococcum on N, P, K uptake in P-responsive wheatgenotypes grown under greenhouse conditions.J. Plant Nutr. Soil Sci. 163:393-398. Nautiyal CS (1999).An efficient microbiological growth medium for screening phosphatesolubilizing microorganisms.FEMS Microbiol. Lett.170:265-270. Norovsuren Z, Zenova G, Mosina L (2007). Actinomycetes in the rhizosphere of semidesertsoils of Mongolia.Eurasian Soil Sci. 40:415418. Oliveira CA, Alves VMC, Marriel IE, Gomes EA, Scotti MR, Carneiro NP, GuimarГЈes CT, Schaffert RE, SГЎ NMH (2009). Phosphate solubilizing microorganisms isolated from rhizosphereof maize cultivated in an oxisol of the Brazilian Cerrado Biome. Soil Biol. Biochem. 41:1782-1787. Olsen S, Watanabe F (1957). A method to determine a phosphorus absorption maximum ofsoils as measured by the Langmuir isotherm. Soil Sci. Soc. Am. J. 21:144-149. Pandey A, Das N, Kumar B, Rinu K, Trivedi P (2008). Phosphate solubilization byPenicillium spp. isolated from soil samples of Indian Himalayan region. World J. Microbiol. Biotechnol. 24:97-102. Pathom-aree W, Stach J, Ward A, Horikoshi K, Bull A, Goodfellow M (2006). Diversity ofactinomycetes isolated from Challenger Deep sediment (10,898 m) from the Mariana Trench. Extremophiles. 10:181-189. PГ©rez E, SulbarГЎn M, Ball MM, YarzГЎbal LA (2007).Isolation and characterization of mineral phosphate-solubilizing bacterianaturally colonizing a limonitic crust in the south-eastern Venezuelan region. Soil Biol. Biochem. 39(11):2905-2914. Pikovskaya R (1948). Mobilization of phosphorus in soil in connection with vital activity ofsome microbial species. Microbiol. 17: 362-370. Prijambada I, Widada J, Kabirun S, Widianto D (2009). Secretion of organic acids by phosphate solubilizing bacteria isolated from Oxisols J. Tanah Trop.14(3):245-251. Rao IM, Barrios E, AmГ©zquita E, Friesen DK (2004).Soil phosphorus dynamics, acquisition and cycling in crop-pasture fallow systems in low fertility tropical soils: A review from Latin America CentroInternacional de Agricultura Tropical (CIAT), Canberra. Modelling nutrient management in tropical cropping systems. ACIAR proceedings. pp. 126-134. Rashid M, Khalil S, Ayub N, Alam S, Latif F (2004).Organic acids production andphosphate solubilization by phosphate solubilizing microorganisms (PSM) under invitro conditions. Pakistan J. Biol. Sci. 7:187-196. Rodriguez H, Fraga R (1999). Phosphate solubilizing bacteria and their role in plant growth promotion. Biotech. Adv.17:319-339. Rudresh DL, Shivaprakash MK, Prasad RD (2005).Effect of combined 742 Afr. J. Microbiol. Res. application ofRhizobium, phosphate solubilizing bacterium and Trichoderma spp. on growth, nutrient uptake and yield of chickpea (Cicer aritenium L.). Appl. Soil Ecol. 28:139-146. Rueda C, Aikawa M, Prada LD, Franco-Correa M, Martinez MA, Padilla G (2009). EvaluaciГіn de la presencia del gen mer A implicado en la detoxificacion demercurio a partir de actinomicetos nativos del humedal de La Conejera. Revista Colombiana de BiotecnologГa 11:105-113. Saharan B, Nehra V (2011). Plant Growth Promoting Rhizobacteria: A Critical Review. Life Sci. Med. Res. 2011:LSMR-21. Sayed W, Mohaowad S, Abd El-Karim M (2000). Effect of Al, Co, and Pb ions on growthof Frankia spp. in a mineral medium. Folia Microbiol. 45:153-156. Shirokikh IG, Zenova GM, Zvyagintsev DG (2002). Actinomycetes in the Rhizosphere of Barley Grown on Acid Soddy Podzolic Soil. Microbiol. 71:455-459. Vassilev N, Vassileva M, Nikolaeva I (2006). Simultaneous Psolubilizing and biocontrolactivity of microorganisms: potentials and future trends. Appl. Microbiol. Biotechnol. 71:137-144. Whitelaw M (2000). Growth promotion of plants inoculated with phosphate-solubilizingfungi. Adv. Agron. 69:99-151. Xu L, Li Q, Jiang C (1996). Diversity of soil actinomycetes in Yunnan, china. Appl. Environ. Microbiol. 62:244-248. Zapata F, Roy R (2007).UtilizaciГіn de rocas fosfГіricas para agricultura sostenible. Boletin FAO No 13, Roma. 156. Vol. 8(8), pp. 743-749, 19 February, 2014 DOI: 10.5897/AJMR2013.5953 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper Establishment of EvaGreen qPCR for detecting bovine rotavirus based on VP7 gene Wei Suocheng1*, Che Tuanjie2, Wang Jingming3, Li Yukong3, Zhang Taojie1, Song Changjun1 and Tian Fengling1 1 Life Science and Engineering College, Northwest University for Nationalities, Lanzhou 730030, China. 2 Lanzhou Baiyuan Company for Gene Technology, Lanzhou 730000, China. 3 Lanzhou Veterinary Research Institute of Chinese Academy of Agricultural Sciences, Lanzhou 730030, China. 4 Agriculture Bureau of Yuzhong County, Lanzhou 730100, China. Accepted 20 January, 2014 The aim of the present study was to establish a method of EvaGreen real time fluorescence quantitative polymerase chain reaction (qPCR) for detecting quickly bovine rotavirus (BRV) in fecal samples from calves with diarrhea. The specific primers were designed and synthesized according to BRV VP7 gene in Genbank. VP7 gene was cloned into the pMD18-T vector. The bovine viral diarrhea virus, bovine coronavirus, porcine epidemic diarrhea virus, bovine mycobacterium tuberculosis and negative control were detected with qPCR. Plasmids in five 10-fold gradients were detected using qPCR. The results show that a EvaGreen qPCR was established in the present study. Only BRV displayed amplification curve; cross-reactivity between BRV and the other viruses or bacteria was not observed. The amplification curve of pMD18-T vector plasmid (diluted in 10-1 to 103 gradient) was typical S shape. The detection limit of qPCR was 8.0 copies/ОјL, namely 100 plasmid concentrations. The coefficients of variation in both intra-assay and inter-assay was less than 2%. The established EvaGreen qPCR had a high specificity, sensitivity and reproducibility. It can be applied to clinical diagnosis and epidemiological surveys of BRV. Key words: Rotavirus, VP7 gene, evagreen, real-time quantitative PCR, bovine. INTRODUCTION Neonatal calf diarrhea is a common disease affecting the newborn calf worldwide, threatening the cattle production along with significant morbidity and mortality and inducing severe economic losses (Wei, 2011). Group A rotaviruses (RVA) are known to be important viral diarrheal agents in infants and young animals, including calves. The numbers of the rotavirus-associated mortality are estimated to be 453,000 in 2008 (Tate, 2012; 2013). The numbers of deaths is particularly high in developing countries (Abe et al., 2009). Even in developed countries, rotavirus remains an important cause of morbidity. Rotaviruses possess 11 segments of double-stranded ribonucleic acid (dsRNA) and two outer capsid proteins: VP4 (encoded by gene segment 4) and VP7 (encoded by gene segment 7, 8 or 9 depending on the strain), both of which are independently responsible for virus neutralization (Estes, 2001). RVA strains are antigenically heterogeneous, and are classified in multiple G and P types de- *Corresponding author. E-mail: [email protected]. Tel: +0086-931-2937773. 744 Afr. J. Microbiol. Res. fined by VP7 and VP4 outer capsid proteins (Papp et al., 2013). The neutralization specificity related to VP7 is referred to as the G serotype (for glycoprotein), and that associated with VP4 is referred to as the P serotype (for protease-sensitive protein) (Anthony et al. 1999). Currently, group A rotavirus has been classified into at least 15 G serotypes (G1-G15) and 21 P genotypes (P1-P24) (Ram, 2004). With regard to bovine, at least nine G serotypes (G1-4, 6-8, 10, 11) and three P genotypes have been found so far (Santos and Hoshino, 2005; Papp et al., 2013). Feray et al. (2010) reported G6 was the predominant G-type, detected in 40/53 samples (75.4%), while P[11] was the predominant P-type, detected in 52/53 samples (98.1%). The most common VP7/VP4 combinations were G6P[11] (60.3%) and G10P[11] (24.5%). A similar finding was reported by Swiatek et al. (2010). Our study found that G6 and G10 serotypes were 29 (54.7%) and 8 (15.1%) in positive samples for VP7. The main combinations of BRV G serotype and P genotype were G6P[5] (28.3%) (Wei et al., 2013). VP7 and VP4 proteins elicit the production of neutralizing antibodies, define the antigenic specificities, referred to as G type and P type, respectively, and are the major antigens neutralizing immune responses during rotavirus infections (Aminu et al., 2010). Rotavirus VP7 gene is highly conservative at both ends of open reading frame (ORF), such it is feasible to detect rotavirus serotypes utilizing the rotavirus specific primers. VP7 has been shown to be involved in the early interactions with cell-surface molecules, during the rotavirus entry process (Lopez and Arias, 2006; Martha et al., 2012). Moreover, PCR can be used to detect rotavirus VP7 not only stool specimens also cerebrospinal fluids and sera (Hiroshi et al., 1994). Currently many methods (including polymerase chain reaction, PCR) are available for detecting rotavirus, especially VP6 antigen (Luan et al., 2006; Gutierrez-Aguirre et al., 2008; Zhu et al., 2011; Fan et al., 2011). Unfortunately, PCR assays require sophisticated equipment, which is costly to maintain, and must be performed in specialized laboratories (Xie et al., 2012). So far, little information regarding real-time quantitative PCR (qPCR) utilized to detect RV VP7 antigen has been known. The real-time quantitative PCR (qPCR) methods are not only fast and accurate, and also can test against different target sequences. Its specificity is very high (Okada and Matsumoto, 2002; Santos and Hoshino, 2005). Quantitative PCR (qPCR), also known as real-time PCR, has become a powerful tool for the amplification, identification and quantification of nucleic acids. Its ability to quantitatively and specifically detect genes has been invaluable for both research and diagnostic applications (Schweitzer and Kingsmore, 2001). The qPCR using a simple DNA dye is a popular choice among academic laboratories for PCR experiments (Bustin, 2002). Compared to conventional reverse transcript PCR (RT-PCR), qPCR has been shown to be more rapid and more sensitive for the detection and quantification of rotavirus (Mackay et al., 2002; Kang et al., 2004; Pang et al., 2004). EvaGreen (EG) is a novel DNA-binding dye. It has been reported to be used for DNA quantification, DNA conformation detection quantitative PCR (Ihrig et al., 2006). Currently, very little research of Evagreen Real-time Quantitative PCR (qPCR) is performed for detection of BRV (Ihrig et al., 2006). Currently, very little research of Evagreen Real-time Quantitative PCR (qPCR) has been performed for detection of bovine rotavirus (BRV) (Gouvea et al., 1990; Mohan et al., 2006). It has not been applied in detecting bovine rotavirus in China. The aim of the present study was to establish EvaGreen Real-time Quantitative PCR (qPCR) for detecting BRV VP7 gene in fecal samples. MATERIALS AND METHODS Fecal samples Fecal samples were collected from 62 calves with diarrhea that were one to thirty days old and located on dairy farms in Lanzhou (26 samples), Qingyang cities (19 samples) and Gannan autonomous prefecture (17 samples) of Gansu province of China, from November 2010 to April 2011. TRIzol (a nucleic acid extraction reagent; Invitrogen, Beijing, China) was added to the collection tube in advance. All fecal specimens were stored at -20В°C until further use. A 10% suspension of each fecal sample was prepared in phosphate buffered saline (PBS), pH 7.2 and centrifuged at 4,000 g for 15 min at 4В°C. The supernatants of 62 fecal samples were subjected to ELISA for detecting the presence of RV with commercially rotavirus detection kits (Lanzhou Institute of Biological Products Company, Lanzhou, China) and following the protocol of the manufacture instructions. The results were interpreted by using the OD values obtained at 450 nm with ELISA reader (BioTec, Dresden, Germany). All positive samples from ELISA were used for the subsequent experiments. Fecal supernatants were stored at 4В°C. Primers designs and synthesis For qPCR, based on the deposited genome sequences of BRV VP7 in GenBank (accession number No. GQ433985), specific primers were designed using Primer Premier 5.0 software according to the highly conserved regions: Forward: 5’-GTATGGTATTGAATATACCAC-3’ (nts 51-71 of GQ433985). Reverse: 5’-GATCCTGTTGGCCATCC-3’ (nts 376-392 of GQ433985). The length of predicting product is 342 bp. The concentrations of primers (100, 200, 300 and 500 nM) were evaluated. The formation of primer-dimers was assessed by melting curve analysis. Thus, only those concentrations of primers that showed dimer-free reactions were used for the final analysis. Primers were synthesized from Takara Bio, Dalian, China. Cell cultures The neonatal calf diarrhea virus (NCDV) strain (AV-51, purchased from Chinese Veterinary Drugs Supervisor Institute, Beijing, China) and ELISA positive fecal samples were inoculated to single layer MA-104 cells as described previously (Wei et al., 2010). The cells Suocheng et al. were cultured for 3-4 days at 37В°C. The process ended when the cytopathogenic effect (CPE) was higher than 90%. Then, the cells were frozen and thawed 2 to 3 times. The viral supernatant was collected for RNA extraction or stored at -80В°C until processed. RNA extraction and cDNA synthesis According to the manufacturer’s instructions, total RNA was extracted from the viral supernatants of the neonatal calf diarrhea virus (NCDV) strain (AV-51) and fecal samples using the TRIzol RNA extraction kit (Invitrogen, Beijing, China). Briefly, PCR was performed in a 25 ОјL volumes that included 15.5 ОјL diethylpyrocarbonate (DEPC) water, 0.5 ОјL (10 mM) deoxyribonucleotide triphosphate (dNTPs), 2.5 ОјL 10Г—PCR buffer, 0.5 ОјL Tag enzyme. 0.5 ОјL BRVF primer, 0.5 ОјL BRVR and 5 ОјL cDNA. The PCR products were electrophoresed on 1.5% agarose gel (Amresco, USA) containing 1Г—Gel Red (BIOTIUM, Hayward, CA, U.S.A.) and subsequently analyzed with the software CS Analyzer Ver 3.0 (ATTO, Tokyo, Japan). The cDNA was synthesized from the NCDV strain and extracted viral RNA by reverse transcription reaction and used for PCR amplification of the VP7 gene. The expected amplicons were 342 bp sizes. Preparation of plasmid standard template The amplified VP7 cDNA fragments were cloned into pMD18-T vectors. Then, pMD18-T vectors were sequenced and validated. The positive plasmids were quantitatively measured using the optimized reaction conditions to establish a standard curve with the logarithm values of template starting copy number as the horizontal axis and Ct values as the vertical axis. The positive plasmids were used as standards (pMD-VP7), which were serially diluted 10-fold gradient to 4.0Г—10-1, 4.0Г—100, 4.0Г—101, 4.0Г—102 and 4.0Г—103 (copies/ОјL). 745 (PEDV) and bovine mycobacterium tuberculosis (provided by Lanzhou Veterinary Research Institute, Chinese Academy of agricultural sciences, Lanzhou, China), respectively. RNA was reverse transcribed. RNA templates were amplified with the established qPCR. Meanwhile, the negative control was detected. Meanwhile, the negative control was set. Sensitivity tests The plasmids were diluted on the serial 10-fold dilutions (103, 102, 101, 100 and 10-1 gradients) and detected with the established qPCR to evaluate the sensitivity of qPCR. Stability For the intra-assay variability, the plasmids in 5 dilution gradients (10-4, 10-3, 10-2 and 10-1) were detected using qPCR. The test was repeated thrice. The copy numbers, mean, standard deviation and variation coefficient (CV) were calculated from the standard curve for each dilution gradients. For inter-assay variability, the plasmids in 5 dilution gradients were detected with the qPCR for three times every three days. The copy numbers, average, standard deviation and variation coefficient were also calculated as the methods mentioned above. Fecal sample detection To evaluate the diagnostic efficacy of qPCR assay, cDNAs of 62 fecal samples were detected using the established qPCR. The findings were compared with that of ELISA method to verify the coincidence rate of two methods. RESULTS EvaGreen Real-time Quantitative PCR (qPCR) The qPCR was performed in a 50 ОјL reaction systems, which consisted of 25 ОјL EvaGreen qPCR Master Mix (Chaoshi biotechnology company, Shanghai, China), 1 ОјL BRVF Primer (10 ОјM), 1 ОјL BRVR primers (10 ОјM), 5 ОјL cDNA and 18 ОјL deionized water. The experiment Detector was set to SYBR, and the Quencher was set to None. The conditions for qPCR were as follows: initial denaturation at 95В°C for 15 min followed by 40 cycles of 94В°C for 15 s, 55В°C for 30 s and 72В°C for 40 s, and a final extension at 72В°C for 10 min. The qPCR was done in ABI quantitative PCR instrument (ABI PRISM 7300 type, Applied Biosystems incorporation, USA). Screening of fecal samples by ELISA The screening of 10% suspension of 62 fecal samples indicated that 12 fecal samples were positive for BRV, with a prevalence rate of 19.36%. Amplification of BRV VP7 gene As shown in Figure 1, a predicted 342 bp band was found in agarose gel electrophoresis. The result testified they are group A BRV. Establishment of the standard curve for qPCR The 10-fold diluted plasmid standards (4.0Г—10-1, 4.0Г—100, 4.0Г—101, 4.0Г—102 and 4.0Г—103 copies/ОјL) were detected quantitatively using qPCR assay. Such the standard curve had been established with the logarithmic values of the starting copies as the horizontal axis (X) and Ct values as the vertical axis (Y). Specificity tests To examine the analytical sensitivity, the RNA was extracted from the viral supernatants of BRV stools, bovine viral diarrhea virus (BVDV), bovine coronavirus (BCV), porcine epidemic diarrhea virus Dynamics curve and the standard curve of qPCR The reaction conditions of qPCR were optimized. The optimum reaction conditions were as follows: initial denaturation for 15 min at 95В°C, denaturation for 15 s at 95В°C, annealing for 30 s at 55В°C, elongation for 40 sat 72В°C, by 40 cycles, and a final elongation of 10 min at 72В°C. The dynamics curve of qPCR was acquired (Figure 2). The recombinant plasmids (pMD-VP7) in five 10-fold gradients from 4.0Г—10-1 to 4.0Г—103 were detected using the optimized qPCR reactions, respectively. Ct values were 746 Afr. J. Microbiol. Res. had an excellent specificity. It can be applied to detect diarrhea sample clinically. Sensitivity test results The plasmids in five dilution gradients were detected with the established qPCR (Figure 5). The amplification curve of pMD-VP7 plasmid (diluted in 10-1пЅћ103 gradient) was typical S shape with an excellent appearance. Ct values were 28.55, 24.42, 2.067, 17.42 and 14.48, respectively. The corresponding copy numbers -3 2 1 0 were 1.80Г—10 , 4.11Г—10 , 6.21Г—10 , 8.03Г—10 and -1 9.68Г—10 , respectively. Therefore, the detection limit of qPCR was 8.0 copies/ОјL, namely 10-0 plasmid concentration. Figure 1. Amplification of BRV in agarose gel electrophoresis. The predicted 342 bp band was found. 1: blank control; 2 and 3: extracted total RNA from fecal samples; 4: marker. Stability test results As shown in Table 1, the variation coefficients (CV) of intra-assay reproducibility and inter-assay reproducibility were 1.0-1.1 and 1.7-2.0, respectively, which demonstrated the qPCR assay was stable and reliable. Detection results of fecal samples Detection results of fecal samples showed that 10 (all of which were positive for ELISA) out of 62 fecal samples were found positive for BRV by qPCR. The coincidence rate of qPCR and ELISA was 83.3%. qPCR had a higher sensitivity and specificity. DISCUSSION Figure 2. The dynamics curve of qPCR. 28.55, 24.42, 20.67, 17.42 and 14.48 respectively. Such, the standard curve was established (Figure 3). The slope, 2 intercept and correlation coefficient (R ) of the standard curve were -3.574, 31.77 and 0.997 respectively, indicating a strong linear relationship. Gene amplification efficiency (E) equalled to (1.91-1) x100%=91%. Such, the regression equation was expressed as Y=-3.574 LogX +31.77. It can be calculated that Ct value equated to 31.77-3.574X. Specificity test results As can be seen from Figure 4, the optimized rotavirus qPCR assay was tested against other viruses and bacteria, which included BCoV, PEDV and MB, in order to demonstrate the specificity of the assay. The results show only BRV displayed amplification curve, the crossreactivity between BRV and other viruses or bacteria was not observed. It indicated the established qPCR assay Real-time PCR can be carried out using either probes or DNA dyes (Higuchi et al., 1993; Wilhelm and Pingoud, 2003; Anne, 2011). SYBR Green exhibits a very strong fluorescent signal, but it has been shown to inhibit the PCR reaction and has a narrow dynamic range and lower reproducibility than other detection chemistries (Gudnason et al., 2007). EvaGreen is another DNA dye which is less inhibitory to PCR than SYBR Green and is marketed as an alternative. EvaGreen dye performed better than SYBR Green in general, and high reaction efficiencies can be achieved using the dye. In cases where template sequence tends to vary, dye-based detection helps prevent false negatives that might result from base pair mismatches in a sequence-specific probe binding region (Anderson et al., 2003; Papin et al., 2004). It has recently been used for quantitative real-time PCR (qPCR), post-PCR DNA melt curve analysis and several other applications (Mao et al., 2007). So far, it has not been reported that qPCR is utilized to detect bovine rotavirus in China. The present study was to develop a higher specificity and sensitivity method for detecting BRV VP7 gene in fecal samples using EvaGreen dye. Suocheng et al. Figure 3. The standard curve of qPCR. The slope, intercept and correlation coefficient (R2) of the standard curve were -3.574, 31.77 and 0.997 respectively, indicating a strong linear relationship. Figure 4. Specificity of qPCR assay. BRV displayed amplification curve, the cross-reactions between bovine rotavirus and other viruses: BVDV, bovine viral diarrhea virus; BcoV, bovine coronavirus; PEDVPEDV, porcine epidemic diarrhea virus or bacteria bovine; MB, mycobacterium tuberculosis and negative control were not observed, indicating a high specificity for qPCR assay. Figure 5. Sensitivity of qPCR assay. M, 100bp DNA Marker; 1-2, padding and negativie control; 3-7, the 10-fold serial plasmid dilutions (103 , 102, 101, 100 and 10-1 gradients). 747 748 Afr. J. Microbiol. Res. Table 1. Intra-assay and Inter-assay reproducibility test of qRT-PCR. Dilution gradient of Standard plasmid* n Intra-assay reproducibility CV(%) X п‚± SD Inter-assay reproducibility CV(%) X п‚± SD 10-1 -2 10 -3 10 10-4 3 3 3 3 15.1В±0.6 18.4В±0.7 21.5В±0.6 26.1В±0.7 16.3В±0.7 19.4В±0.9 21.1В±0.9 26.0В±0.9 1.0 1.0 1.1 1.0 1.7 2.0 1.9 2.0 Note: * Copy /ОјL In the present research, a 342 bp VP7 gene of BRV was amplified from fecal samples with RT-PCR. qPCR has been developed for determining BRV VP7 gene. The quantities of RNA in qPCR ranged between 8.03Г—100 and -3 1.80Г—10 copies per reaction. The established qPCR was high specificity, sensitivity and stability. However, because of inadequate conditions and detection of small samples, the specificity of the experimental methods and result repetition need to be improved in the future. In addition, BRV Kit has not been developed (Luan et al., 2006; Wei et al., 2010). The human ELISA Kit was used in this study. The coincidence rate of qPCR and ELISA in our findings needs to be investigated further. It is concluded that the qPCR using EvaGreen dye is a rapid, sensitive and stable method for the detection of BRV VP7 gene. The qPCR has a low risk of contamination and is less time and manpower consuming than conventional RT-PCR. It could be used for clinical diagnosis and epidemiological survey of bovine rotavirus. ACKNOWLEDGEMENTS The work was supported by the science and technology program project in Gansu province of China in 2007 (Grant No: 0708NKCA079 and the research and application project of agricultural biotechnology in Gansu province (Grant No: GNSW-2010-10). REFERENCES Abe M, Ito N, Morikaw S, Takasu M, Murase T, Kawashima T, Kawai Y, Kohara J, Sugiyama M (2009) Molecular epidemiology of rotaviruses among healthy calves in of a novel bovine rotavirus bearing new P and G genotypes. Virus Res. 144: 250-257 Aminu M, Page N A, Ahmad AA, Umoh JU, Dewar J, Steele AD (2010). Diversity of Rotavirus VP7 and VP4 Genotypes in Northwestern Nigeria. JID. 202 (Suppl 1): S198-S204. Anderson TP, Werno AM, Beynon KA, Murdoch DR (2003). Failure to genotype herpes simplex virus by real-time PCR assay and melting curve analysis due to sequence variation within probe binding sites. J. Clin. Microbiol. 41(5): 2135-2137. Anne CE (2011). SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR. BMC Res. Notes. 4: 263-271. Anthony HC, Choi MB, Monica MM (1999). Antibody-Independent Protection against Rotavirus Infection of Mice Stimulated by Intranasal Immunization with Chimeric VP4 or VP6 Protein. J. Virol. 73(9): 7574-7581. Bustin SA (2002). Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. 29(1): 23-39. Estes MK (2001). Rotaviruses and their replication. In Fields virology Knipe DM, Howley PM eds). Lippincott-Roven Publishers, Philadelphia, 1747-1785. Fan Q, Xie ZX, Lie JB, Peng YS, Deng XW, Xie ZQ, Xie LJ, Peng Y (2011). Detection of bovine rotavirus by TaqMan based Real-time reverse transcription polymerase chain reaction assay. China Anim. Husbandry Vet. Med. 38:105–108. Feray A, Aykut O, Tuba CO, Mehmet OT, Elvin C, Vito M, Ibrahim B (2010). Distribution of G (VP7) and P (VP4) genotypes of group A bovine rotaviruses from Turkish calves with diarrhea, 1997–2008. Vet. Microbiol. 141:231–237. Gouvea V, Glass RI, Woods P, Taniguchi K, Clarke HF, Forrester B, Fang ZY (1990). Polymerase chain reaction amplification and typing of rotavirus nucleic acid from stool specimens. J. Clin. Microbiol. 28:276-282. Gudnason H, Dufva M, Bang DD, W olff A (2007). Comparison of multiple dyes for real-time PCR: effects of dye concentration and sequence composition on DNA amplification and melting temperature. Nucleic Acids Res. 35(19): e127 Gutierrez-Aguirre I, Steyer A, Boben J, Gruden K, Poljsak-Prijatelj M, Ravnikar M (2008). Sensitive detection of multiple rotavirus genotypes with a single reverse transcriptionreal-time quantitative PCR assay. J. Clin. Microbiol. 46:2547–2554. Higuchi R, Fockler C, Dollinger G, Watson R (1993). Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Bio. Technol. 11:1026-1030. Hiroshi U, Keqin X, Shuichi N, Shigeru M, Toshiaki A (1994). Detection and Sequencing of Rotavirus VP7 Gene from Human Materials (Stools, Sera, Cerebrospinal Fluids, and Throat Swabs) by Reverse Transcription and PCR. J. Clin. Microbiol. 32(12): 2893-2897. Ihrig J, Lill R, Muhlenhoff U (2006). Application of the DNA-specific dye EvaGreen for the routine quantification of DNA in microplates. Anal. Biochem. 359(2):265-267. Kang G, Iturriza-Gomara M, Wheeler JG, Crystal P, Monica B, Ramani S, Primrose B, Moses PD, Gallimore CI, Brown DW, Gray J (2004). Quantitation of group A rotavirus by real-time reverse-transcription-polymerase chain reaction: correlation with clinical severity in children in South India. J. Med. Virol. 73, 118-122. Lopez S, Arias CF. (2006) Early steps in rotavirus cell entry. Curr Top Microbiol Immunol 309:39–66. Luan J, Yang S, Zang W, Gao Y, Zhong J, Zhao H (2006). Rapid detection of bovine rotavirus with semi2nested RT2PCR assay. Chinese J. Zoonoses. 22(7): 671-674. Mackay IM, Arden KE, Nitsche A (2002). Real-time PCR in virology. Nucleic Acids Res. 30: 1292-1305. Mao F, Leung WY, Xin X (2007). Characterization of EvaGreen and the implication of its physicochemical properties for qPCR applications. BMC Biotechnol. 7:76-82. Martha NC, Fanny G, Orlando A, Carlos AG (2012). Rotavirus VP4 and VP7-Derived Synthetic Peptides as Potential Substrates of Protein Suocheng et al. Disulfide Isomerase Lead to Inhibition of Rotavirus Infection. Int. J. Pept. Res. Ther. 18:373–382 Mohan S, Manoharan P, Pachaikani R (2006). Genotyping of rotavirus of neonatal calves by nested-multiplex PCR in India. Veterinarski Arhiv. 76 (6): 497-505. Okada N, Matsumoto Y (2002). Bovine rotavirus G and P types and sequence analysis of the VP7 gene of two G8 bovine rotaviruses from Japan. Vet Microbiol. 84: 297-305. Pang XL, Lee B, Boroumand N, Leblanc B, Preiksaitis JK, Yu ICC (2004). Increased detection of rotavirus using a real time reverse transcription polymerase chain reaction (RT-PCR) assay in stool specimens fromchildren with diarrhea. J. Med. Virol. 72: 496-501. Papin JF, Vahrson W, Dittmer D (2004). SYBR Green-based real-time quantitative PCR assay for detection of West Nile virus circumvents false-negative results due to strain variability. J. Clin. Microbiol. 42(4):1511-1518. Papp H, LГЎszlГі B, Jakab F, Ganesh B, De Grazia S, Matthijnssens J, Ciarlet M, Martella V, BГЎnyai K (2013). Review of group A rotavirus strains reported in swine and cattle. Vet. Microbiol. 165(3-4):190-199. Ram IG (2004). Pathogenesis of intestinal and system in rotavirus infection. J. Virol. 78:10213-10220. Santos N, Hoshino Y (2005). Global distribution of rotavirus serotypes/ genotypes and its implication for the development and implementation of an effective rotavirus vaccine. Rev. Med. Virol. 15: 29-56. Schweitzer B, Kingsmore S (2001). Combining nucleic acid amplification and detection. Curr. Opin. Biotechnol. 12(1):21-27. Swiatek DL, Palomboc EA, Leed A, Coventryd MJ, Britza ML, Kirkwooda CD (2010). Detection and analysis of bovine rotavirus strains circulating in Australian calves during 2004 and 2005. Vet. Microbiol. 140: 56–62. 749 Tate JE, Steele AD, Bines JE, Zuber PL, Parashar UD (2012). Research priorities regarding rotavirus vaccine and intussusception: a meeting summary. Vaccine. 30 (Suppl 1):A179-84.doi: 10.1097/INF.0b013e31828d639c. Tate JE, Haynes A, Payne DC, Cortese MM, Lopman BA, Patel MM, Parashar UD (2013). Trends in national rotavirus activity before and after introduction of rotavirus vaccine into the national immunization program in the United States, 2000 to 2012. Pediatr Infect Dis J. 32(7):741-4. Wei Suocheng, FENG Ruofei, GONG Zhuandi, TIAN Fengling (2010). Researches of Isolation and Cell Cultivation of Bovine Rotavirus in Vero and MA-104 Cells. J. Northwest University for Nationalities. 31(4):71-75. Wei S, Gong Z, Che T, Ayimu G, Tian F (2013). Genotyping of calves rotavirus in China by reverse transcription polymerase chain reaction. J. Virol. Methods 189(1):36– 40 Wei Z, Jianbao D, Takeshi H, Yoshitaka G, Masuo S (2011). Rapid and Sensitive Detection of Bovine Coronavirus and Group A Bovine Rotavirus from Fecal Samples by Using One-Step Duplex RT-PCR Assay. J. Vet. Med. Sci. 73(4): 531-534. Xie Z, Fan Q, Liu J, Pang Y, Deng X, Xie Z, Xie L, Khan MI (2012). Reverse transcription loop-mediated isothermal amplification assay for rapid detection of Bovine Rotavirus. BMC Vet. Res. 8:133-137. Zhu W, Dong J, Haga T, Goto Y, Sueyoshi M (2011). Rapid and sensitive detection of bovine coronavirus and group a bovine rotavirus from fecal samples by using one-step duplex RT-PCR assay. J. Vet. Med. Sci. 73:531–534. Vol. 8(8), pp. 750-758, 19 February, 2014 DOI: 10.5897/AJMR2013.6351 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper Nutritional requirements for the production of antimicrobial metabolites from Streptomyces Mariadhas Valan Arasu1,2*, Thankappan Sarasam Rejiniemon3, Naif Abdullah Al-Dhabi4, Veeramuthu Duraipandiyan1,4, Savarimuthu Ignacimuthu1, Paul Agastian1,5, Sun-Ju Kim6, V. Aldous J. Huxley3, Kyung Dong Lee7, Ki Choon Choi2* 1 Division of Microbiology, Entomology Research Institute, Loyola College, Chennai, India. Grassland and forage division, National Institute of Animal Science, RDA, Seonghwan-Eup, Cheonan-Si, Chungnam, 330-801, Republic of Korea. 3 Department of Zoology, Thiru Vika Government Arts College, Thiruvarur - 610 003, Tamil Nadu, India. 4 Department of Botany and Microbiology, Addiriyah Chair for Environmental Studies, College of Science, King Saud University, Riyadh, Saudi Arabia. 5 Department of Plant Biology and Biotechnology, Loyola College, Chennai, India. 6 Department of Bio-environmental Chemistry, Chungnam National University, 99 Daehak-Ro, Yuseong-Gu, Daejeon 305-764, Republic of Korea. 7 Department of Oriental Medicine Materials, Dongsin University, Naju, Korea. 2 Accepted 13 January, 2014 The objective of this study was to optimize the nutritional and cultural conditions of Streptomyces strain ERI-1, ERI-3 and ERI-26 for the production of antimicrobial metabolites under shake-flask conditions. Effect of eight fermentation medium, different temperature, pH, incubation time, different carbon and nitrogen sources and different concentration of sodium chloride on production of antimicrobial metabolites were studied. Antimicrobial activity of the fermentation medium was evaluated by cup plate method by measuring the zone of inhibition. Nutritional and cultural conditions for the production of antimicrobial metabolites by Streptomyces strain ERI-1, ERI-3 and ERI-26 under shake-flask conditions have been optimized. Modified nutrient medium was found to be good base for fermentation. Glucose and ammonium nitrate were identified as best carbon and nitrogen sources, respectively for growth and production of more antimicrobial compounds. Similarly, initial production medium pH of 7.0, incubation temperature of 30В°C and incubation time of 96 h was found to be optimal. Optimization of medium and cultural conditions resulted in better antibacterial and antifungal activity. The zone of inhibition of ERI-26 against Aspergillus niger was 25 and 20 mm for Curvularia lunata, respectively. It is clear that novel Stretomyces strains ERI-1, ERI-3 and ERI-26 produced extra cellular antimicrobial metabolites effective against pathogenic bacteria and fungi, moreover the medium and cultural conditions for better antimicrobial metabolites production have been optimized. Key words: Streptomyces, antimicrobial activity, nutritional requirements, cultural conditions, optimized media. INTRODUCTION Streptomycetes are potent producers of secondary metabolites. Among 10000 known antibiotics, 45-55% is produced by Streptomycetes (Demain, 2006; Lazzarini et *Corresponding author. E-mail: [email protected]. al., 2000). Secondary metabolites produced by them have a broad spectrum of biological activities such as antibacterial (streptomycin, tetracycline, chloramphenicol), Arasu et al. antifungal (nystatin), antiviral (tunicamycin), antiparasitic (avermectin), immunosuppressive (rapamycin), anticancer (actinomycin, mitomycin C, anthracyclines), enzyme inhibitors (clavulanic acid) and diabetogenic (bafilomycin, streptozotocin). Secondary metabolite production in microbes is strongly influenced by nutritional factors and growth conditions. A common strategy, widely applied in industrial screening programs, consists of the application of several growth conditions (including variables such as production media, incubation time and other factors) to different strains which has been studied (Vilella et al., 2000). There is strong evidence that this approach improves the chances of finding the desired metabolites (Lauren and Yit-Heng, 2011; Arasu et al., 2013). Considering that any screening program of microbial natural products can handle a limited number of fermentations, applying many growth conditions to each strain may critically restrict the number of strains and therefore the diversity of biosynthetic pathways included in the screening. As a compromise between these two requirements, a number of conditions are usually applied to each strain (Wildmans, 1997). Furthermore, without prior knowledge about the preferred growth conditions for a given microorganism, random assignment of media to strains may generate an inefficient redundancy of metabolites or extracts lacking relevant levels of secondary metabolites. The production of secondary metabolites is affected by the availability of nutrients (Valanarasu et al., 2010). In fermentation experiments, the production of antibiotics is increased by the presence of a non preferred carbon source, or by other nutrients (Mohd et al., 2012). The source and availability of nitrogen can also influence the production of secondary metabolites (Arasu et al., 2008; Arasu et al., 2009). In our screening programme for isolation and identification of actinomycetes from Westen Ghats of Tamil Nadu for antimicrobial metabolite production, we isolated 367 actinomycetes from different parts of the forest soil samples. Actinomycetes recovered from Kanyakumari showed significant activity against most of the tested bacteria and fungi (Arasu et al., 2013). Among the different actinomycetes; ERI-1, ERI-3 and ERI-26 isolates from the Western Ghats region of Kanyakumari District revealed significant activity against all the tested bacteria and fungi. This study focused on optimizing nutrition and cultural conditions of Streptomyces strain ERI-1, ERI-3 and ERI26 for the production of antimicrobial metabolites under the shake-flask condition. MATERIALS AND METHODS Fermentation medium Fermentations were carried out using eight different antimicrobial compound production medium; GEN medium (M-1), Streptomyces medium (M-2), Micromonospora medium (M-3), nutrient glucose medium (M-4), Bennett medium (M-5), starch with a mineral salt solution medium (M-6), complex medium (M-7) and starch casein medium (M-8). A loopful of a selected strain was inoculated into 50 751 mL fermentation broth medium and incubated on a rotary shaker at 200 rpm, 30В°C for 24 h. After that 10% of inoculum was transferred to production medium containing 100 mL of fermentation medium in 500 mL Erlenmeyer flask. Different culture conditions like temperatures (20, 25, 30, 37 and 45В°C), pH (6.0, 6.5, 7.0, 7.5, 8.0 and 8.5) and incubation time (24, 48, 72, 96, 120 and 144 h) were studied to standardize the antibiotic production. Effect of different carbon source and nitrogen source for growth and antimicrobial compound production in fermentation medium were evaluated. Different concentrations of sugar for production of antimicrobial compound and growth were also studied. Influence of different concentrations of sodium chloride in production medium was studied. Antibacterial assay Test organism The following test organisms were used for antibacterial studies: Staphylococcus aureus (ATCC 25923), Staphylococcus epidermidis (MTCC 3615), Bacillus subtilis (MTCC 441), Enterococcus faecalis (ATCC 29212), Escherichia coli (ATCC 25922), Pseudomonas aeruginosa (ATCC 27853), Klebsiella pneumoniae (ATCC 15380), Proteus vulgaris (MTCC 1771), Erwinia sp. MTCC (2760), Xanthomonas sp., Vibrio fischeri (MTCC 1738) and Salmonella typhi (MTCC 733). All cultures were obtained from Department of Microbiology, Christian Medical College, Vellore, Tamil Nadu, India. Each bacterial strain was inoculated in 3 mL of Mueller Hinton broth and incubated at 37В°C for 24 h. After incubation period the culture was diluted. Fungal strains The following fungi were used for experiments: Trichophyton rubrum (MTCC 296), Trichophyton rubrum (57/01), Trichophyton mentagrophytes (66/01), Trichophyton simii (110/02), Epidermophyton floccosum (73/01), Scopulariopsis sp. (101/01) Aspergillus niger (MTCC 1344), Botyritis cinerea, Curvularia lunata (46/01) and Candida albicans (MTCC 227). Preparation of fungal spore The filamentous fungi were grown on Sabouraud dextrose sgar (SDA) slants at 28В°C for 10 days and the spores were collected using sterile doubled distilled water and homogenized. Yeast was grown on Sabouraud dextrose broth at 28В°C for 48 h. Cup plate method Antibacterial assays Antibacterial activities were assayed by the agar diffusion method by Arasu et al. (2013). Petri plates were prepared with 20 mL of sterile Mueller Hinton Agar (MHA) (Hi-media, Mumbai). The test cultures (100 ВµL) of suspension containing 108 CFU/mL bacteria) were swabbed on the top of the solidified media and allowed to dry for 10 min. 5 mm diameter well was made using sterile cork borer and filled with 0.05 mL of supernatant of ERI-1, ERI-3 and ERI-26. The plates were left for 30 min at room temperature for supernatant diffusion. Negative control was prepared using the respective fermentation medium. The plates were incubated for 24 h at 37В°C. A zone of inhibition was recorded in millimeters and the experiment was repeated twice. Antifungal assays Antifungal assay was done by agar diffusion method. Petri plates 752 Afr. J. Microbiol. Res. Table 1. Effect of production of antimicrobial metabolites on different media. B.s S.a S.e E.f Inhibition zones in mm E.c P.a K.p X.sp. E.sp. S.t V.f P.v C.a ERI-1 Medium -1 Medium – 2 Medium – 3 Medium – 4 Medium – 5 Medium – 6 Medium – 7 Medium – 8 12 10 12 14 10 12 10 12 10 12 10 12 12 13 14 12 10 12 23 14 15 10 10 14 12 10 15 12 10 10 10 11 14 10 10 10 10 10 11 10 10 9 10 10 10 12 9 10 12 11 12 12 12 12 10 10 11 10 10 10 10 9 13 10 9 10 14 10 12 ERI-3 Medium - 1 Medium – 2 Medium – 3 Medium – 4 Medium – 5 Medium – 6 Medium – 7 Medium – 8 10 12 10 10 15 11 11 12 12 11 9 10 12 10 14 13 12 11 9 10 11 14 10 10 10 9 11 10 10 11 9 10 12 10 10 12 10 11 9 11 12 10 9 10 10 12 10 10 10 15 10 12 10 10 10 12 ERI-26 Medium Medium Medium Medium Medium Medium Medium Medium 9 11 10 12 11 11 10 9 9 13 11 14 12 10 11 11 14 12 14 12 10 10 10 10 10 12 10 10 11 15 9 9 10 - 9 11 - 10 12 - 12 - 10 - 14 - 10 - 10 10 10 10 Fermentation medium –1 –2 –3 –4 –5 –6 –7 –8 -: No activity, ERI: Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus; S.e-S. epidermidis; E.f- E. faecalis; E.cE. coli; P.a- P. aeruginosa; K.p- K. pneumoniae; X.sp- Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri; P.v- P. vulgaris. Results were analyzed in triplicates. were prepared with 20 mL of sterile SDA (Hi-media, Mumbai). The test cultures (50ВµL of fungal spore suspension) were swabbed on the top of the solidified media and allowed to dry for 10 min. Five mm diameter well was made using sterile cork borer and filled with 0.05 mL of supernatant of ERI-1, ERI-3 and ERI-26. The plates were left for 30 min at room temperature for supernatant diffusion. Negative control was prepared using the respective fermentation medium. The plates were incubated for 24-48 h at 28В°C. A zone of inhibition was recorded in millimeters and the experiment was repeated twice. pound(s) from three actinomycetes strains ERI-1, ERI-3 and ERI-26. All the twelve tested bacteria and yeast growth was inhibited by strain ERI-1 grown in M-1 and M8 medium. M-2 did not show any activity against K. pneumoniae, Xanthomonas sp., Erwinia, S. typhi, V. fischeri, P. vulgaris and C. albicans, whereas M-5 exhibited activity against only B. subtilis, S. aureus and S. epidermidis (Table 1). ERI-3 cultivated in M-3, M-5 and M-8 inhibited the growth of all the tested bacteria; however M-4 was ideal for ERI-26 RESULTS Selection of fermentation medium Effect of pH on the production of antimicrobial compounds Eight different fermentation media named as M-1 to M-8 were used as the base to determine the optimal nutritional conditions for the production of antimicrobial com- Optimum pH for the production of antimicrobial compounds was recorded by diameter of zone of inhibition (Table 2). At pH 7.0, ERI-1, ERI-3 and ERI-26 exhibited Arasu et al. 753 Table 2. Effect of pH of the medium on the growth and production of antimicrobial metabolites. pH Inhibition zones in mm Strain ERI-1 DCW 6.0 ERI-3 DCW 0.98 g/L ERI-26 DCW 1.23 g/L DCW 1.74 g/L ERI-3 DCW 1.32g/L ERI-26 DCW 1.47 g/L ERI-1 7.0 S.a S.e E.f E.c P.a K.p X.sp E.sp S.t V.f P.v C.a - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 12 9 11 10 12 - - - - - - - 10 9 10 10 11 9 9 9 - - - - - - 10 11 12 10 10 9 7 - - - - - - 15 15 14 14 14 11 10 10 12 12 12 10 12 12 9 9 11 10 9 9 9 11 - - - - 13 13 16 16 13 10 11 12 12 11 13 10 12 9 10 10 9 9 10 9 10 12 10 9 9 9 12 13 15 10 11 11 10 12 14 10 12 10 11 9 10 9 9 10 8 8 12 13 14 - - 10 13 14 10 12 12 14 12 - - - - - - 9 10 11 9 9 9 - - - - - - 12 - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 1.5g/L ERI-1 6.5 B.s DCW 2.47 g/L ERI-3 DCW 2.21 g/L ERI-26 DCW 2.73 g/L ERI-1 DCW 2.4 g/L 7.5 ERI-3 DCW 2.75 g/L ERI-26 DCW 2.43 g/L ERI-1 8.0 DCW 1.41 g/L ERI-3 DCW 1.28 g/L ERI-26 DCW 0.79 g/L ERI-1 8.5 DCW 0.42 g/L ERI-3 DCW 0.61 g/L ERI-26 DCW 0.72 g/L -; No activity, ERI- Entomology Research Institute, DCW- dry cell weight. B.s - B. subtilis; S.a – S. aureus ;S.e - S. epidermidis; E.f - E. faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.; E.sp- Erwinia;S.t - S. typhi; V.f - V. fischeri;P.v - P. vulgaris. Results were analyzed in triplicates. good growth and antimicrobial activity against tested bacteria. Cell growth in terms of biomass was noted in strain ERI-3 as 0.98, 1.32, 2.21, 2.43, 0.79 and 0.72 g/L for pH 6.0, 6.5, 7.0, 7.5, 8.0 and 8.5, respectively. Optimizing the incubation time and temperature for production of antimicrobial compounds ERI-1, ERI- 3 and ERI- 26 showed maximum antimicro- 754 Afr. J. Microbiol. Res. Table 3. Effect of incubation time on growth and production of antimicrobial metabolites. Time 24 48 72 Strain S.a 9 S.e 10 E.f - S.t - V.f - P.v - C.a - - - - - - - - - - - - - - - - - - - - - - - - - - - 10 12 10 9 11 12 13 11 12 10 12 12 10 9 10 12 9 10 11 10 10 12 11 10 10 10 10 9 11 12 9 10 11 9 11 10 10 10 9 9 10 11 10 11 12 12 10 12 11 11 10 10 ERI-3 DCW 4.01 (g/L) ERI-26 DCW 3.9 (g/L) 12 11 12 10 11 13 10 9 12 10 12 10 10 10 12 11 12 13 10 11 12 12 10 13 10 10 ERI-1 9 10 9 9 10 9 10 10 9 10 9 10 10 ERI-3 12 10 11 11 10 11 9 10 10 9 11 10 10 DCW 3.79 (g/L) ERI-26 DCW 4.0 (g/L) 10 9 11 10 10 9 11 12 9 10 10 10 9 ERI-1 DCW 1.27 (g/L) ERI-3 DCW 0.7 (g/L) ERI-26 DCW 0.86 (g/L) ERI-1 DCW 2.8 ERI-3 DCW 2.46 (g/L) ERI-26 DCW 2.1 (g/L) ERI-1 DCW 3.21 (g/L) DCW 96 Inhibition zones in mm E.c P.a K.p X.sp E.sp - B.s 9 3.02 (g/L) -; No activity, ERI- Entomology Research Institute, DCW- dry cell weight; B.s - B. subtilis; S.a- S. aureus; S.e- S. epidermidis; E.f E. faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f - V. fischeri; P.v - P. vulgaris. Results were analyzed in triplicates. bial activity after 24 h. At 48 and 72 h, it exhibited maximum cell growth as well as antibacterial activity (Tables 3 and 4). ERI-1, ERI-3 and ERI-26 did not exhibit activity at 20 and 45В°C. It was not suitable for growth also. 30В°C was found to be optimum temperature for antimicrobial metabolite production (Table 4). Effect of glucose concentration on growth and antimicrobial activity Different concentration of glucose on growth and antibacterial activity was studied (Table 6). For ERI-1, ERI-3 and ERI-26, the concentration of glucose from 6 to 12 g/L enhanced the cell growth and the antimicrobial compound production. Effect of different carbon sources on growth and antimicrobial activity Effect of different carbon source on growth and antimicrobial activity was analyzed. Optimization of antibacterial compound production was carried out in batch culture. Strains were able to grow in all the tested carbon sources (Table 5). However, ERI-1 and ERI-3 exhibited maximum antimicrobial activity in medium supplemented with glucose as a sole carbon source followed by starch and fructose. ERI-26 was able to utilize glucose for better growth and revealed maximum antibacterial activity. Effect of different nitrogen source on growth and antimicrobial activity The results of nitrogen source utilization are shown in Table 7. The higher growth and antibacterial activity were observed in ammonium nitrate as nitrogen source followed by sodium nitrate and potassium nitrate in case of ERI-1 and ERI-26. ERI-3 exhibited maximum growth and antibacterial activity by using sodium nitrate followed by ammonium nitrate. Arasu et al. 755 Table 4. Effect of incubation temperature on growth and production of antimicrobial metabolites. Temperature 20В°C 30В°C 37В°C 45В°C Strain ERI-1 ERI-3 ERI-26 ERI-1 ERI-3 ERI-26 ERI-1 ERI-3 ERI-26 ERI-1 ERI-3 ERI-26 B.s 10 11 9 10 9 9 10 - S.a 11 9 11 10 10 11 11 - S.e 11 11 12 9 10 10 - E.f 14 13 10 11 9 9 - Inhibition zones in mm E.c P.a K.p X.sp E.sp 10 12 10 11 10 10 13 11 12 10 9 10 10 10 11 9 11 10 9 9 9 9 9 9 9 10 10 10 - S.t 10 10 11 9 10 - V.f 10 10 11 10 10 - P.v 11 10 10 11 9 - C.a 10 12 11 9 10 9 - -: No activity, ERI- Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus; S.e- S. epidermidis; E.f- E. faecalis; E.c- E. coli; P.a- P. aeruginosa; K.p- K. pneumoniae; X.sp- Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri; P.v- P. vulgaris.Results were analyzed in triplicates. Table 5. Effect of different carbon sources on growth and antimicrobial activity against S. epidermidis. ERI-1 ERI-3 ERI-26 Carbon Dry cell weight Antimicrobial activity Dry cell weight Antimicrobial activity Dry cell weight Antimicrobial activity source (g/L) (mm) (g/L) (mm) (g/L) (mm) Glucose 2.9 23 3.1 20 3 23 Starch 1.7 20 1.5 18 1.7 17 Sucrose 1.8 17 1.7 15 2 16 Starch 1.5 20 1.4 15 1.8 16 Maltose 2.7 18 2.9 17 2.5 18 Fructose 2.8 20 2.7 19 2.9 19 Mannitol 0.8 15 0.4 15 0.5 16 Mannose 1.7 15 1.5 15 1.8 15 Xylose 0.6 0 0.7 13 0.4 Glycerol 2.4 18 2.7 16 2.9 16 Results were analyzed in triplicates. Table 6. Effect of different glucose concentration on growth and antimicrobial activity (against S. epidermidis). ERI-1 ERI-3 ERI-26 Glucose concentration Dry cell Antimicrobial activity Dry cell Antimicrobial activity Dry cell Antimicrobial activity (g/L) weight (g/L) (mm) weight (g/L) (mm) weight (g/L) (mm) 2 0.72 0.45 0.91 12 4 1.25 0.93 1.43 12 6 2.37 14 1.73 16 2.30 15 8 3.11 17 2.54 17 3.10 17 10 3.73 17 3.1 19 3.80 20 12 3.68 22 3.04 19 3.90 22 14 3.24 22 2.73 18 2.40 22 16 2.43 20 2.64 18 2.34 22 18 1.40 20 1.56 14 2.10 18 20 0.91 18 1.24 14 2.03 18 Results were analyzed in triplicates. 756 Afr. J. Microbiol. Res. Table 7. Effect of different nitrogen sources on growth and antimicrobial activity (against S. epidermidis). Nitrogen source Ammonium nitrate Ammonium sulphate Ammonium citrate Sodium nitrate Potassium nitrate Dry cell weight (g/L) 2.78 0.87 1.04 2.45 2.40 ERI-1 Antimicrobial activity (mm) 21 14 15 20 19 Dry cell weight (g/L) 2.42 1.27 0.73 2.75 2.35 ERI-3 Antimicrobial activity (mm) 17 15 12 22 17 ERI-26 Dry cell Antimicrobial activity weight (g/L) (mm) 2.40 17 1.70 15 0.64 1.92 15 2.29 15 Results were analyzed in triplicates. Table 8. Effect sodium chloride concentration on growth and antimicrobial activity (against S. epidermidis). ERI-1 Sodium chloride concentration Dry cell weight Antimicrobial (g/L) (g/L) activity (mm) 4 1.85 17 8 3.21 18 12 4.68 23 16 3.43 20 20 1.91 18 ERI-3 Dry cell Antimicrobial weight (g/L) activity (mm) 1.93 18 2.84 18 3.64 24 2.94 20 1.54 19 ERI-26 Dry cell Antimicrobial weight (g/L) activity (mm) 1.93 18 3.71 21 3.53 22 2.14 22 1.33 21 Results were analyzed in triplicates. Effect of sodium chloride on growth and antimicrobial activity Effect of different concentration of sodium chloride on growth and antibacterial activity was studied. Increase in concentration of sodium chloride in the medium influenced the growth and antimicrobial compound production (Table 8). A concentration of 12 g/L was good for growth as well as antimicrobial activity for the strains. There was a decline in growth and antimicrobial activity after 20 g/L. Optimized media on antimicrobial activity Optimized media showed good activity as compared to normal fermentation media. Secondary metabolites from strain ERI-1 showed good antimicrobial activity in optimized media (M-4 media containing 12 g/L glucose, 1.2 g/L ammonium nitrate, 12 g/L sodium chloride, pH 7.0, temperature 30В°C and incubation time 72 h). It was 1.5 times more than the normal media (Table 9). ERI-3 cultivated in M-8 media containing 12 g/L glucose, 1.2 g/L sodium nitrate, 12 g/L sodium chloride, pH 7.5, temperature 30В°C and incubation time 72 h revealed good production of antimicrobial metabolite in the broth. M-4 media components with 12 g/L of glucose, 1.2 g/L ammonium nitrate, 12 g/L sodium chloride, pH 7.0, temperature 30В°C and incubation time 72 h influenced ERI-26 for better production of antimicrobial metabolites. Effect of fermentation media on antifungal activity Fermentation media were also checked against fungal pathogens. It was observed that strain ERI-26 greatly suppressed the growth of all the chosen fungal strains as compared to strain ERI-1 and ERI-3 (Table 9). Among all the fungi, A. niger and C. lunata showed significant inhibition. DISCUSSION Cultivation of different complex media signalized the ability for secondary metabolite production and the influence of inoculum stage conditions. Arasu et al. (2008) reported that antagonistic properties are largely influenced by the quality of the medium. Eight different fermentation media were used for the selection of best antimicrobial metabolite production. Medium-4 (modified nutrient glucose agar media) was chosen as the best base for the production and antimicrobial metabolite production for ERI-1 and ERI-26. ERI-3 cultured in M-8 was the best source for antimicrobial metabolite production. Our results indicated that MNGA was the good base for antimicrobial metabolite production; however Augustine et al. (2005) reported that starch casein medium was found to be good base for antifungal metabolite production. Optimizations of fermentation conditions are necessary to improve secondary metabolite formation. Dissolved oxygen tension was identified to influence the productivity Arasu et al. 757 Table 9. Antimicrobial activity of optimized fermentation medium. Strain ERI-1 ERI-3 ERI-26 B.s 22 22 21 S.a 18 20 23 Antibacterial activity (Inhibition zones in mm) S.e E.f E.c P.a K.p X.sp E.sp 18 19 15 16 23 18 15 21 12 11 10 12 15 10 20 15 13 12 10 11 11 S.t 15 12 11 V.f 15 10 10 P.v 10 13 11 T.m 15 Anfungal activity (Inhibition zones in mm) E.f T.s C.l A.n B.c T.r 296 T.r 57 15 10 20 25 10 15 18 Scro 10 C.a 18 - ; No activity, ERI- Entomology Research Institute. B.s- B. subtilis; S.a- S. aureus ; S.e- S. epidermidis; E.f- E. faecalis; E.c - E. coli; P.a- P. aeruginosa; K.p - K. pneumoniae; X.sp - Xanthomonas sp.; E.sp- Erwinia; S.t- S. typhi; V.f- V. fischeri; P.v- P. Vulgaris; T.m- T. mentographytes; E.f- Epidermophyton floccosum; T.s- T. simii; C.l- Curvularia lunata; A.n- Aspergillus niger; B.c- Botrytis cinerea; T.rTrichophyton rubrum; Scro- Scropulariopsis sp.; C.a- Candida albicans. Results were analyzed in triplicates. Among the fungus, only Candida albicans was used in the initial antimicrobial screening such as effect of different medium, different temperature, different pH and different incubation time, respectively. of several processes concerning bioactive compound (Ya-Jie et al., 2009). Possibility to enlarge secondary metabolite formation with high oxygen levels is a strong dependency of oxygen with the enzymatic reactions of product formation. Kim et al. (2000) reported a 7-fold enhancement of kasugamycin production by pH shock in batch culture of Streptomyces kasugaensis. It is well known that environmental signals, including pH shock, can stimulate and promote the biosynthesis of secondary metabolites. Kim et al. (2007) reported that when the pH was maintained at 5, production of geldanamycin was increased from 414 to 768 mg/L. Nadia et al. (2004) studied the effects of temperature, pH, incubation period, some media and different nitrogen and carbon sources for the production of antimicrobial metabolite production. Temperature of 35В°C and pH 8 were the best for growth and antimicrobial agent production and 14 to 15 days of incubation was found to be the best for maximum growth and antimicrobial activity, respectively, in the medium BG-11. We found that medium with glucose and fructose showed maximum antimicrobial metabolite production and cell growth. Ammonium nitrate and sodium nitrate were found to be the best nitrogen source for the antimicrobial metabolite production. They influence the growth, as well as the antimicrobial metabolite production of the actinomycetes strains. Nadia et al. (2004) reported that leucine was the best nitrogen source for antimicrobial activity, while maximum antimicrobial activity was introduced by using the carbon sources, citrate and acetate. Our results indicated that more antimicrobial activity was found when the carbon source is glucose in combination with the nitrogen source ammonium nitrate. The effects of nitrogen sources on streptolydigin production and distribution of secondary metabolites from Streptomyces lydicus were investigated in shake flask level (Liangzhi et al., 2007). When soybean meal was used as the source of nitrogen, three analogues of streptolydigin were detected. Among the nitrogen sources glutamic acid was most favorable for the formation of streptolydigin (Liangzhi et al., 2007). ERI-1, ERI-3 and ERI-26 were able to grow in all the tested carbon sources. However maximum growth and antimicrobial activity was obtained in medium supplemented with glucose followed by fructose. Fermentation medium supplemented with glucose enhanced the growth and antimicrobial metabolite synthesis. The highest activity was obtained in media containing ammonium nitrate as a nitrogen source, followed by sodium nitrate and potassium nitrate. Strains cultivated at 30В°C were optimum for good growth and antimicrobial metabolite production. The results also indicated an incubation time of 96 h as optimal. Cruz et al. (1999) reported that the production of antibiotic by S. griseocarneus was increased by glucose. Gupte and Kulkarni reported that three independent variables, namely concentration of carbon source (glucose), nitrogen source (soybean meal) and temperature of incubation, were found to be the most important for the production of antimicrobial metabolites (Gupte and Kulkarni, 2000). In general, Streptomyces sp. grew best in media containing carbon and nitrogen sources, including chitin, starch, glycerol, arginin, asparagine, casein and nitrate (Locci, 1989). Results of the present work indicated that the selected actinomycetes possess antibacterial and antifungal properties in liquid broth. This explains that the antimicrobial metabolites are extra cellular in nature. Conditions such as pH, temperature and incubation period were optimized. Best me-dium for growth and antimicrobial metabolite production were selected on the basis of antimicrobial activity. Modified nutrient medium with glucose as a carbon source was found to be good base for fermentation. Best nitrogen source was selected based on the growth and antimicrobial activity. From 758 Afr. J. Microbiol. Res. the present investigations, it was clear that ERI-1, ERI-3 and ERI-26 were found to produce extra cellular antimicrobial metabolites. ACKNOWLEDGEMENTS We thank "Cooperative Research Program for Agriculture Science and Technology Development (Project No. PJ008502)" Rural Development Administration, Republic of Korea. The authors extend gratitude to The Director, Entomology Research Institute, Loyola College, Chennai. Authors are thankful to Addiriyah Chair for Environmental Studies, Department of Botany and Microbiology, College of Science, King Saud University, Saudi Arabia for financial assistance. REFERENCES Arasu MV, Al-Dhabi NA, Saritha V, Duraipandiyan V, Muthukumar C, Kim SJ (2013). Antifeedant, larvicidal and growth inhibitory bioactivities of novel polyketide metabolite isolated from Streptomyces sp. AP-123 against Helicoverpa armigera and Spodoptera litura BMC Microbiol. 13:105. Arasu MV, DuraipandiyanV, Agastian P, Ignacimuthu S (2008). Antimicrobial activity of Streptomyces spp. ERI-26 recovered from Western Ghats of Tamil Nadu. J. Med. Mycol. 18:147-153. Arasu MV, Duraipandiyan V, Agastian P, Ignacimuthu S (2009). In vitro antimicrobial activity of Streptomyces spp. ERI-3 isolated from Western Ghats rock soil (India). J. Med. Mycol. 19: 22-28. Arasu MV, Ignacimuthu S, Agastian P (2012). Actinomycetes from Western Ghats of Tamil Nadu with its antimicrobial properties. Asian Pac. J. Trop. Med. S830-S837. Augustine SK, Bhavsar OSP, Kapadnis BP (2005). Production of a growth dependent metabolite active against dermatophytes by Streptomyces rochei AK 39. Ind. J. Med. Res. 121:164-170. Cruz R, Arias ME, Soliveri J (1999). Nutritional requirements for the production of pyrazoloisoquinolinone antibiotics by Streptomyces griseocarneus NCIMB 40447. Appl. Microbiol. Biotechnol. 53:115-119. Demain AL (2006). From natural products discovery to commercialization: a success story. J. Ind. Microbiol. Biotechnol. 33:486-495. Gupte MD, Kulkarni PR (2002). A study of antifungal antibiotic production by Streptomyces chattanoogensis MTCC 3423 using full factorial design. Lett. Appl. Microbiol. 35:220-226. Kim CJ, Chang YK, Chun GT (2000). Enhancement of kasugamycin production by pH shock in batch cultures of Streptomyces kasugaensis. Biotech. Prog. 16:548-552. Kim YJ, Song JY, Moon MH, Smith CP, Hong SK, Chang YK (2007). pH shock induces overexpression of regulatory and biosynthetic genes for actinorhodin production in Streptomyces coelicolor A3(2). Appl. Microbiol. Biotechnol. 76:1119-1130. Lauren BP, Yi T, Yit-Heng C (2011). Metabolic engineering for the production of natural products. Annu. Rev. Chem. Biomol. 2:211236. Lazzarini A, Cavaletti L, Toppo G, Marinelli F (2000). Rare genera of actinomycetes as potential producers of new antibiotics. Antonie van Leeuwenhoek 78:399-405. Liangzhi LI, Bin Q, Yingjin Y (2007). Nitrogen sources affect streptolydigin production and related secondary metabolites distribution of Streptomyces lydicus. Chin. J. Chem. Eng. 15:403-410. Locci R (1989). Streptomyces and related genera. In: Stanley T. Williams, M. Elizabeth. Sharpe, and John Holt, editors. Bergey’s manual of systematic bacteriology. Baltimore: Williams Co. Mohd HI, Hawa ZEJ (2012). Primary, secondary metabolites, H2O2, malondialdehyde and photosynthetic responses of Orthosiphon stimaneus Benth. to different irradiance levels. Molecules 17:1159-1176. Nadia HN, Abdel FM, Khaleafa SHZ (2004). Factors affecting antimicrobial activity of Synechococcus leopoliensis. Microbiol. Res. 159:395-402. Valanarasu M, Kannan P, Ezhilvendan S, Ganesan G, Ignacimuthu S, Agastian P (2010). Antifungal and antifeedant activities of extracellular product of Streptomyces spp. ERI-04 isolated from Western Ghats of Tamil Nadu. J. Med. Mycol. 20:290-297 Vilella D, SГЎnchez M, Platas G, Salazar O, Genilloud O, Royo I, Cascales C, MartГn I, DГez T, Silverman KC, Lingham RB, Singh SB, Jayasuriya H, PelГЎez F (2000). Inhibitors of farnesylation of ras from a natural products screening program. J. Ind. Microbiol. Biotechnol. 25:315-327. Wildmans H (1997). Potential of tropical microfungi within the pharmaceutical industry. In: Hyde KD, editor. Biodiversity of tropical microfungi. Hong Kong: Hong Kong University Press; pp. 29-46. Ya-Jie T, Wei Z, Jian-Jiang Z (2009). Performance analyses of a pH-shift and DOT-shift integrated fed-batch fermentation process for the production of ganoderic acid and Ganoderma polysaccharides by medicinal mushroom Ganoderma lucidum. Bioresour Technol 100: 1852–1859. Vol. 8(8), pp. 759-765, 19 February, 2014 DOI: 10.5897/AJMR12.2078 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper Incidence of Aspergillus contamination of groundnut (Arachis hypogaea L.) in Eastern Ethiopia Abdi Mohammed1 and Alemayehu Chala2* 1 Bule Hora University, P. O. Box 144, Bule Hora, Ethiopia. 2 Hawassa University, P. O. Box 05, Hawassa, Ethiopia. Accepted 23 January, 2014 The production of groundnut is constrained by several factors, among which is Aspergillus spp. In addition to causing quantitative losses, Aspergillus spp. produce highly toxic and carcinogenic chemical substances known as aflatoxins. This study was conducted with the objectives to (i) identify Aspergillus species associated with groundnuts, (ii) determine the frequency of seed contamination, and (iii) survey agro-ecological conditions related to groundnut contamination by Aspergillus spp. About 270 groundnut samples were collected from farmers’ storage, fields and local markets of three districts that is, Babile, Darolabu and Gursum of Eastern Ethiopia for mycological analysis in the year 2010. Results of the mycological analysis suggested heavy infestation of groundnut samples by various molds including Aspergillus niger, Aspergillus flavus, Aspergillus ochraceus, Aspergillus parasiticus and Pencillium species. At the district level, the incidence of infected groundnut kernels ranged from 50 to 80%. Within the district kernel infection varied between 36.3 and 100%. The common Aspergillus symptoms (yellowing or chlorotic leaves, wilting, drying and brown or black mass covered by yellow or greenish spores) were also observed in groundnut fields. The current results were consistent with our earlier report of heavy aflatoxin contamination of groundnut from the same places, suggesting the urgent need to apply control measures against toxigenic fungi and associated mycotoxins. Key words: Aspergillus spp., groundnut, Penicillium spp., Ethiopia. INTRODUCTION Groundnut (Arachis hypogaea L.) is an important food and feed crop, which also serve as component of crop rotation in many countries (Pande et al., 2003; Upadhyaya et al., 2006). Groundnuts are also significant source of cash in developing countries that contribute significantly to food security and alleviate poverty (Smart et al., 1990). Developing countries account for 97% of the world’s groundnut area and 94% of the total production (FAOSTAT, 2010). However, groundnut yield in this part of the world and particularly in Africa is lower than the world average due to prevailing abiotic, biotic and socioeconomic factors (Pande et al., 2003; Upadhyaya et al., 2006; Caliskan et al., 2008). In warm climates grains are easily infected with toxige- nic microorganisms like Aspergillus species. Aspergillus spp. are facultative parasites. They invade host plant tissues directly or attack tissues that have been predisposed by environmental stresses such as dry weather or damages caused by insects, nematodes, natural cracking, and harvest equipment (Pettit and Taber, 1968). They are distributed worldwide, mainly in countries with tropical climates that have extreme ranges of rainfall, temperature and humidity (Pettit and Taber, 1968). Many strains of this fungus are capable of producing aflatoxins that render the seed unacceptable due to high toxicity for human or animal consumption (Reddy et al., 1996). Aflatoxins are highly toxic metabolites associated with Reye’s syndrome, Kwashiorkor and acute hepatitis *Corresponding author E-mail: [email protected]. Tel: +251 912 163096. Fax: +251 46 2206517. 760 Afr. J. Microbiol. Res. (Wild and Hall, 1999; Wild and Turner, 2002). The Eastern lowland areas of Ethiopia have considerable potential for increased oil crop production including groundnut. Particularly areas such as Babile, Darolabu and Gursum are the major producers of groundnuts for local and commercial consumption (Getnet and Nugussie, 1991; Chala et al., 2012). Nevertheless, the area may also be very conducive for toxigenic fungi like Aspergillus spp. owing to its warm and dry climate. Moreover, farmers’ practices of production and handling of groundnut at pre- and pos-harvest stages may provide favorable conditions for outbreaks of fungi and their mycotoxins. As Chala et al. (2012) reported, groundnut from East Ethiopia is heavily contaminated by aflatoxins at levels much more than international standards, and this might be associated with infection of the crop with Apsergillus spp., mainly A. falvus and A. parasiticus that are known producers of aflatoxins. However, up to date information on the prevalence of fungi, and studies on environmental factors and farmers’ practices that promote fungal contamination, which could be basis for the reduction of mycotoxins are limited under Ethiopian conditions. On the other hand, such studies are of paramount importance to give valid recommendations for safe consumption and marketing of groundnut. The objectives of this study were to: i) identify Aspergillus species associated with groundnut in East Ethiopia, ii) determine the frequency of seed contamination, and iii) survey agro-ecological conditions related to contamination of groundnut by Aspergillus spp. MATERIALS AND METHODS Surveys of groundnut and sample collection Groundnut samples were collected from three districts (Babile, Darolabu and Gursum) of Eastern Ethiopia in the year 2010. The samples were collected in three groups that is, from farmers’ stores, fields and from local markets of selected locations of the three districts. Geographic description of survey locations are given in Table 1. In each district, five locations were chosen based on the groundnut productions potential. Six samples were collected from each location and hence 30 samples were collected per district making the total number of samples collected from all over the three districts 270 (3 districts Г— 5 locations per district Г— 6 samples per location Г— 3 sample groups per district). Data were also gathered on planting and harvesting dates of the crop, the variety, soil type, previous crop, and types of cultural practices. The common methods of storage structures, drying materials and grain moistures were observed. Fungal isolation, species identification Fungal isolation Fifty groundnut seeds per sample were surface sterilized with 10% Chlorox solution for 1 min, followed by immersion in sterile distilled water for 1 min. Surface sterilized seeds were then placed on freshly prepared potato dextrose agar (PDA) plates (five seeds per plate) and incubated for three days at 25В°C. Pure cultures of different out growing fungi were obtained by transferring fungal colonies to new PDA plates using sterile toothpicks, and incubating the plates for 5-7 days at 25В°C. Pure cultures of each isolate were then stored at 4В°C in vials containing 2.5 ml of sterile distilled water for further use. Species identification Isolates were identified to a species level based on morphological (phenotypic) features as described by Cotty (1994), Egel et al. (1994), Kurtzman et al. (1997), and Okuda et al. (2000). For this purpose: Isolates representing each pure culture were grown on Czapek Dox Agar (CZDA) and PDA at 25В°C for 5-7 days. Fungal colonies that grew rapidly and produced colors of white, yellow, yellow-brown, brown to black or shades of green, mostly consisting of a dense felt of erect conidiophores were broadly classified as Aspergillus spp. while those that produce blue spores were considered as Pencillium spp. (Okuda et al., 2000). Isolates with dark green colonies and rough conidia were considered A. parasiticus (Klich, 2002). The major distinction currently separating A. niger from the other species of Aspergillus is the production of carbon black or very dark brown spores from biseriate phialides (Raper and Fennell, 1965). Those that showed brown colony with orange and cream reverse sides were considered A. sojae and A. oryzae, respectively (Cotty, 1994). Those, which produce conidia with smooth surface on CZDA and colonies typical of A. flavus were recorded as A. flavus. Data analysis Data on frequencies of kernel infection by Aspergillus and Penicillium species for samples collected from different locations of the districts were subjected to analysis of variance (ANOVA) using the SAS computer package, version 9.11 (SAS, 2003). LSD test at the 0.05 probability level was used for mean comparison. RESULTS AND DISCUSSION Identification of Aspergillus species associated with groundnut Four different Aspergillus spp. were found to be associated with groundnut samples collected from Eastern Ethiopia (Figure 1). The first species isolated from the collected samples was A. niger. The major distinction currently separating A. niger from the other species of Aspergillus is the production of carbon black or dark brown spores of biseriate phialides (Raper and Fennell, 1965). The current study also confirmed the production of black or brown-black or black conidia by this species (Figure 1). A. flavus was the second species identified in this study. Colonies of this fungus were characterized by yellow to dark, yellowish-green pigments, consisting of a dense felt of conidiophores or mature vesicles bearing phialides over their entire surface (Gourama and Bullerman, 1995). In general, A. flavus was known as a velvety, yellow to green or the old colony was brown mould with a goldish to red-brown on the reverse. The conidiophores were variable in length; walls of A. flavus conidia were smooth to finely roughened or moderately roughened, pitted and spiny. These observations were consistent with the findings of Gourama and Bullerman (1995), who reported A. flavus colonies as being initially Mohammed and Chala 761 Table 1. Geographic description of locations included in the survey. District Location Ausharif Shekabdi Shekusman Ifa Bishan Babile Latitude 0 09 11’933” 0 09 12”890” 0 09 12’89” 0 09 17’762” 09015’872” Longitudes 0 042 13’080” 042013’65” 0 042 13’105” 042017’161” 042018’049” Altitude (m) 1733 1437 1784 1500 1500 Darolabu Sakina Gadulo Odalaku Sororo Haroadi 08035’023” 0 08 26’078” 08035’067” 08035’036” 08034’954” 040020’388” 0 040 15’732” 040019’842” 040019844” 040020’280” 2100 1400 1760 1608 1788 Gursum Audal Ilalam Kassa oromiya Oda oromiya Harobate 09 37’297” 0 09 37’268” 09037’282” 09037’273” 09037’298” Babile A. niger A. ochraceus A. niger A. ochraceus 0 A. flavus A. parasiticus Figure 1. Aspergillus spp. isolated from groundnut samples. Figure 2. Symptoms of Aspergillus infection on groundnut. yellow, turning to yellow-green or olive green with age and appearing dark green with smooth shape and some having radial wrinkles. The third species identified in the current work, A. ochraceoroseus, produced yellow-gold conidia (Bartoli and Maggi, 1978). The A. ochraceus was characterized particularly by its pale yellow conidial heads, orange-red conidiophores with coarsely roughened walls, light 0 042 43’951” 0 042 43’758” 042043’610” 042043’633” 042043’832” 1792 1838 1650 1732 1550 colored sclerotia, and salmon-pink mycelial turf on the reverse side of CZDA. Colonies of this species also produced near white to light yellow pigment and were dull yellow to dark yellow or sometimes brown on the reverse. A. parasiticus was the fourth species isolated from groundnut samples tested in the current study. Colonies representing this species produced dark green and rough conidia on CZDA at 25 and 37В°C after 5-7 days of incubation. Similar study by Peterson et al. (2001) distinguished A. parasiticus from A. bombycis by its typically dark green color on CZDA. Groundnut plants infected by Aspergillus spp. showed typical symptoms of infection as shown in (Figure 2). These include yellowing of leaves or chlorosis and premature death and dropping of leaves, wilting, drying single plant and patching or drying of localized areas within the fields. Underground grains were rotten and distorted, and the plants were pulled out of the ground easily. On some dried plants, brown or black mass covered by yellow or greenish spores were observed in infected fields. A study by Subrahmanyam and Ravindranath (1988) stated the presence of shriveled and dried grains covered by yellow or green spores, when groundnut plants are infected by A. flavus (Aflaroot or yellow mold). The same study reported highly stunted seedlings; reduced leaf size with pale to light green; crown rot or collar rot, with germinating seeds covered with masses of black conidia; and rapid drying of plants due to infection of groundnut by Aspergillus spp. Frequency of kernel contamination Proportion of kernel contamination by Aspergillus spp. varied from 50% at Babile market to about 80% at farmers’ 762 Afr. J. Microbiol. Res. Figure 3. Proportion of groundnut kernels infected with Aspergillus spp. in East Ethiopia (N= 150 seeds/samples). fields in Gursum district and storage houses in the district of Darolabu (Figure 3). Groundnut samples collected from storage houses in the districts of Gursum and Babile, and farmers’ fields at Babile had the second highest kernel contamination (70%). When samples were analyzed at the location level (within district), kernel contamination varied significantly (p<0.05) from 36% at Bishan Babile market (Babile district) to 100% in farmers’ fields of Harobate (Gursum district) (Table 2). Samples from stores in Bishan Babile and Shekabdi kebeles (Babile district), stores in Sororo location of Darolabu district, farmers’ field in Kasa Oromiya of Gursum district were infected at a proportion of 93%. In addition, groundnut samples collected from farmers’ fields in Ausharif and Shekabdi location of Babile district, stores of Sakina and Odalaku (Darolabu district), and stores of Audal and Harobate in Gursum district were found to be contaminated at a rate of 90%. On the other hand, samples from markets at Shekusman location (Babile district), Sororo of Darolabu district and Oda Oromiya (Gursum district) had only 43% kernel infection. Generally, the current results suggest heavy contamination of groundnut kernels with Aspergillus spp. Groundnut samples collected from markets had the lowest level of Aspergillus infection compared to samples from farmers’ fields and stores across the survey districts and locations. This may suggest possible sorting of kernels by farmers to avoid those with visible symptoms of infection (discoloration) before bringing the samples to the local markets. The results were in agreement with the study by Pitt and Hocking (2009) in which Aspergillus spp. were more prevalent in the field and stored foods than in the markets. The frequency of Aspergillus isolated from the groundnut samples analyzed in the current study is presented in Table 3. Of the several species isolated from the ground- nut samples, A. niger and A. flavus were the most prevalent mycotoxigenic fungi across the storage, field and market samples in East Ethiopia. These two species were isolated at a rate of 21-48% (A. flavus) and 35-66% (A. niger). On the other hand, A. ochraceus accounted for 0-14%, while A. parasiticus was associated with 2-21% of kernel infection. Pencillium spp. were also isolated from 6-13% of samples analyzed (data not shown). In another experiment, Eshetu (2010) reported the most frequent occurrence of Aspergillus spp. (A. flavus, A. niger and other Aspergilli) in wet shelled one year stored peanut sample from Gursum district of Hararghe region in East Ethiopia. In this study; A. flavus and A. niger were isolated at higher frequencies from samples collected from farmers’ fields and stores than markets while A. parasiticus was consistently isolated at higher frequencies from market samples. In contrast to these, isolation frequency of A. ochraceus was not consistently high or low in any of the sample collection sites (fields, markets and stores) across the survey districts. The current results were consistent with Chala et al. (2012), who detected 5-11,900 Вµg/kg total aflatoxin from same samples suggesting heavy groundnut contamination by Aspergillus spp. and associated aflatoxins in the region. Aspergillus flavus and aflatoxins contamination was also prevalent in stored groundnuts in Ghana (Awuah and Kpodo, 1996). Abdela (2009) also reported contamination of groundnut samples from Sudan by A. niger and A. flavus, which were isolated at frequencies of 29-60% for A. niger and 4-52% for A. flavus. Fusarium oxysporum, A. niger, R. bataticola and S. rolfisii were the predominant species of fungi associated with diseased plants indicating the involvement of these fungi in pre- and post- emergence death of groundnut plants in Babile district (Tefera and Tana, 2002). Mohammed and Chala 763 Table 2. Proportion of groundnut seeds infected by Aspergillus spp. in different districts of East Ethiopia. District Location Babile Ausharif Shekusman Shekabdi Ifa Bishan babile LSD (0.05) CV (%) Percent kernel infection Store Field Market c a bc 50 90 53.3 b b cd 70 63 43.3 a a a 93.3 90 70 b b 66.7 63 56b a b 93.3 70 36.3cd 12 11 21.8 14 13 20 Darolabu Sakina Gadulo Odalaku Sororo Haroadi LSD (0.05) CV (%) 90a b 73.3 a 90 a 93 66.7b 12 12 70b b 53.3 56.7b b 53.3 a 76 11 15 56.7ab a 66.7 66.7a c 43 46.7bc 11 17 Gursum Audal Ilalam Kasa Oromiya Oda Oromiya Harobate LSD (0.05) CV (%) 90a 56.7c 63.3b 73.3b 90a 13.4 15 73.3b 70b 93.3a 66.7b 100a 11 11 56.7c 66ab 65bc 43.3cd 46.7cd 7 12 Means in a column followed by the same letter are not significantly different according to LCD at p<0.05. Table 3. Frequency of Aspergillus species isolated from groundnut seeds collected from three districts in East Ethiopia. Percent kernel contamination Store Field Market 20.5 29 26.25 66 47.8 38.75 3.6 14 21.25 9.8 9.7 13.75 District Fungal specie Babile A. flavus A. niger A. parasiticus A. ochraceus Darolabu A. flavus A. niger A. parasiticus A. ochraceus 31 56 4 9 32.6 53.6 2.1 10.5 33.7 41 10.8 8.7 Gursum A. flavus A. niger A. parasiticus A. ochraceus 48.2 34.82 4.46 9.82 41 40.5 10.74 7.43 34.5 39 14.3 0 Description of local groundnut varieties around selected areas Description of groundnut varieties in around Babile and Gursum districts are different from that of Darolabu districts. Their naming was based on the morphology standing from the ground and leaf shape, size, color and seed size. Around Babile and Gursum districts, the common 764 Afr. J. Microbiol. Res. local groundnut varieties were “Oldhale”, “Sartu”, and “Jawsi” (Data from Agricultural and Rural Develop-ment Bureaus of the distritcs). Another similar study re-ported that predominant groundnut local variety (Oldhale) was commonly produced by farmers around Babile district (Tefera and Tana, 2002). The shape and leaf size of these three varieties were different from each other. Two groundnut varieties that is, “Basuqa”and “Qacine” are found to grow commonly around Darolabu district. They are identified based on the plant morphology and seed size. The “Basuqa” variety has larger seeds and leaves than “Qacine”. It gives higer yield than “Qacine”. But it is more susceptible to diseases and drought as revealed by the Agricultural and Rural Development Bureau of the district. Factors associated with Aspergillus spp. contamination of groundnuts in the study areas Cultural practices Across the study areas, the groundnut shell is removed and left in farms, on the roads or water furrows then irrigation water takes it to the farms and gardens. Such a scenario generally favors over seasoning of plant pathogens including Aspergillus for subsequent contamination of the next crops. Besides, groundnut in the survey districts is cultivated either as a sole crop or intercropped with different crops like sorghum (Sorghum bicolor), maize (Zea mays), haricot bean (Phaseolus vulgaris), and under the shade of chat (Khata edulis), coffee (Coffea arabica) and mango (Mangifera indica) trees. Although intercropping is generally known to decrease disease pressure in agricultural fields, the companion crops in groundnut fields may not be very effective against Aspergillus spp. Mechanical damages caused during pulling and digging out groundnuts may also have predisposed kernels to infection by Aspergillus and associated aflatoxins. Seeds in split pods are frequently invaded by A. flavus and subsequently become contaminated with aflatoxin as suggested by (Graham, 1982). Shriveled kernels contain higher amounts of aflatoxin as a result of higher A. flavus infection (Hill et al., 1984). Other factors, which may aid the contamination of groundnut with Aspergillus and then aflatoxins might be exchanging of equipment or plowing materials and groundnut seeds between households. Time of planting and harvesting of groundnuts Rain fall is usually unpredictable at the time of planting and harvesting around the study areas. The planting time of groundnut around the study areas usually lasts from the beginning of April to the end of May, and the harvesting time is from the end of September to the first half of November according to the field conditions and availability of labor. However, pods may overstay in the field after optimum maturations due to lack of labor, which further increases Aspergillus infection. Drought stress during late stages of pod development favors inva-sion of groundnut by A. flavus and subsequent aflatoxin contamination. End of season drought was very critical as it affects grain filling and pod formation in groundnut (Hill et al., 1984). Drying method of groundnut around the study areas Groundnut crops harvested in the survey districts are usually sun dried on materials such as matting. Curing of groundnut was done for few days in the farms before drying and removing of the seed from the hulms, to remove some moisture content from the kernels. In cases, where the moisture content of threshed unshelled and shelled pods was too high, the pods were sometimes bagged and every day the bags were brought out from the stores and left in the open. Although such practices may help reduce Aspergillus invasion, it would have been made more effective had it been coupled with fumigation with burning cow dung fumes and sun drying for one day as suggested by Gehewande et al. (1986). Traditional groundnut storage system Storage structures commonly found in the survey districts are made from mud and animal dung. In mud house there was no improved aerations in some stores and in some rain could percolate from the top and from the sides. Groundnuts in such houses are usually stored in sacks from the previous years, and this may also increase the contamination of groundnuts by Aspergillus and aflatoxins. Dickens et al. (1973) associated moisture condensation on roofs, improper application of insecticide sprays or leaking hoses and application equipment, conveyance of water from flooded elevator dump pits into warehouse, and storage of peanuts on concrete floors that are damp or have no vapor barriers with increased A. flavus growth. According to Bankole and Adebanjo (2003), traditional storage structures used for on farm storage include containers made of plant materials (woods, bamboo, and thratch). Conclusion Results of the current survey revealed heavy contamination of groundnuts by Aspegillus spp. Infection of kernels were higher in farmers’ store and farmers’ fields than markets with incidence of kernel infection at district level ranging from 36% at Babile market to 100% at Gursum field. A. niger and A. flavus were the most dominant species infecting groundnuts in East Ethiopia. In combination with our earlier report on aflatoxin contamination of groundnut from East Ethiopia, the current results should serve as a wakeup call to create aware- Mohammed and Chala ness on toxicogenic fungi and associated mycotoixns in the country. As aflatoxins are associated with health risks, reducing their level in food stuff to a level accepted by international standard is paramount importance to ensure the safety of these food stuff to consumers thereby facilitate trade both within and between countries. Five local groundnut varieties are found to grow in the survey districts. These are “Sartu”, “Oldhale”, “Jawsi”, “Basuka” and “Qacine”. Although these varieties vary in terms of morphological features and disease resistance, their resistance to Aspergillus and aflatoxins under differing environmental conditions is not established beyond ambiguity. Thus future work should also focus in testing varieties for Aspergillus resistance under different environmental conditions and management practices. This study has identified some important factors that may contribute for aflatoxin contamination of groundnuts both pre- and post-harvest. These include: weather conditions, seed and equipment sharing, planting time; harvesting time and methods; curing, drying and storage practices. The roles of additional factors that contribute to aflatoxin contamination down in the value chain need further investigation. In addition, the role of none chemical seeds treatments especially essential oils and that of biological control agents in reducing groundnut contamination should be studied to come up with a more effective and sustainable management strategy. Farmers’ association and extension agents should also be encouraged in creating awareness about aflatoxins and management techniques. ACKNOWLEDGEMENT We are grateful to the Drylands Coordination Group (DCG), Norway, for financial assistance. We also thank Drs. Dereje Gorfu, Ferdu Azerefegne and Yibrah Beyene for their valuable comments. REFERENCES Abdella MH (2009). Mycoflora of groundnut kernels from Sudan. Trans. Br. Mycol. Soci. 63: 353-359. Awuah RT, Kpodo KA (1996). High incidence of A. flavus and aflatoxins in stored groundnuts in Ghana and the use of microbial assay to assess the inhibitory effects of plant extracts on aflatoxin synthesis. Mycopathologia 134: 109-114. Bankole SA, Adebanjo OO (2003). Occurrence of aflatoxins and fumonisins in preharvest maize from south-western Nigeria. Food Add. Cont. 21: 251- 255. Bartoli A, Maggi O (1978). Four new species of Aspergillus from Ivory Coast soil. Trans. Br. Mycol. Soci. 71: 383-394. Caliskan S, Arslan M, Arioglu H (2008). Effects of sowing date and growth duration on growth and yield of groundnut in a Mediterraneantype environment in Turkey. Field Cro. Res. 105: 131-140. Chala A, Mohammed A, Ayalew A, Skinnes H (2012). Natural occurrence of aflatoxins in groundnut (Arachis hypogaea L.) from eastern Ethiopia. Food Control. In press. Cotty PJ (1994). Comparison of four groups for the isolation of A. flavus group fungi. Mycopathologia. 125: 157-162. 765 Dickens JW, Satterwhite JB, Sneed RE (1973). Aflatoxin-contaminated peanuts produced on North Carolina farms in 1968. J Am. Peanut Res. Edu. Assoc. 5: 48-58. Egel DS, Cotty PJ, Elias S (1994). Relationship among isolates of Aspergillus sect. flavi that vary in aflatoxin production. Phytopathology. 84: 906-912. Eshetu L (2010). Aflatoxin content of peanut (Arachis hypogaea L.) in relation to shelling and storage practice of Ethiopian farmers. M.Sc. Thesis. Addis Ababa University, Ethiopia. FAOSTAT (2010). Groundnut world production. http://www.faostat.fao.org. Gehewande MP, Nagaraj G, Jhala R (1986). Aflatoxin production and detoxification in groundnut. Proceedings of the national seminar on plant protection in field crops. 29-31 January 1986. Central plant protection training institute. Hydrabd. India. pp. 15-26. Getnet A, Nugussie A (1991). Production and research on oil seeds in Ethiopia. Proceedings of the first national oil seeds workshop in Ethiopia, 3-5 December. Institute of Agricultural Research. Addis Ababa, Ethiopia. p.312. Gourama H, Bullerman LB (1995). A. flavus and A. parasiticus: Aflatoxigenic fungi of concern in food and feeds. J. Food Prot. 58: 1395-1404. Graham J (1982). Aflatoxin in peanuts: Occurrence and control. Queens. Agri. J. 108: 119-122. Hill RA, Wilson DM, Burg WR, Shotwell OL (1984). Viable fungi in corn dust. App. Environ. Microbiol. 47: 84-87. Klich MA (2002). Identification of common Aspergillus species. Centraalbureau voor Shimmelcultures. Utrecht. The Netherlands. p.116. Kurtzman CP, Horn BW, Hesseltine CW (1997). Aspergillus nomius, a new aflatoxin-production species related to A. flavus and A. tamari. Ant. Van Lee. 53: 147-158. Okuda T, Klich MA, Seifert KA, Ando K (2000). Integration of modern taxonomic methods for Penicillium and Aspergillus Classification. In: Samson RA, Pitt JI Editors. Hardwood Academic Publishers: Reading, UK. pp 83-100. Pande N, Saxena J, Pandey H (2003). Natural occurrence of mycotoxins in some cereals. Mycoses. 33:126-128. Peterson SW, Ito Y, Horn BW, Goto T (2001). Aspergillus bombycis, a new aflatoxigenic species and genetic variation in its sibling species, A. nomius. Mycologia. 93: 689-703. Pettit RE, Taber RA (1968). Factors influencing aflatoxin accumulation in peanut kernels and the associated mycoflora. Appl. Microbiol. 16: 1230-1234. rd Pitt JI, Hocking AD (2009). Fungi and food spoilage (3 ed). Springer. pp. 520. Raper KB, Fennell DI (1965). The genus Aspergillus. Williams and Wilkins. Baltimore, Maryland. pp.686. Reddy LJ, Nigam SN, Moss JP, Singh AK, Subrahmanyam P, McDonald D, Reddy AGS (1996). Registration of ICGV86699 peanut germplasm line with multiple disease and insect resistance. Crop Science 36: 821. SAS Institute Inc (2003). SAS/STATA guide for personal computers version 9.1 edition. Carry: SAS Institute. Smart MG, Shotwell OL, Caldwell RW (1990). Pathogenesis in Aspergillus ear rot of maize: aflatoxin B1 levels in grains around wound inoculation sites. Phytopatology. 80: 1283-1286. Subrahmanyam P, Ravindranath V (1988). Fungal and nematode diseases. In: Reddy PS Editor: Groundnut. Indian Council of Agricultural Research. New Delhi. India. pp. 453-523. Tefera T, Tana T (2002). Agronomic performance of sorghum and groundnut cultivars in sole and intercrop cultivation under semiarid conditions. J Agron. and Crop Sci. 188: 212-218. Upadhyaya HD, Reddy LJ, Gowda CLL, Singh S (2006). Identification of diverse groundnut germplasm: Sources of early maturity in a core collection. Field Cro. Res. 97: 261-271. Wild CP, Hall AJ (1999). Hepatitis B virus and liver cancer: Unanswered questions. Can. Surv. 33: 35-54. Wild CP, Turner PC (2002). The toxicology of aflatoxins as basis for public health decisions. Mutagenesis. 17: 471-481. Vol. 8(8), pp. 766-775, 19 February, 2014 DOI: 10.5897/AJMR2013.6182 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper Microencapsulation, survival and adherence studies of indigenous probiotics Ammara Hassan1*, M. Nawaz Ch2 and Barbara Rasco3 1 Food and Biotechnology Research Centre, Pakistan Council of Scientific and Industrial Research, Lahore. Pakistan. 2 CEES, University of the Punjab, Lahore. Pakistan. 3 School of food Sciences, Washington State University, USA. Accepted 23 January, 2014 The aim of the study was to evaluate the adherence potential of indigenous probiotic bacteria and to improve the gastrointestinal survival of these cultures by adopting the double microencapsulation technique. The mean with standard deviation of triplicate experiments for the cell surface hydrophobicity, aggregation, and Cell adhesion evaluation of indigenous probiotics revealed that there was no significant difference in the hydrophobicity of both solvents (n- hexadecane and Xylene). A mixed trend was observed in the estimation for hydrophobicity; the indigenous Lactobacillus acidophilus was found with highest cell surface hydrophobicity (56.3%) and the lowest was found in Lactobacillus reuteri (28.1%). The Ca-alginate and prebiotics amalgum was used in double treatment and compared with control (free) and single encapsulated (Ca-alginate) cells in the stimulated gastric juice (SGJ) and stimulated intestinal juice (SIJ). The one-way analysis of variance (ANOVA) results show that the double microencapsulation technique has significant effects (P< 0.05) on the survival of bacterial cells during 6 weeks storage. A negligible reduction was found on day 42 in case of double microencapsulated cells as compared to significant adverse effects on the free cell. The loss was higher in single microencapsulated Lactobacillus plantarum and Lactobacillus paracasei and zero loss for Lactobacillus delbrueckii subsp. Bulgaricus. While a slight revival was observed in the free and single encapsulated bacteria in SIJ. Thus, combination of Ca-alginate and prebiotics significantly improves the viability and stress response of probiotics in the harsh GI conditions. Key words: Surface-hydrophobicity, aggregation, adhesion, double- microencapsulation, stimulated gastric Juice, stimulated intestinal juice, prebiotics, probiotics. INTRODUCTION Foods are no longer considered by consumers only in terms of taste and immediate nutritional needs, but also in terms of their ability to provide specific health benefits beyond their basic nutritional value. Currently, the largest segment of the functional food market is provided by the foods targeted towards improving the balance and activity of the intestinal microflora (Saarela et al., 2002). The nutritional effects due to the presence of probiotics in the *Corresponding author. E-mail: [email protected]. products led Ilya Metchnikoff towards Nobel Prize in 1908 (Vasiljevic and Shah, 2008). Probiotics are live microorganisms that benefit the health of the host, if consumed in adequate amount (Liaskovskii and Podgorskii, 2005). Mostly probiotic bacteria are incorporated in dairy products like milk, ice cream and yoghurt. The lactic acid producing probiotics keep the gut at a low pH, maintains the gut microflora and helps preserve the dairy products. Hassan et al. 767 They also combat the growth of harmful pathogens that cause foodborne illnesses (that is, diarrhea). The probiotics prevent the attachment of these pathogens by competing for similar binding sites on the gut epithelium (Parvez et al., 2006). But to deliver the health benefits, the probiotic bacteria need to be viable in the gut. The International Dairy Foundation (IDF) has recommended a 7 minimum number of 10 CFU per gram of the product consumed (Homayouni et al., 2008). However, the loss of viability can happen prior to consumption, during processsing procedures such as oxygen stress, freezing and drying or due to the harsh conditions in gastrointestinal (GI) tract such as high pH, bile salt and gastric acid secretion (ChГЎvarri et al., 2010). Therefore, providing a physical barrier to the probiotic living cells to resist adverse environmental conditions is therefore an approach currently receiving considerable interest (Kailasapathy, 2009). The microencapsulation techniques have resulted in greatly enhanced viability of these microorganisms in food products as well as in the gastrointestinal tract. In this process, active agents are entrapped within a carrier material. It is a useful tool to improve living cells into foods, to protect (Favaro-Trindade and Grosso, 2002; Liserre et al., 2007; Shima et al., 2009; Thantsha et al., 2009) and to extend their storage life and to convert them into a powder form for convenient use (O'riordan et al., 2001; Lian et al., 2003; Oliveira et al., 2007). In addition, microencapsulation can promote controlled release and optimize delivery to the site of action, thereby potentiating the efficacy of the respective probiotic strain. This process can also prevent these microorganisms from multiplying in food that would otherwise change their sensory characteristics. The investigations has revealed that the probiotic cell adhesion on the gut lining is considered as an important requirement for delivering health based benefits and the estimation of surface hydrophobicity is the best technique to determine this adherence and colonization potential (Kaushik et al., 2009). In this study, two materials of particular interest used as capsules were the Ca-alginate and prebiotics amalgum (containing galactooligosaccharides (GOS), mannooligosaccharide (MOS), and fructooligosaccharides (FOS)). Alginate is a natural polysaccharide of ОІ-Dmannuronic acid (M) and О±-L-guluronic acid (G), usually extracted from algae/seaweed and is currently the most widely used and studied material of microencapsulation (Chen and Walker, 2005). while Prebiotics are a group of carbohydrates made up of functional oligosaccharides which are non-digestible food substances that favour the growth of other bacteria (Liaskovskii and Podgorskii, 2005). The main objective of this research was to evaluate the adherence potential and survival of indigenous probiotic bacteria in gastrointestinal (GI) environment after microencapsulation. Cell aggregation was kept at 35В°C for 2 h after that 1.0 ml of the top suspension was taken to measure the absorbance (A final), and broth was used as reference (Del Re et al., 2000; TomГЎs et al., 2005). The estimation was performed in replicate. To calculate cellular autoaggregation index, the difference in percentage between the initial and final absorbance was recorded as follows: The freshly grown probiotic bacterial cells in MRS broth at 35В°C for 24 h were harvested (1) and the cell pellet washed with PBS and resuspended in PBS. An absorbance of ~0.5 at 600 nm (A initial) was taken. Then the suspension was centrifuged and the pellet was resuspended in equal volume of removed broth (in 1). The mixture MATERIALS AND METHODS In vitro adherence studies of indigenous probiotic strains Cell surface hydrophobicity To determine the probiotics adhesion to hydrocarbons the method of Rosenberg et al. (Rosenberg et al. 1980) and absorbance was taken at 600 nm and surface hydrophobicity (%) was calculated in replicates as percent decrease (О”AbsГ—100) in the absorbance of suspension (A Initial) and after phase separations (A final) as follows: Caco-2 Cells Adhesion Assay Preparation of cell suspension for microencapsulation Adhesion of probiotic isolates was estimated using method of Jacobsen et al. (Jacobsen et al., 1999). with Caco-2 cells (105) and the estimation was performed in replicate. All the previously Isolated Probiotic cultures (Hassan and Chaudhry, 2013) were prepared, from frozen stocks stored at в€’80В°C, by transfering into MRS broth, then cultures were incubated, 768 Afr. J. Microbiol. Res. Figure 1. Overview of adopted microencapsulation technique. in anaerobic conditions, at 35В°C for 18 h. After incubation, media were centrifuged for 10 min at 4В°C, and cells were washed with sterile 0.1% (w/v) pepton water. Microencapsulation 2008) by adding to 36 mL of the pancreatin- bile mixture (containing 1 mg/mL pancreatin and 4.5 g/mL of bile salts in phosphate buffer) , and pH was adjusted to 7.4. The mixture was then incubated for 4 h at 35В°C. Statistical analysis For microencapsulation, firstly the cells were coated with Caalginate by the emulsion method of Ortakci (Ortakci et al., 2012) and stored in pepton-saline solution at 4В°C until use. Later, the alginate -encapsulated probiotic cells were coated with the mixture of prebiotics, containing FOS, MOS, GOS and free cells were used as control. The overall adopted technique for microencapsulation is shown in Figure 1. The data observed in in vitro adherence studies as well as the logarithmic reductions in free (control), single encapsulated and double encapsulated bacterial cells as a consequence of acidic (SGJ-A and SGJ-B) and bile (SIJ) juices were analyzed by one-way ANOVA using SPSS 17 version. Significance was declared at P ≤ 0.05. Survival evaluation in simulated gastric juice (SGJ) RESULTS AND DSCUSSION To investigate the effect of pH, same as that of Gastric juice, on the survival of indigenous encapsulated probiotic bacteria, the cells were treated (for 120 min ) with sterile stimulated Gastric Juice -A (SGJ -A) as followed by Mainville et al. (Mainville et al., 2005) containing 2.0 g/kg of NaCl and 0.3 g/kg of pepsin in M HCl (~pH 1.4) and sterile stimulated Gastric Juice- B (SGJ -B) containing 0.9 M H3PO4 (pH 2.0) instead of HCl. In vitro adherence studies of potential indigenous probiotic strains Survival evaluation in simulated intestinal juice (SIJ) After treatment in SGJ for 60 min, the mixture was converted to simulated intestinal juice (Huang and Adams 2004; Annan et al. Cell surface hydrophobicity The investigations has revealed that the probiotic cell adhesion on the gut lining is considered as an important requirement for delivering health based benefits and the estimation of surface hydrophobicity is the best technique to determine this adherence and colonization potential (Kaushik et al., 2009). Therefore, the indigenous probiotic Hassan et al. 769 Table 1. Cell surface hydrophobicity, aggregation, and cell adhesion evaluation of selected indigenous probiotic Isolates. Isolate L. acidophilus L. lactis L. casei L. rhamnosus L. brevis L. lactis (b) L. rhamnosus (b) L. acidophilus(b) L. brevis (b) L. casei (b) B. bifidus B. infantis B. longum B. dentum B. brevis B. adoles L. plantum L. reteri L. gasseri L. fermentum Hydrophobicity (%) n- hexadecane Xylene 56.3 В± 0.10 56.1 В± 0.04 49.1 В± 0.06 49.3 В± 0.08 52.7 В± 0.21 52.3 В± 0.01 47.3 В± 0.14 47.3 В± 0.09 43.1 В± 0.12 43.5 В± 0.03 37.5 В± 0.19 37.6 В± 0.13 39.1 В± 0.24 39.1 В± 0.17 34.9 В± 0.14 34.1 В± 0.74 33.4 В± 0.14 33.6 В± 0.79 36.7 В± 0.18 36.2 В± 0.18 29.1 В± 0.21 29 В± 0.06 39.7 В± 0.17 39.1 В± 0.08 51.3 В± 0.78 51.6 В± 0.07 46.7 В± 0.98 46.7 В± 0.17 31.5 В± 0.15 31.3 В± 0.04 38.4 В± 0.18 38.1 В± 0.09 36.6 В± 0.24 36.1 В± 0.13 28.1 В± 0.27 28.6 В± 0.19 35.5 В± 0.17 35.5 В± 0.19 39.6 В± 0.12 39.6 В± 0.27 isolates were also analysed for the adherence studies in this study. The mean with standard deviation of triplicate experiments are presented in Table 1. It has been found that there was no significant difference in the hydrophobicity of both solvents used. All the recorded readings found in line with Kaushik et al. (Kaushik et al., 2009). In the present estimation, the hydrophobicity was found with mixed trend, the indigenous Lactobacillus acidophilus was found with highest cell surface hydrophobicity (56.3%) and lowest was found in Lactobacillus reuteri (28.1%). Previous research has revealed that some lactobacillus strains show low cell surface hydrophobicity to 2-5% (Schillinger et al., 2005; Rijnaarts et al., 1993) but neither of the isolated strain showed such a low hydophobicity percentage. Kaushik et al. (2009) has clamied that hydrophobicity plays a vital role in the cellular interaction. This great difference in the hydophobicity percentage could be due to the difference in the cell surface protein expression that may be due to the variation in environmental conditions(TomГЎs et al., 2005; Ramiah et al., 2007). Aggregation (%) Adhesion ratio (%) 36.1 В± 0.13 34.9 В± 0.14 31.7 В± 0.09 41.3 В± 0.98 32.6 В± 0.01 40.9 В± 0.12 51.9 В± 0.07 37.9 В± 0.07 56.1 В± 0.03 48.0 В± 0.04 49.2 В± 0.08 32.9 В± 0.06 32.5 В± 0.02 33.3 В± 0.07 31.8 В± 0.03 40.7 В± 0.07 49.6 В± 0.05 31.9 В± 0.03 35.1 В± 0.10 31.7 В± 0.09 7.2 В± 0.10 8.3 В± 0.09 7 В± 0.12 8.1 В± 016 8.5 В± 0.32 7.9 В± 0.63 7.4 В± 0.42 7.1 В± 0.31 6.9 В± 0.17 8.6 В± 0.78 8.2 В± 0.91 7.9 В± 0.19 8.1 В± 0.17 7.6 В± 0.63 7.3 В± 0.71 7.1 В± 0.44 7.2 В± 0.19 6.1 В± 0.13 6.9 В± 0.22 7.5 В± 0.26 persistence of probiotic bacteria in the host GI tract (Boekhorst et al., 2006b) (Boekhorst et al., 2006a). It has also been investigated that after adherence in the gut lining, the probiotic bacteria got the ability of aggregation and colonization for health promoting benefits. Vandevoorde et al. (1992) has also reported that the cellular aggregation not only facilitates the colonization but also provide a protection to the host by formatio of biofilm (Vandevoorde et al., 1992) and this biofilm formation is important for functioning of probiotics (OcaГ±a and Nader-Macias, 2001; Kos et al., 2003; Cesena et al., 2001). In the present study, the mean and standard deviation of percentages of triplicate experiment for cell aggregation of all indigenous isolates were recorded and presented in Table 1. The highest percentage was observed in L. rhamnosus (51.9%) followed by L. brevis with the percentage of 56.1 while the least was found in two isolates L.casei and L.fermentus with the similar value of 31.7%. The cell aggregation study was also concluded by Kaushik et al (Kaushik et al., 2009) but they did not find such a high potential of self-aggregation in their indigenous strain of Lactobacillus plantarum. Cell auto-aggregation Cell adhesion assay The reports have highlighted the presence of four mucusbinding proteins genome in Lactobacillus plantarum inclding the longest gene, ORF lp_1643 containing six repeats. These proteins helps in the adherence and the The mean and standard deviation of cell adhesion assay of selected indigenous isolates are given in Table 1, the highest percentage was observed by L. casei (8.6%) 770 Afr. J. Microbiol. Res. Table 2. Probiotic bacterial count for Free, Single and Double Encapsulated bacteria during storage. Time (day) 0 7 14 21 28 35 42 Control (Mean CFU Г— 108/g) В±SD 2.45 В± 0.20 2.52 В± 0.14 2.68 В± 0.19 2.74 В± 0.27 2.63 В± 0.23 1.91 В± 0.20 0.71 В± 0.19 Single-encapsulated (Mean CFU Г— 108/g) В±SD 2.98 В± 0.21 2.92 В± 0.18 3.12 В± 0.23 3.29 В± 0.40 3.36 В± 0.23 3.29 В± 0.16 3.14 В± 0.14 Double-encapsulated (Mean CFU Г— 108/g) В±SD 3.16 В± 0.18 3.32 В± 0.09 3.41 В± 0.17 3.68 В± 0.23 3.73 В± 0.71 3.84 В± 0.20 3.83 В± 0.20 followed by isolate L. brevis with the percentage of 8.5% while the least was found in isolates Lactobacillus lactis with the value of 6.1%. The results of cell surface hydrophobicity, cell auto-aggregation and cell adhesion assay for the selected indigenous probiotic isolates suggests that these isolates have specific interaction and colonization potential in the gut that is also indicated by good adhesion ratio while using Caco-2 cell lines, as matches the conclusions of Kaushik on lactobacillus strains (Kaushik et al., 2009). This study showed significant effects on the survival of free cultures in both SGJ-A and SGJ-B while the loss was higher in single microencapsulated L. plantarum and Lactobacillus paracasei while negligible loss was observed for double- microencapsulated cells. The zero loss was found in the mean probiotic count (cfu/g) of Lactobacillus delbrueckii subsp. Bulgaricus and L. paracasei. While a slight revival was observed in the free and single encapsulated bacteria in SIJ probably because of resuscitation of some injured cells because of acidic conditions. The adherence studies reveal that there is significant potential of health benefits of the isolated indigenous probiotic cultures and the combination of Ca-alginate and prebiotics significantly improves the viability of probiotic cells in the harsh gastrointestinal conditions. These microencapsulated indigenous probiotic cutlures can be used in food technology and production as it provides a solution to the low viability of probiotics incorporated in local dairy products. Ideally these cultures, since have adherence potential, can maintain the level of the beneficial probiotic bacteria at the minimum standard amount required (Akhiar and Aqilah, 2010). All the individual cultures of Lactobacillus and Bifidobacterium as well as the mixed culture of both showed similar response as that was investigated by Sultana et al. (2000), Kailasapathy et al. (2002), Vivek et al. (2013) and Chen et al. (2005), and proved the potential of microencapsulation for protecting the indigenous probiotic bacterial cells. The adopted double encapsulation technique has presented a significant effect (P< 0.05) on the survival of probiotic indigenous cells during storage of six weeks. In the case of free cells, which were used as a control, the reduction in the mean count was observed on day 28, single encapsulated on day 35 while the double encapsulated bacterial cells was decreased from 3.84 Г— 8 8 10 on day 35 to 3.83 Г— 10 on day 42. The present investigation also endorsed the results of Yeo and Liong that a significant increase in the count for L. acidophillus FTDC 8033 and Lactobacillus sp. FTDC 2113 in soy milk when supplemented with prebiotic (FOS) upto 7- log CFU/ml (Yeo and Liong, 2010). According to Ding and Shah, probiotic bacteria encapsulated in alginate, xanthan gum, and carrageenan gum survived better (P < 0.05) than free probiotic bacteria, in acidic environment (Ding and Shah, 2009), which also justifies the significance of present study. In fact, it has been investigated that prebiotics (fructooligosaccharides, iso-maltooligosaccharides and lactulose) is an emerging alternative that can further enhance probiotic activity and they enhance the growth of probiotics by providing carbon and nitrogen Microencapsulation and survival indigenous probiotic strains studies of The mean and standard deviation experiments conducted in triplicate for the free, single (Ca- alginate) and double (Ca- alginate and prebiotics amagum) microencapsulation are shown in Table 2 and count was performed on seven day interval for the period of six weeks. The rate of reduction of probiotic bacterial count (CFU/g) was calculated by the following formula; Hassan et al. 771 Figure 2. Mean loss in Lactobacillus count (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in SGJ- A. Lactobacillus lactis AH-1 Lactobacillus reuteri AH-2 , Lactobacillus acidophilus AH-3, Lactobacillus rhamnosus AH-4 Lactobacillus casei AH-5, Lactobacillus plantarum AH-6 and Lactobacillus brevis AH-7. sources which can increase their colonization of the gut (Annan et al., 2008). However, the symbiotic effects of probiotics and prebiotics are strain-dependent. As Yeo Siok had reported different growth behaviours for six different strains of lactobacilli and bifidobacteria when supplemented with five different prebiotics. Lactobacillus spp. FTDC 2113 grew significantly when supplemented with FOS but did not grow with pectin (Yeo and Liong, 2010). In the present study the mixture of encapsulated bacteria has showed higher growth in the presence of prebiotics. The survival of double microencapsulated probiotics not only proves the statement of Rabanel et al. that both the alginate and prebiotics are compatible with probiotics (Rabanel et al., 2009) but also justifies the claim of Chen Kun-Nan et al. (2005) that the Survival rate of the co-encapsulated active probiotics increases 1000 times higher than for alginates alone. Simulated gastric Juice The stimulated Gastric Juice (SGJ-A) has shown a significant reduction on the free probiotic cell (Figure 2). Initial mean count for free cells was 2.45 Г— 108 cfu/g which had 3 4 2 1 lost 1.09 Г— 10 , 1.04 Г— 10 , 2.01 Г— 10 , 2.74 Г— 10 , 2.56 Г— 2 1 2 10 , 1.76Г—10 and 1.99 Г— 10 for L. lactis AH-1, L. reuteri AH-2, L. acidophilus AH-3, Lactobacillus rhamnosus AH4, Lactobacillus casei AH-5, L. plantarum AH-6, and Lactobacillus brevis AH-7, respectively. The results of the survival evaluation of free cells, Single encapsulated and double encapsulated probiotics in stimulated Gastric Juice B, shown in Figure 3. The results indicated that the pH 2.0 resulted in great loss in count for uncoated free bacterial cells while the coated bacterial cells, either single or double microencapsulated, had a negligible reduction. In the case of single microencapsulated probiotics, the loss was high L. plantarum AH-6 and Lactobacillus brevis AH-7 that is, 2.29 Г— 102 and 3.24 Г— 102, respectively. The bacterial loss was negligible in the case of double- microencapsulated bacterial cells. The zero loss was found in the mean microbiological count (cfu/g) of L. reuteri AH-2 and L. reuteri AH-7 after the incubation of 2 h in SGJ-A. The results of bifidobacterium cultures are shown in Figure 4 for SGJ-A. This rapid reduction in count of free bacterial cells, when incubated for 120 min in stimulated Gastric Juice -A (SGJ-A), was the function of low pH (1.4) and acidic conditions, which is similar to the pH of the human stomach before ingestion of food. the main reason of rapid loss was that no protection was provided to free cells in such a harsh acidic environment. The technique of double microencapsulation, both with Ca- alginate and prebiotics (FOS and IMO) showed amazing results in the case of L. reuteri AH-2 and Lactobacillus brevis AH-7 as compared to the negligible loss of bacterial count was observed in the case of other probiotic isolates. It proves the potential in technique of double microencapsulation. Under the double microencapsulated probiotic cells, the survival of bacteria was significantly greater than free and singlemicroencapsulated bacterial cells. This supports the notion that it is prime to test the probiotics in the proper physiological conditions as bacterial survival is greatly influenced by variations in pH (Mainville et al., 2005; Pitino et al., 2010). This agrees with the findings of Sharp (Sharp et al., 2008) who observed a 3.8-log reduction after two hours of incubation in SGJ. 772 Afr. J. Microbiol. Res. Figure 3. Mean loss in Lactobacillus count (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in SGJ-B. L. lactis AH-1, Lactobacillus reuteri AH-2, Lactobacillus acidophilus AH-3 , Lactobacillus rhamnosus AH-4 , Lactobacillus casei AH-5 , Lactobacillus plantarum AH-6 , and Lactobacillus brevis AH-7. Figure 4. Mean loss in bifidobacterium and two lactobacillus strains count (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in stimulated Gastric Juice B (120 min incubation). Again the great loss of free probiotic cells was found in the SGJ-B as compared to single and double - microencapsulation. The in vitro test of gastric survival using H3PO4 (SGJ-B) was useful to provide a buffering effect when the bacteria were present in a uncoated form especially. The results of SGJ-B for the bifidobacterium isolates Hassan et al. 773 Figure 5. Mean loss in bifidobacterium and two lactobacillus strains count (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in stimulated Gastric Juice B (120 min incubation). Figure 6. Mean loss in Lactobacillus isolates (Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in SIJ. L. lactis AH-1, Lactobacillus reuteri AH-2, Lactobacillus acidophilus AH-3, Lactobacillus rhamnosus AH-4, Lactobacillus casei AH-5, Lactobacillus plantarum AH-6 and Lactobacillus brevis AH-7 . are shown in Figure 5. Simulated intestinal juice (SIJ) The Mean loss in probiotic count (Log 10 cfu/g) for control, single encapsulated and double encapsulated probiotics in stimulated Intestinal Juice (pH 7.4) are shown in Figure 6. A slight recovery of free and single encapsulated bacterial strains was found after the addi- tion of bile-pancreatin mixture. The acids of the SGJ-A and SGJ-B both were unable to provide any significant protective effect for the control and single micro-encapsulated probiotics. A slight increase may be the resuscitation of some cells that were sublethally injured during the 160 min of incubation of SGJ, while the zero loss was found in the case of double microencapsulated bacterial cells. Bifidobacterium breve and Bifidobacterium longum were encapsulated by Picot and Lacroix, who found 774 Afr. J. Microbiol. Res. Figure 7. Mean loss in bifidobacterium and two lactobacillus strains count Log 10 cfu/g) for free (control), Single encapsulated and Double Encapsulated bacteria in SIJ. results similar to the present study. They reported that this approach is potentially useful for delivery of viable probiotics to the gastrointestinal tract of humans (Picot and Lacroix 2004). After incubation in simulated gastric (1 h) and intestinal juices (pH 7.4, 4 h), the number of probiotic B. adolescentis the surviving cells was found high (Annan et al. 2008) showing similarity with the present study. The results of SIJ for the bifidobacterium and two lactobacillus isolates are shown in Figure 7. This study showed significantly adverse effects on the survival of free cultures in both SGJ-A and SGJ-B while the loss was higher in single microencapsulated L. plantarum AH-6 and Lactobacillus brevis AH-7 while negligible for double- microencapsulated cells. The zero loss was found in the mean microbiological count (cfu/g) of L. reuteriAH-2 and Lactobacillus brevis AH-7. While a slight revival was observed in the free and single encapsulated bacteria in SIJ probably because of resuscitation of some injured cells because of acidic conditions. The findings reveal that the combination of Ca-alginate and prebiotics significantly improve the viability of bacterial cells in the harsh gastrointestinal conditions and may be of use for the food and/or pharmaceutical industries. In the nutshell, the results of survival studies reveals that incurporation of ca- alginate and prebiotic amalgum has improved viability of probiotics. REFERENCES Akhiar M, Aqilah NS (2010). Enhancement of probiotics survival by microencapsulation with alginate and prebiotics. MMG 445 Basic Biotechnol. eJ. 6 (1) Annan N, Borza A, Hansen LT (2008). Encapsulation in alginate-coated gelatin microspheres improves survival of the probiotic< i> Bifidobacterium adolescentis</i> 15703T during exposure to simulated gastro-intestinal conditions. Food Res. Int. 41(2):184-193. Boekhorst J, Helmer Q, Kleerebezem M, Siezen RJ (2006a). Comparative analysis of proteins with a mucus-binding domain found exclusively in lactic acid bacteria. Microbiol. 152(1):273-280 Boekhorst J, Wels M, Kleerebezem M, Siezen RJ (2006b). The predicted secretome of Lactobacillus plantarum WCFS1 sheds light on interactions with its environment. Microbiol. 152(11):3175-3183 Cesena C, Morelli L, Alander M, Siljander T, Tuomola E, Salminen S, Mattila-Sandholm T, Vilpponen-Salmela T, Von W right A (2001). < i> Lactobacillus crispatus</i> and its Nonaggregating Mutant in Human Colonization Trials. J. Dairy Sci. 84(5):1001-1010 ChГЎvarri M, MaraГ±Гіn I, Ares R, IbГЎГ±ez FC, Marzo F, VillarГЎn MdC (2010). Microencapsulation of a probiotic and prebiotic in alginatechitosan capsules improves survival in simulated gastro-intestinal conditions. Int. J. Food Microbiol. 142(1):185-189 Chen CC, Walker WA (2005). Probiotics and prebiotics: role in clinical disease states. Adv. Pediatr. 52:77-113 Chen KN, Chen MJ, Liu JR, Lin CW, Chiu HY (2005). Optimization of incorporated prebiotics as coating materials for probiotic microencapsulation. J. Food Sci. 70(5):M260-M266 Del Re B, Sgorbati B, Miglioli M, Palenzona D (2000). Adhesion, autoaggregation and hydrophobicity of 13 strains of Bifidobacterium longum. Lett. Appl. Microbiol. 31(6):438-442. Favaro-Trindade C, Grosso C (2002) Microencapsulation of L. acidophilus (La-05) and B. lactis (Bb-12) and evaluation of their survival at the pH values of the stomach and in bile. J. Microencaps 19(4):485-494. Hassan A, Chaudhry MN (2013) Culture-dependent and cultureindependent techniques to identify lactic acid bacteria in fermented products. Afr. J. Microbiol. Res. 7(30):3983-3987 Homayouni AA, Ehsani A, Yarmand M, Razavi MSH (2008). Effect of microencapsulation and resistant starch on the probiotic survival and sensory properties of symbiotic ice cream. Food Chem. 111:50-55. Huang Y, Adams MC (2004). In vitro assessment of the upper gastrointestinal tolerance of potential probiotic dairy propionibacteria. Int. J. Food Microbiol. 91(3):253-260. Jacobsen CN, Nielsen VR, Hayford A, MГёller P, Michaelsen K, Paerregaard A, SandstrГ¶m B, Tvede M, Jakobsen M (1999). Screening of probiotic activities of forty-seven strains of Lactobacillus spp. by in vitro techniques and evaluation of the colonization ability of five selected strains in humans. Appl. Environ. Microbiol. 65(11): Hassan et al. 4949-4956. Kailasapathy K (2002). Microencapsulation of probiotic bacteria: technology and potential applications. Curr. Issues Intestinal Microbiol. 3(2):39-48. Kailasapathy K (2009). Encapsulation technologies for functional foods and nutraceutical product development. CAB Reviews: Perspectives in agriculture, veterinary science, nutrition and natural resources 4(033):1-19. Kaushik JK, Kumar A, Duary RK, Mohanty AK, Grover S, Batish VK (2009). Functional and probiotic attributes of an indigenous isolate of Lactobacillus plantarum. PloS one 4(12):e8099. Kos B, Е uЕЎkoviД‡ J, VukoviД‡ S, Е impraga M, Frece J, MatoЕЎiД‡ S (2003). Adhesion and aggregation ability of probiotic strain Lactobacillus acidophilus M92. J. Appl. Microbiol. 94(6):981-987. Lian W-C, Hsiao H-C, Chou C-C (2003). Viability of microencapsulated bifidobacteria in simulated gastric juice and bile solution. Int. J. Food Microbiol. 86(3):293-301. Liaskovskii TM, Podgorskii VS (2005). [Assessment of probiotics according to the international organizations (FAO/WHO)]. Microbiol. J. 67(6):104-112. Liserre AM, RГ© MI, Franco BD (2007). Microencapsulation of Bifidobacterium animalis subsp. lactis in modified alginate-chitosan beads and evaluation of survival in simulated gastrointestinal conditions. Food Biotechnol. 21(1):1-16. Mainville I, Arcand Y, Farnworth E (2005). A dynamic model that simulates the human upper gastrointestinal tract for the study of probiotics. Int. J. Food Microbiol. 99(3):287-296. O'riordan K, Andrews D, Buckle K, Conway P (2001). Evaluation of microencapsulation of a Bifidobacterium strain with starch as an approach to prolonging viability during storage. J. Appl. Microbiol. 91(6):1059-1066. OcaГ±a VS, Nader-Macias ME (2001). Vaginal lactobacilli: self-and coaggregating ability. Br J Biomed Sci 59 (4):183-190 Oliveira A, Moretti T, Boschini C, Baliero J, Freitas L, Freitas O, FavaroTrindade C (2007). Microencapsulation of B. lactis (BI 01) and L. acidophilus (LAC 4) by complex coacervation followed by spoutedbed drying. Drying Technol. 25(10):1687-1693. Ortakci F, Broadbent J, McManus W, McMahon D (2012). Survival of microencapsulated probiotic< i> Lactobacillus paracasei</i> LBC-1e during manufacture of Mozzarella cheese and simulated gastric digestion. J. Dairy Sci. pp. 6274-6281. Parvez S, Malik K, Ah Kang S, Kim HY (2006). Probiotics and their fermented food products are beneficial for health. J. Appl. Microbiol. 100(6):1171-1185. Picot A, Lacroix C (2004). Encapsulation of bifidobacteria in whey protein-based microcapsules and survival in simulated gastrointestinal conditions and in yoghurt. Int. Dairy J. 14(6):505-515. Pitino I, Randazzo CL, Mandalari G, Lo Curto A, Faulks RM, Le Marc Y, Bisignano C, Caggia C, Wickham MSJ (2010). Survival of< i> Lactobacillus rhamnosus</i> strains in the upper gastrointestinal tract. Food Microbiol. 27(8):1121-1127. Rabanel JM, Banquy X, Zouaoui H, Mokhtar M, Hildgen P (2009). Progress technology in microencapsulation methods for cell therapy. Biotechnol. Prog. 25(4):946-963. Ramiah K, Van Reenen C, Dicks L (2007). Expression of the mucus adhesion genes< i> Mub</i> and< i> MapA</i>, adhesion-like factor< i> EF-Tu</i> and bacteriocin gene< i> plaA</i> of< i> Lactobacillus plantarum</i> 423, monitored with real-time PCR. Int. J. Food Microbiol. 116(3):405-409. 775 Rijnaarts HH, Norde W, Bouwer EJ, Lyklema J, Zehnder AJ (1993). Bacterial adhesion under static and dynamic conditions. Appl. Environ. Microbiol. 59(10):3255-3265. Rosenberg M, Gutnick D, Rosenberg E (1980). Adherence of bacteria to hydrocarbons: a simple method for measuring cell‐surface hydrophobicity. FEMS Microbiol. Lett. 9(1):29-33. Saarela M, LГ¤hteenmГ¤ki L, Crittenden R, Salminen S, Mattila-Sandholm T (2002). Gut bacteria and health foods - the European perspective. Int. J. Food Microbiol. 78(1):99-117. Schillinger U, Guigas C, Heinrich Holzapfel W (2005). < i> In vitro</i> adherence and other properties of lactobacilli used in probiotic yoghurt-like products. Int. Dairy J. 15(12):1289-1297. Sharp M, McMahon DJ, Broadbent J (2008). Comparative Evaluation of Yogurt and Low‐Fat Cheddar Cheese as Delivery Media for Probiotic Lactobacillus casei. J. Food Sci. 73(7):M375-M377. Shima M, Matsuo T, Yamashita M, Adachi S (2009). Protection of< i> Lactobacillus acidophilus</i> from bile salts in a model intestinal juice by incorporation into the inner-water phase of a W/O/W emulsion. Food Hydrocolloids 23(2):281-285. Sultana K, Godward G, Reynolds N, Arumugaswamy R, Peiris P, Kailasapathy K (2000). Encapsulation of probiotic bacteria with alginate-starch and evaluation of survival in simulated gastrointestinal conditions and in yoghurt. Int. J. Food Microbiol. 62(1):47-55. Thantsha MS, Cloete TE, Moolman FS, Labuschagne PW (2009). Supercritical carbon dioxide interpolymer complexes improve survival of< i> B</i>.< i> longum</i> Bb-46 in simulated gastrointestinal fluids. Int. J. Food Microbiol. 12(1):88-92. TomГЎs J, Wiese B, Nader‐MacГas M (2005). Effects of culture conditions on the growth and auto‐aggregation ability of vaginal Lactobacillus johnsonii CRL 1294. J. Appl. Microbiol. 99(6):13831391. Vandevoorde L, Christiaens H, Verstraete W (1992). Prevalence of coaggregation reactions among chicken lactobacilli. J. Appl. Microbiol. 72(3):214-219. Vasiljevic T, Shah NP (2008). Probiotics - from Metchnikoff to bioactives. Int. Dairy J. 18(7):714-728. Vivek K (2013). Use of encapsulated probiotics in dairy based foods. Int. J. Food Agric. Vet. Sci. 3(1):188-199 Yeo SK, Liong MT (2010). Effect of prebiotics on viability and growth characteristics of probiotics in soymilk. J. Sci. Food Agric. 90(2):267275. doi:10.1002/jsfa.3808 Vol. 8(8), pp. 776-782, 19 February, 2014 DOI: 10.5897/AJMR2013.6576 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research paper Screening novel diagnostic marker of Mycobacterium tuberculosis Xin Pan1,2*, Siliang Zeng1, Jialin Cai2, Bin Zhang3*, Boju Pan2, Zhonglei Pan2, Ying Wu2, Ying Wang4, Yi Zhou1, Wei Fang2, Min Chen2, Wanqing Liao2, XiuZhen Yu1, Min Tao1, Jun Zhang1 and Wei Song1 1 Shanghai Junwei Fine Medical ClubпјЊ58 Bao Tou Road, Shanghai 200433, China. Second Military Medical UniversityпјЊ800 Xiang Yin Road, Shanghai, 200433, China. 3 Qingpu Branch of Zhongshan Hospital, Fudan University, 1158 Gong Yuan Dong Road, Shanghai 201700, China. 4 Shanghai Jiao Tong University School of Medicine, 280 Chongqing South Road, Shanghai, 200025, China. 2 Accepted 23 January, 2014 The aim of present study was to screen and evaluate the serodiagnostic value of the purified fusion antigens of Mycobacterium tuberculosis (Mtb) by enzyme-linked immunosorbent assay (ELISA). A group of vector system which was constructed by cloning Rv1908c, Rv0733, Rv0899, Rv1411c and Rv3914 gene of Mtb into the prokaryotic expression plasmid pET-32b was transformed into E. coli for induction and expression fusion antigens to determine their potentiality in diagnostic application. Following purification with the His-select nickel magnetic agarose beads, the expressed fusion proteins showed purity via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot technique. The ELISA plates were coated with these fusion antigens. Through ELISA, the antigen binding with specific IgG levels between active TB patients and healthy controls was compared. The purity and the size of the expressed fusion antigens were confirmed by the Western blot. The ELISA results indicated that IgG levels against Rv1411c-6His, Rv3914-6His and Rv2031c-6His were significantly higher in serum of active TB patients than in that of healthy controls. More interesting, the AUC value of Rv3914-6His (0.7867) was higher than that of Rv2031c-6His (0.754) which was widely used in clinic. The results implied that Rv3914-6His might be a useful candidate antigen in the diagnosis of Mtb infection, especially for active pulmonary TB diagnosis. Its role in serodiagnosis of extra-pulmonary TB is still needed to be validated. Key words: Mycobacterium tuberculosis, expression and purification, antigen, serodiagnosis, tuberculosis. INTRODUCTION Tuberculosis (TB) is a chronic infectious disease mainly caused by Mycobacterium tuberculosis (Mtb). The bacteria typically attack the lung parenchyma which named pulmonary TB (PTB) by the clinical manifestations (Walzl et al., 2011). Mtb also can attack other part of the body such as lymph nodes, the central nervous system, liver, spleen, kidney, spine, bone and skin which named extrapulmonary TB (EPTB) (Ireton et al., 2010). TB is currently the second-largest killer infectious agent after human immunodeficiency virus (HIV). According to the World Health Organization (WHO) statistics, China has the world's second largest tuberculosis epidemic *Corresponding authors. E-mail: [email protected] and [email protected]. Pan et al. (Wang et al., 2007). Therefore, it is very important to develop new convenient, fast, high sensitivity and specificity diagnosis methods to control the prevalence and spread of tuberculosisпјЋ Although currently bacteriological culture is still considered as the gold standard in clinical laboratory confirmation of TB disease, the laboratory may need more time (46 weeks), and the rates of false-positive cultures are too high, which are not suitable for clinical application (Kashyap et al., 2010). The newly developed GeneXpert MTB/RIF assay is a novel nucleic acid amplification diagnostic technique for the diagnosis of tuberculosis and rapid detection of rifampicin (RIF) resistance in clinical specimens (Steingart et al., 2013). But this assay determined the presence or absence of Mtb or rifampicin resistance, the activity of TB bacillus cannot be determined. The QuantiFERONВ®-TB gold in-tube or T-Spot TB test is an indirect test for measuring the release of interferon-gamma (INF-Оі) from the patient's viable T lymphocytes stimulated by a few Mtb-specific antigens (early secreted antigenic target-6 and culture filtrate protein-10) (Rose et al., 2012) . INF-Оі release assays have excellent sensitivity and specificity with minimizing subjective interpretation and operator bias. However, the assays require expensive instrument, reagents and well trained operators. These requirements restrict their use in China. Serodiagnosis has a long history and is characterized by convenient specimens, low costs, and commonly used in clinical laboratories to test numerous TB serum samples in a short time (Steingart et al., 2011). The antibody response to the 88 kDa, 65 kDa Hsp, 45 kDa, 38 kDa lipoprotein (He et al., 2011), 16 kDa HSP (Senol et al., 2009), ESAT-6, CFP-10, and lipoarabinomannan (LAM) (Ben Selma et al., 2010) antigens of Mtb was extensively studied by diagnostic companies and used in the commercial serological tests of TB infection (Flores et al., 2011). However, currently available commercial serodiagnostic tests provided inconsistent and imprecise findings, the WHO issued a policy statement against the use of commercial serological tests for the diagnosis of active PTB (WHO, 2011). Therefore, accurate, rapid and inexpensive antibody-based tests for TB diagnosis are needed urgently (Flores et al., 2011). The Mtb immunoproteome analyses revealed sera from TB mainly recognized membrane associated and extracellular proteins of the bacterial (Kunnath-Velayudhan et al., 2010). In the study, the successful cloned genes of Mycobacterium tuberculosis envelope proteins Rv1908c, Rv0733, Rv0899, Rv1411c and Rv3914 were selected for expression and purification and screening serodiagnosis antigens. Rv1908c gene name is KatG, antigen name is catalase-peroxidase- peroxynitritase T, molecular mass is about 80.57 kDa, it may play a role in the intracellular survival of mycobacteria within macrophages. Rv0733 gene name is adk, antigen name is adenylate kinase, molecular mass is about 20.09 kDa, it is essential for the 777 bacteria in intracellular nucleotide metabolism. Rv0899 gene name is ompAпјЊantigen name is outer membrane protein A, molecular mass is about 33.54 kDa, it may protect the integrity of the bacterium. Rv1411c gene name is lprG, antigen name is conserved lipoprotein, molecular mass is about 24.55 kDa, the function is still unknown. Rv3914 gene name is trxC, antigen name is thioredoxin, molecular mass is about 12.54 kDa, Thioredoxin participates in various redox reactions. Enzymelinked immunosorbent assay (ELISA) plates were coated with prokaryotic expression and purification of the five antigens, respectively. An indirect ELISA was established for rapid comparison serum IgG responses to the five antigens respectively between patients with active tuberculosis (TB group) and healthy physical examinees with non-tuberculosis (control group). Anti-Rv3914 IgG may become a potential important new serum marker for active tuberculosis diagnosis. MATERIALS AND METHODS Plasmids and antigens The recombinant prokaryotic expressive plasmids pET-32b-Rv0733, pET-32b-Rv1411c, pET-32b-Rv1908c, pET-32b-Rv0899, pET-32bRv3914 and Rv2031c-6His fusion antigen were kept in our laboratory. Main Reagents and instruments Mouse monoclonal to 6Г—His tag antibody was purchased from Abcam, USA. Prestained protein molecular weight marker was purchased from Fermentas, Canada. IRDye 800CW goat antimouse IgG (H+L) was purchased from Licor Biosciences, USA. Plasmid preparation kit and DNA gel extraction kit were purchased from Axygen, USA. Isopropyl-ОІ-D-thiogalactopyranoside (IPTG) and His-select nickel magnetic agarose beads were purchased from Sigma, USA. Alkaline phosphatase (AP)-affinipure goat anti-human IgG (H+L) was purchased from Jackson ImmunoResearch, USA. BL21 (DE3) PLySs competent cells was purchased from Takara, Japan. Amicon ultra-2 centrifugal filter unit with ultracel-3 membrane was purchased from Millipore, USA. Odyssey infrared imaging system was purchased from Licor Biosciences, USA. ELISA plate reader was purchased from Corning Incorporated, USA. Prokaryotic expression and purification of His-Mtb fusion antigens Escherichia coli (E.coli) BL21 (DE3) PLySs was transformed with the recombinant plasmid pET-32b-Rv0733, pET-32b-Rv1411c, pET32b-Rv1908c, pET-32b-Rv0899, pET-32b-Rv3914 and pET-32bRv2031c, respectively. Positive colonies were confirmed by DNA sequencing and performed to verify antigen expression. Two hundred (200) mL medium LB containing 50 Ојg/mL ampicillin was inoculated and incubated at 37В°C with 200 rpm shaking to the optical density (OD) value approximately 0.4пЅћ0.6 at 600 nm. IPTG was added to a final concentration of 0.1 mmol/L for inducing expression. Shaking incubation was continued at 30В°C for 6 h. Bacterial cells were precipitated by centrifugation (7000 g for 3 min at 4В°C) and resuspended in 20 mL lysis buffer containing 50 mmol/L 778 Afr. J. Microbiol. Res. NaH2PO4пјЊ300 mmol/L NaCl and 10mmol/L imidazole pH 8.0. The mixture was sonicated and centrifuged (8000 g for 30 min at 4В°C). The supernatant containing recombinant Mtb antigens named crude extracts were filtered through a 0.45 Ојm prefilter. His-select nickel magnetic agarose beads were uniformly suspended and added 1 mL to the filtrate protein. The mixture gently shaked overnight at 4В°C and the affinity gel washed with plenty of wash buffer containing 50 mmol/L NaH2 PO4, 300 mmol/L NaCl and 20 mmol/L imidazole pH 8.0. The sample was centrifuged and the supernatant containing unbinding contaminating proteins was removed. The HisTag-C-terminal protein was eluted from the beads with elution buffer (50 mmol/L NaH2 PO4, 300 mmol/L NaCl, 300 mmol/L imidazole, pH 8.0). Eluted fractions were transferred to Amicon Ultra-2 centrifugal filter unit with ultracel-3 membrane and centrifuged to remove the imidazole and other small molecules. The ultrafiltered samples were sterilized through 0.22 Ојm filter. The purified proteins were stored in 40% glycerin at -80В°C. SDS-PAGE and Western blotting The protein concentration of the crude extracts and the purified protein was measured respectively using the Bradford method. An equal amount of total protein content was loaded on each lane and separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by staining at 37В°C using Coomassie brilliant blue R-250. Rv3914 was used as a given example for assessing the purity effect before and after purification. For Western blot analysis, five purified antigens were separated by 12% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes by semi-dry apparatus and nonspecific binding was blocked with PBS containing 3% bovine serum albumin (BSA). The blots were probed with anti-6-His antibodies diluted 1:1000, and the immune complexes were visualized using goat anti-mouse IgGпј€H+Lпј‰IRDye 800 conjugate secondary antibody, according to the manufacturer’s instructions. Blots were digitally photographed using the Odyssey infrared imaging system. Human serum collection The research proposal was approved by the ethics committee of Shanghai Junwei Fine Medical Club, China and all participants at Shanghai pulmonary hospital, China provided written informed consents. Thirty-four serum samples were collected from patients with confirmed diagnosis active pulmonary tuberculosis and thirtyfive serum samples were obtained from healthy physical examinees. The patients had clinical symptomsпјЊradiological signs of TB, acid-fast stain test of sputum smear, as well as positive culture for Mycobacterium tuberculosis. Serum samples as healthy controls were obtained from healthy physical examinees with no apparent signs of any disease and tuberculosis diagnoses ruled out. Detection the relative antibody in serum by indirect enzymelinked immunosorbent assay Flat-bottom 96-well Costar plates were coated with 100 ОјL/well of each purified antigen at a concentration of 1Ојg/mL in carbonate buffer (15mM Na2CO3, 35mM NaHCO3, pH9.6). The positive control was Rv2031c (16 kDa HSP) -6His antigen, the negative control was serum of healthy physical examinees and blank control was phosphate-buffered saline (PBS). After overnight incubation at 4В°C, these antigen-coated wells were washed 3 times with PBS, containing 0.05% Tween 20 (PBST), blocked with blocking buffer of 1% gelatin in PBST for an hour at 37В°C and followed by three washings. Subsequently, 100 ОјL of diluted serum samples (1:100 in blocking buffer) was added. Following an incubation period of 1 h at 37В°C, the wells were again washed and filled with 100 ОјL of a 1:2000 dilution of alkaline phosphatase-conjugated goat anti-human immunoglobulin G. After incubation for 1 hr at 37В°C, the plates were again washed with PBST. The wells were filled with 100 ОјL of substrate solution (1 mg/mL p-nitrophenylphosphate in 10% diethanolamine buffer containing 0.5 mM MgCl2, pH 9.8). After 30 min incubation at room temperature in darkness, the reaction was stopped by adding 50 ОјL /well of 2 M Na2CO3. The optical density (OD) of each well was measured at a wavelength of 405 nm in ELISA plate reader. Immunogenic properties of the purified antigens identification were done in ten-fold serial dilutions of serum samples. Statistical analysis Data were presented as means and standard errors (mean В± SD). The cut-off value for the optical density (OD) of an ELISA was determined by the mean value of healthy controls plus 3SD. Comparisons between two groups were performed with GraphPad Prism 5 statistical analysis software using the Mann Whitney test, and the level P < 0.05 was considered statistically significant. RESULTS Prokaryotic expression, purification and identification of five recombinant antigens of Mycobacterium tuberculosis Single colonies of BL21 (DE3) PlySs bacteria transformed respectively by pET-32b-Rv0733, pET-32bRv 1411c, pET-32b-Rv1908c, pET-32b-Rv0899 and pET32b-Rv3914 were picked up from cultured plates and confirmed by DNA sequencing analysis. Recombinant antigens expressed as COOH-terminally polyhistidinetagged fusion proteins were induced with IPTG and purified using His-select nickel magnetic agarose beads. SDS-PAGE gels for Rv3914-6His given representative sample visualization the level of purity required was stained with Coomassie brilliant blue R-250. Taking the molecular weight of the 6Г—His tag (0.84kDa) and that of Rv3914 antigen (12.54 kDa) into account, the size of the purified protein showed an expected size of protein band of 13.38 kDa (Figure 1). Based on the Western blot assay, all of the five purified native fusion proteins could be recognized by His monocolonal antibodies and the expected bands were present respectively (Figure 2). These fusion proteins were Rv0899-6His (34.38 kDa), Rv0733-6His (20.93 kDa), Rv1908c-6His (81.41 kDa), Rv1411c-6His (25.39 kDa) and Rv3914-6His (13.38 kDa), respectively. Reactivities evaluation of recombinant antigens to human serum specimens A total of 34 serum samples were collected from 34 patients with a confirmed diagnosis of pulmonary tuberculosis at Shanghai pulmonary hospital between 2009 and 2010. Pan et al. Figure 1. Expression and purification of Rv3914-6His fusion protein detected with SDS-PAGE 1:Protein marker; 2:Lysates of pET32b-Rv3914/BL21(DE3) PlySs with IPTG induction; 3: Purified native Rv3914-6His fusion protein. Figure 2. The identification of five kinds of Mtb fusion antigens by two-color infrared fluorescence 1:Protein marker; 2: Purified Rv0899c-6His fusion protein; 3: Purified Rv0733-6His fusion protein; 4: Purified Rv1908c-6His fusion proteinпј›5: Purified Rv1411c-6His fusion protein; 6: Purified Rv3914-6His fusion protein. The clinical and laboratory characteristics of the TB patients and healthy controls were summarized in Table 1. Serum samples as control group were obtained from healthy individuals (n=35) with tuberculosis diagnoses ruled out. The reactivities of recombinant antigens to human serum 779 serum specimens were interpreted based on the ELISA assays. For ELISA the positive control antigen Rv2031c6His (Figure 3) and the representative antigens Rv39146His (Figure 4) were used. Rv2031c, the 16 kDa heat shock protein (HSP), one of the three well known diagnostic antigen (Senol et al., 2009), was shown to be specific and sensitive for detecting antibodies against M. tuberculosis. The antigens were coated onto 96-well microplates. A total of 7 human sera were used in this assay, of which 6 serum specimens were from active TB patients, whereas 1 was from healthy individual. Ten-fold serial dilutions of the sera were examined, all reactions were run three times. The results revealed that the purified native Rv3914-6His antigen showed substantial reactivity to active-TB specimens. The OD value of active-TB specimens was significantly increased (0.88-fold for Rv2031c-6His, t=-15.433, P=0.0001; 0.72-fold for Rv3914-6His, t =-8.513, P=0.0004) in microwell plate coated with the antigens at the concentration of 1Ојg/mL as compared with the concentration of 0.1 Ојg/mL. The recombinant antigens concentration of 1 Ојg/mL for ELISA studies was selected as working coated concentration in the following studies. ELISA screening of purified recombinant antigens for TB diagnosis After confirming the reactivity of purified fusion antigen, a total of 69 human serum samples were assayed by ELISA using the five recombinant antigens, respectively. The Rv2031c-6His (16 kDa antigen) fusion protein was included in the assay system as a positive control for specificity and sensitivity. Each assay was repeated three times. These sera consisted of 34 samples from active TB patients, and 35 samples from healthy physical examinees. The profiles of IgG antibodies against of these purified fusion Mtb antigens were estimated by indirect ELISA in these human serum samples collected (Figure 5). The ELISA with Rv3914-6His, Rv1411c-6His and Rv2031c-6His fusion antigens were useful to discriminate positive and negative TB, a statistically significant difference in IgG level were found between healthy controls and TB patients (PRv3914c-6His=0.0001, PRv1411c-6His=0.0043 and PRv2031c-6His=0.0004, respectively). There was no significant difference in the levels of anti-Mycobacterium tuberculosis antibody IgG from those of serum specimens from healthy controls and from active TB individuals by ELISA with Rv0899-6His, Rv0733-6His and Rv1908c-6His fusion antigens (PRv0899-6His=0.1398, PRv0733-6His=0.3060 and PRv1908c-6His = 0.0691, respectively). Receiver operating characteristic (ROC) curves is a graph of sensitivity on the y-axis against 100-specificity on the x-axis. It is an excellent way to evaluate the clinical diagnostic value of given biomarker. ROC curves were plotted using GraphPad Prism 5. The areas under the summary ROC curve (AUC) of Rv3914-6His, 780 Afr. J. Microbiol. Res. Table 1. Clinical and experimental parameters of research cohort. Clinical and laboratory characteristic Age (years В±SD) Sex (male/female) Duration of symptoms (months В±SD) Active tuberculosis patients (n=34) 45.4 В± 18.6 12/22 19.18 В± 2.61 Treatment (months В±SD) 2.45 В± 0.12 Smear positive Sputum culture positive 20 25 Purified protein derivative (PPD) positive Cavity positive 16 13 Healthy controls (n=35) 42.8 В± 16.2 24/11 пјЌ пјЌ пјЌ пјЌ пјЌ пјЌ Concentration of Rv2031c-6His antigen (Ојg/mL) Figure 3. Detection of serum IgG against with Rv2031c-6His fusion protein by indirect ELISA. TB: tuberculosis patients; HC: protein by indirect ELISA. TB: tuberculosis patientsпј›HC: healthy physical examinees. Figure 5. Detection of serum IgG against with Mtb antigen-6His fusion protein by indirect ELISA. TB: tuberculosis patients (n=34)пј›HC: healthy physical examinees (n=35). Rv1411c-6His and Rv2031c-6His ROC were 0.7867, 0.5867 and 0.754, respectively (Figure 6). An AUC of 0.75 or greater is generally considered a good biomarker. Antibody response to the 16 kDa heat shock protein in active TB has been used in assist diagnosis of infectious Mtb (Senol et al., 2009). It was suggested that Rv3914 recombinant protein could be potentially used for the diagnosis of tuberculosis and as a candidate antigen. DISCUSSION Concentration of Rv3914-6His antigen (Ојg/mL) Figure 4. Detection of serum IgG against with Rv3914-6His fusion protein by indirect ELISA. TB: tuberculosis patients; HC: protein by indirect ELISA. In recent yearsпјЊdue to movement of population, problems of multi-drug resistant TB and TB-HIV co-infection, tuberculosis continues to be one of major public health burden in ChinaпјЋRapid and effective diagnosis of infectious cases is crucial to facilitate earlier treatment initiation Pan et al. 781 TB: tuberculosis patients (n=34)пј›HC: healthy physical examinees (n=35) 150 Rv2031c-6His 100 50 100 50 0 0 0 20 40 60 80 100% - Specificity% 100 150 Rv3914-6His Sensitivity% Sensitivity% Sensitivity% 150 Rv1411c-6His 0 20 40 60 80 100 100 50 0 0 100% - Specificity% 20 40 60 80 100 100% - Specificity% Figure 6. ROC curves of Mtb 6His fusion antigens in the diagnosis of TB. and reducing disease transmission and preventing emergence of resistant strains (Kaushik et al., 2012). The aim of this study was to screen a specific diagnostic marker from five envelope protein of Mtb which identified by proteomic studies (de Souza et al., 2011; Forrellad et al., 2013). The envelop antigensпјЊsuch as Rv1908c (Escalante et al., 2013), Rv0899 (Marassi (2011) and Rv3914 (Akif et al., 2008), may play essential roles in the intracellular growth and survival of Mtb within the host. The expression and purification system of five fusion proteins was successfully established and recombinant fusion proteins with high purity and high yield was obtained. The recombinant antigen’s native conformation with antibody binding activity may be lost due to prokaryotic expression system, so the ELISA plates were coated with gradient dilution antigens, and the collected serums (dilution, 1:100) were used as primary antibodies. The result showed the representative Rv3914-6His antigen retained antibody-binding activity. The purified fusion antigens were potentially used as coated antigens in ELISA assays. Serum specimens (including 34 cases of active TB patients and 35 healthy physical examinees) were tested for the presence of IgG antibodies against these five antigens of Mtb using a quantitative ELISA. The results of ELISA test showed good sensitivity for purified Rv39146His and Rv1411c-6His antigen. The levels of antibodies against the two antigens were significantly higher in TB patients than in healthy individuals (PRv3914c-6His = 0.0001, PRv1411c-6His = 0.0043), respectively. Rv3914 could be selected as an adjunct for TB serodiagnostic assay according to the ROC analysis, the AUC value for Rv3914-6His is 0.7867 and similar to the value for Rv2031c (AUC Rv2031c-6His=0.754 ). It would be of interest to further study how the Rv3914 and Rv2031c antigens perform in combination. There were no statistically significant differences between the optical density values obtained with sera from TB patients and healthy controls with Rv1908c-6His, Rv0899-6His or Rv0733-6His antigens-coated ELISA plates, respectively. It has been reported previously that mutations in the three antigens’ gene lead to reduce virulence and may cause reduced survival of Mtb in host tissues (Pym et al., 2002; Raynaud et al., 2002; Bellinzoni et al., 2006). These antigens might really begin their work when Mtb were engulfed by macrophages. Therefore, these antigens might be helpful for screening intracellular antibodies of Mtb. Authors’ contributions XP designed the research and wrote the paper; XP, SLZ, JLC, BZ, BJP, ZLP, YW, YW, YZ, WF, MC, WQL, XZY, MT, JZ, WS performed research. ACKNOWLEDGMENT This work was supported by National Key Basic Research Program of China Grants (Contract No. 2013CB531601) and National Natural Science Foundation of China Grants (Contract No. 30972633). REFERENCES Akif M, Khare G, Tyagi AK, Mande SC, Sardesai AA (2008). Functional studies of multiple thioredoxins from Mycobacterium tuberculosis. J. Bacteriol. 190(21):7087-7095. Bellinzoni M, Haouz A, GraГ±a M, Munier-Lehmann H, Shepard W, Alzari PM (2006). The crystal structure of Mycobacterium tuberculosis 2+ adenylate kinase in complex with two molecules of ADP and Mg supports an associative mechanism for phosphoryl transfer. Protein Sci. 15(6):1489-1493. Ben Selma W, Harizi H, Marzouk M, Ben Kahla I, Ben Lazreg F, Ferjeni A, Harrabi I, Abdelghani A, Ben Said M, Boukadida J (2010). Rapid detection of immunoglobulin G against Mycobacterium tuberculosis antigens by two commercial ELISA kits. Int. J. Tuberc. Lung. Dis. 14(7):841-846. de Souza GA, Leversen NA, Malen H, Wiker HG (2011). Bacterial proteins with cleaved or uncleaved signal peptides of the general secretory pathway. J. Proteomics 75(2):502-510. Escalante P, McKean-Cowdin R, Ramaswamy SV, Williams-Bouyer N, Teeter LD, Jones BE, Graviss EA (2013). Can mycobacterial katG genetic changes in isoniazid-resistant tuberculosis influence human disease features? Int. J. Tuberc. Lung Dis. 17(5):644-651. 782 Afr. J. Microbiol. Res. Flores LL, Steingart KR, Dendukuri N, Schiller I, Minion J, Pai M, Ramsay A, Henry M, Laal S (2011). Systematic review and metaanalysis of antigen detection tests for the diagnosis of tuberculosis. Clin. Vaccine Immunol. 8(10):1616-1627. Forrellad MA, Klepp LI, GioffrГ© A, Sabio y GarcГa J, Morbidoni HR, de la Paz Santangelo M, Cataldi AA, Bigi F (2013). Virulence factors of the Mycobacterium tuberculosis complex. Virulence 4(1):3-66. He XY, Li J, Hao J, Chen HB, Zhao YZ, Huang XY, He K, Xiao L, Ye LP, Qu YM, Ge LH (2011). Assessment of five antigens from Mycobacterium tuberculosis for serodiagnosis of tuberculosis. Clin. Vaccine Immunol.18(4):565-570. Ireton GC, Greenwald R, Liang H, Esfandiari J, Lyashchenko KP, Reed SG (2010). Identification of Mycobacterium tuberculosis antigens of high serodiagnostic value. Clin. Vaccine Immunol. 17(10):1539-1547. Kashyap RS, Ramteke SS, Gaherwar HM, Deshpande PS, Purohit HJ, Taori GM, Daginawala H (2010). Evaluation of BioFM liquid medium for culture of cerebrospinal fluid in tuberculous meningitis to identify Mycobacterium tuberculosis. Indian. J. Med. Microbiol. 28(4):366369. Kaushik A, Singh UB, Porwal C, Venugopal SJ, Mohan A, Krishnan A, Goyal V, Banavaliker JN (2012). Diagnostic potential of 16 kDa (HspX, О±-crystalline) antigen for serodiagnosis of tuberculosis. Indian. J. Med. Res. 135(5):771-777. Kunnath-Velayudhan S, Salamon H, Wang HY, Davidow AL, Molina DM, Huynh VT, Cirillo DM, Michel G, Talbot EA, Perkins MD, Felgner PL, Liang XW, Gennaro ML (2010). Dynamic antibody responses to the Mycobacterium tuberculosis proteome. Proc. Natl. Acad. Sci. U. S. A. 107(33):14703-14708. Marassi FM (2011). Mycobacterium tuberculosis Rv0899 defines a family of membrane proteins widespread in nitrogen-fixing bacteria. Proteins.79(10):2946-2955. Pym AS, Saint-Joanis B, Saint-Joanis B, Cole ST (2002). Effect of katG mutations on the virulence of Mycobacterium tuberculosis and the implication for transmission in humans. Infect. Immun. 70(9):49554960. Raynaud C, Papavinasasundaram KG, Speight RA, Springer B, Sander P, Bottger EC, Colston MJ, Draper P (2002). The functions of OmpATb, a pore-forming protein of Mycobacterium tuberculosis. Mol. Microbiol. 46(1):191-201. Rose MV, Kimaro G, Nissen TN, Kroidl I, Hoelscher M, Bygbjerg IC, Mfinanga SG, Ravn P (2012). QuantiFERONВ®-TB gold in-tube performance for diagnosing active tuberculosis in children and adults in a high burden setting. PLoS. One.7(7):e37851. Senol G, Ecevit C, OztГјrk A (2009). Humoral immune response against 38- and 16-kDa mycobacterial antigens in childhood tuberculosis. Pediatr. Pulmonol.44(9):839-844. Steingart KR, Flores LL, Dendukuri N, Schiller I, Laal S, Ramsay A, Hopewell PC, Pai M (2011). Commercial serological tests for the diagnosis of active pulmonary and extrapulmonary tuberculosis: an updated systematic review and meta-analysis. PLoS. Med. 8(8): e1001062. Steingart KR, Sohn H, Schiller I, Kloda LA, Boehme CC, Pai M, Dendukuri N (2013). XpertВ® MTB/RIF assay for pulmonary tuberculosis and rifampicin resistance in adults. Cochrane. Database. Syst. Rev.1:CD009593. Walzl G, Ronacher K, Hanekom W, Scriba TJ, Zumla A (2011). Immunological biomarkers of tuberculosis. Nat. Rev. Immunol. 11(5):343-354. Wang L, Liu J, Chin DP (2007). Progress in tuberculosis control and the evolving public-health system in China. Lancet. 369(9562):691-696. World Health Organization (WHO) (2011). Policy statement: commercial serodiagnostic tests for diagnosis of tuberculosis. WHO/HTM/TB/2011.5.WHO, Geneva, Switzerland. http://whqlibdoc.who.int/publications/2011/9789241502054_eng.pdf. Accessed 29 July 2011. Vol. 8(8), pp. 783-787, 19 February, 2014 DOI: 10.5897/AJMR2013.6186 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper An outbreak of ringworm caused by Trichophyton verrucosum in a group of calves in Vom, Nigeria Dalis, J. S.1*, Kazeem, H. M.2, Kwaga, J. K. P.3 and Kwanashie, C. N.2 1 Bacterial Research Division, National Veterinary Research Institute, Vom, Plateau State, Nigeria. Department of Microbiology, Faculty of Veterinary Medicine, Ahmadu Bello University, Zaria, Kaduna State, Nigeria. 3 Department of Veterinary Public Health and Preventive Medicine, Ahmadu Bello University, Zaria, Kaduna State, Nigeria. 2 Accepted 5 February, 2014 An outbreak of ringworm in young calves is reported from Vom in Nigeria. Twelve out of fourteen calves were observed to have skin lesions consistent with dermatophytosis. Lesions were seen mostly around the eyes and neck. Skin scrapings were collected from the affected areas and processed for mycology. Trichophyton verrucosum was isolated from all the affected calves. This study has shown that T. verrucosum can be a problem to watch for in calves in this particular environment, both as a zoonosis and economic importance as a result of damage to hides and skin. The need to study the prevalence of the disease among the cattle population in the state and country with a view to instituting preventive and control measures was emphasized. Key words: Dermatophytosis, outbreak, calves, Nigeria. INTRODUCTION Ringworm (dermatophytosis) is an infection of the superficial, keratinized structures of the skin and hair of man and animals. The disease is caused by a group of keratinophilic filamentous fungi called dermatophytes in the Genera Trichophyton, Microsporum and Epidermophyton (Gudding and Lund, 1995). Animals are infected by contact with arthrospores (asexual spores formed in the hyphae of the parasitic stage) or conidia (sexual or asexual spores formed in the “free living” environmental stage). Transmission between hosts usually occurs by direct contact with a symptomatic or asymptomatic host (Murray et al., 2005). It had been reported that housing animals in close proximity to each other for long periods in the presence of infected debris was responsible for the high incidence of the disease in winter (Al-Ani et al., 2002). However, the disease appears to be more common in tropical than temperate *Corresponding author. E-mail: [email protected]. climates, and particularly in countries or areas having hot and humid climatic conditions (Radostits et al., 1997). The typical lesion in cattle is a heavy, grayish-white crust that is raised perceptibly above the skin, affecting young calves’ more than adult cattle (Cam et al., 2007; Akbarmehr, 2011). Dermatophytosis had been considered the most common zoonosis worldwide, affecting more children than adults (Achterman and White, 2012). Studies on human skin infections revealed that dermatophytosis and other superficial fungal infections constitute a major public health problem in Nigeria (Adeleke et al., 2008). Whereas the literature is replete with information on human dermatophytoses (Ameh and Okolo, 2004; Adeleke et al., 2008; Nweze, 2010), very little information on animal ringworm have been documented in Nigeria. While there are some information on dermato- 784 Afr. J. Microbiol. Res. phytosis of goats (Chineme et al., 1980) and pet animals (Adekeye et al., 1989), to our knowledge, no studies on ringworm infection in cattle have been published from this country. This paper focuses on the outbreak of ringworm in a group of calves in Vom, Nigeria. MATERIALS AND METHODS Twelve out of fourteen (85.7%) calves aged between four and eight months were observed to have skin lesions consistent with dermatophytosis. The calves were kept indoors and in close contact with each other. They were fed concentrate and hay and allowed to suckle from their dams in the morning during milking. The dams and other adult cattle in the herd were physically examined for the presence of skin lesions. Skin samples were collected from infected animals by first disinfecting the affected area by cleaning it with cotton wool soaked in 70% ethyl alcohol. Skin scrapings were collected by scraping the margin of the lesions using sterile scalpel blade into sterile Petri dishes. Hair pullouts and crusts were also collected from the margin of the lesions as described by Robert and Pihet (2008). Each sample was divided into two parts. One part was used for direct microscopic examination while the second part was used for fungal isolation by culture. Direct microscopic examination A portion of each sample was placed on a clean glass slide containing a drop of 10% potassium hydroxide solution and covered with a cover slip. The slides were gently heated over a flame from a Bunsen burner and examined for the presence of arthrospores and hyphae under a light microscope. Fungal isolation and identification Each sample was inoculated onto Dermasel agar (OXOID) containing: Mycological peptone, 10.0 g/L; glucose, 20.0g/L; agar, 14.5g/L; cyclohexamide, 0.4g/L and chloramphenicol, 0.05g/L, pH 6.9, incubated at 37В°C for 2-4 weeks and examined for fungal growth. Identification of fungal isolates was carried out by both macroscopic and microscopic examination which included growth rate, general topography, surface and reverse pigmentation. Microscopic identification of positive fungal cultures was carried out using the method described by Murray et al. (2005). Briefly, a drop of lactophenol cotton blue stain was placed on a clean glass slide. A portion of mycelium was transferred into the lactophenol cotton blue stain and teased with a 22 gauge nichrome needle to separate the filaments. Cover slip was placed on the preparation and examined under low and high power magnification using a much reduced light for identification. RESULTS The skin of affected calves showed circular, circumscribed, grayish-white, thick, hairless, crusty raised lesions (Figure 1). The lesions were mostly seen on the head, face, around the eyes, neck and dewlap. No visible skin lesions were observed on the dams or other animals in the herd. All the 12 samples were positive for fungal elements (ectothrix spores and endothrix hyphae) by direct microscopic examination. The fungus grew slowly on Dermarsel agar producing white, cottony, heaped and slightly folded colonies with some submerge growth and yellow reverse pigment (Figure 2). Microscopic examination of isolates stained with lactophenol cotton blue revealed septate hyphae with numerous clavate microconidia borne laterally from the hyphae (Figure 3b), and many clamydospores arranged in chains (chains of pearls) characteristic of T. verrucosum (Figure 3b) DISCUSSION T. verrucosum was found to be responsible for the ringworm seen on 12 of the 14 calves in this study. Our report is significant as it suggests that dermatophytosis could be a major problem in cattle farms especially in young animals. This report agrees with previous findings (Cam et al., 2007; Shams-Gahfarokhi et al., 2009), that young animals are particularly susceptible to infection by ringworm fungi. This could be as a result of the poorly developed immune system and the high pH of the skin in young animals (Radostits et al., 1997). The diagnosis of ringworm in this study was based on clinical signs, demonstration of fungal elements in samples by direct microscopic examination and the isolation of causative agent by culture. T. verrucosum had been implicated in ringworm of cattle (Swai and Sanka, 2012; Cam et al., 2007). The main clinical signs observed among the affected calves were circular, circumscribed, grayish-white, thick crusty lesions perceptibly raised above the skin. The lesions were most frequently found on the head and neck especially around the eyes and face. These observations were in agreement with other reports (Cam et al., 2007; Akbarmehr, 2011). The reason for the occurrence of more lesions around the eyes and face in young animals is not well understood. However, the habit of licking and grooming by calves could predispose this part of the animal to infection. Our results showed that all the samples examined by direct microscopy were positive for fungi. Other researchers found out that direct microscopic examination could provide a positive diagnosis in 60-71% of samples from which dermatophytes were isolated (Sparkes et al., 1993; Al-Ani et al., 2002). In this study, the dermatophyte was isolated in pure culture suggesting that dermasel agar is a suitable selective medium for the isolation of pathogenic fungi. Colonies of T. verrucosum in this report were slow growing, white, cottony, heaped and slightly folded with some submerged growth and yellow reverse pigment. This observation is consistent with the findings of Forbes et al. (2002). In our investigation, microscopic examination revealed septated hyphae and microconidia that were attached laterally to the hyphae. There were numerous chlamydospores mostly in chains (chains of pearls). Dalis et al. 785 Figure 1. Ringworm lesions in a 4 month-old calf. Note thick, crusty, grayish-white lesions around the eye, face, ear and neck (arrow). This agrees with the report of Shams-Gahfarokhi et al. (2009) who observed chains of chlamydospores as predominant microscopic feature of the fungus in slide culture. Adult cattle had been reported to be less susceptible to the ringworm (Cam et al., 2007) and some of the dams could perhaps be carrying the infection without showing clinical sign and might be a source of infection for the calves. The soil, infected installations and even the house were the animals were kept could be other sources through which the animal could acquire infection since T. verrucosum is known to persist in the environment for 5-7 years and had been isolated from the soil (Gudding and Lund, 1995; Mahmoudabadi and Zarrin, 2008; Singh and Kushwaha, 2010). We do not know the actual source of infection for these animals because neither neither the healthy dams nor any of these materials were sampled and investigated in this study. The warm and humid climate of our environment could have favored the growth and development of fungal spores thereby predisposing the animals to infection and hence the outbreak in this highly susceptible population. Cattle ringworm causes high economic losses especially in the livestock and leather industries due to downgrading of hides and skin and decrease in meat and milk production (Gudding and Lund, 1995). In a survey of bovine dermatophytoses in major dairy farms of Mashhad City, Eastern Iran, T. verrucosum was the predominant dermatophyte isolated (Shams-Gahfarokhi et al., 2009). A large scale outbreak of the disease involving a dairy herd has recently been reported in Arusha region, Tanzania (Swai and Sanka, 2012). Several other outbreaks of ringworm affecting cattle herds and especially young calves had been documented in Australia (Maslem, 2000), China (Ming and Ti, 2006) and Italy (Papini et al., 2009). The major problem with T. verrucosum infection in cattle farms is that, once the disease is introduced into a farm, it spreads rapidly among susceptible animals. The organism is difficult to eradicate from the environment because of the peculiarity in composition of its spores. Treatment of cattle ringworm is expensive and cumbersome especially on a herd level (Gudding and Lund, 1995). This concern has prompted the need for effective prophylaxis against the disease as hygienic and other preventive measures were often inadequate (Rybnikar, 1992). Vaccination against bovine dermatophytosis had been 786 Afr. J. Microbiol. Res. Figure 2. Colonial morphology of T. verrucosum. Note: white, cottony, heaped and folded colony. a b Figure 3. Microscopic morphology of T. verrucosum showing microconidia borne laterally from the hyphae (a) and clamydoconidia in chains referred to as “chains of pearls” (b). considered the most effective way of controlling the infection (Rybnikar, 1992). Immunization of calves with live T. verrucosum was found to protect 90% of the vaccinated animals against T. verrucosum infection (Mikaili et al., 2012). A nationwide immunization program carried out in Norway where all cattle including none infected animals of all ages followed by vaccination of all calves and purchased animals reduced the prevalence of ringworm from 70% in the year the program started to 0% eight years later (Gudding and Lund, 1995; Mikaili et al., 2012). Ringworm is enzootic in Nigeria. However, the national prevalence of the disease in the cattle population in this country is yet to be determined. This study has revealed that T. verrucosum could be an important health problem in calves in this particular environment, both as a zoonosis and economic importance as a result of esthetic and damage to hides and skin. There is need to study and understand the disease among the cattle population in this country with a view to Instituting Dalis et al. prevention and control measures. ACKNOWLEDGEMENT We thank the Executive Director, National Veterinary Research Institute, Vom, Nigeria for permission to publish this work REFERENCES Achterman RR, White TC (2012). Dermatophyte virulence factors: identifying and analyzing genes that may contribute to chronic or acute infections. Int. J. Microbiol. 2012. pp. 1-8 Adekeye J, Ado P, Kwanashie CN, Adeyanju J, Abdullahi S (1989). Prevalence of animal dermatophytes in Zaria. Zariya Veterinarian, 4(1):84-86. Adeleke SI, Usman B, Ihesiulor G (2008). Dermatophytosis among itinerant Quranic scholars in Kano (Northwest) Nigeria. Nig. Med. Pract. 53(3):33-35. Akbarmehr J (2011). The prevalence of cattle ringworm in native dairy farms of Sarab city (East Azarbayjan Province) in Iran. Afr. J. Microbiol. Res. 5(11): 1268-1271. Al-Ani FK, Younes FA, Al-Rawashdeh OF (2002). Ringworm Infection in Cattle and Horses in Jordan. Acta. Vet. Brno. 71: 55-60. Ameh IG, Okolo RU (2004). Dermatophytosis among school children: domestic animals as predisposing factor in Sokoto, Nigeria. Pak. J. Biol. Sci. 7(7):1109-1112. Cam Y, GГјmГјssoy KS, Kibar M, Apaydin N, Atalay Г– (2007). Efficacy of ethylenediamine dihydriodise for the treatment of ringworm in young cattle. Vet. Rec. 160: 408-410. Chineme CN, Adekeye JO, Bida SA (1980). Trichophyton verrucosum in young goats. Bull. Anim. Hlth. Prod. 29: 75-78. Forbes BA, Sahm DF Weissfeld AS (2002). Laboratory Methods in th Basic Mycology. In Bailey and Scott’s Diagnostic Microbiology 11 edition, Mosby Inc, 11830 West line Industrial Drive St. Louis, Missouri 63146, U S A. Gudding R, Lund A (1995). Immunoprophylaxis of bovine dermatophytosis. Can. Vet. J. 36:302-306 Mahmoudabadi AZ, Zarrin M (2008). Isolation of dermatophytes and related kerationophilic fungi from the two Public Parks in Ahvaz. Jundishapur J. Microbiol. 1(1):20-23. Maslen MM (2000). Human cases of cattle ringworm due to Trichophyton verrucosum in Victoria, Australia. Australian J. Dermatol. 42: 1-4. Mikaili A, Chalabi M, Ghashghaie A, Mostafaie A (2012). Immunization against bovine dermatophytosis with live Trichophyton verrucosum. Afr. J. Microbiol. Res. 6 (23):4950-4953. Ming PX, Ti YL, Bulmer GS (2006). Outbreak of Trichophyton verrucosum in China transmitted from cows to humans. Mycopath. 161: 225-228. Murray PR, Rosenthal KS, Pfaller MA (2005). Superficial and cutaneous th mycosis. In: Medical Microbiology, 5 edition. Philadelphia, USA, pp. 745-751. Nweze EI (2010). Dermatophytosis among children of Fulani/Hausa herdsmen living in Southeastern Nigeria. Rev. Iberoam. Micol. 27(4):191-194. 787 Papini R, Nardoni S, Fanelli A, Mancianti F (2009). High infection rate of Trichophyton verrucosum in calves from Central Italy. Zoonoses Pub. Hlth. 56(2): 59-64. Radostits OM, Blood DC, Gay CC (1997). Veterinary Medicine, 8th Ed, Bailliere Tindall, London,pp. 381-39. Robert R, Pihet M (2008). Conventional methods for the diagnosis of dermatophytosis. Mycopath. 166: 295-306. Rybnikar A (1992). Cross-immunity in calves after vaccination against trichophytosis. Acta Vet. Brno. 61:189-194. Shams-Gahfarokhi M, Mosleh TF, Ranjbar BS, Razzaghi AM (2009). An epidemiological survey on cattle ringworm in major dairy farms of Mashad city, Eastern Iran. I. J, M. 1(3): 31-36 Singh I, Kushwaha RKS (2010). Dermatophyte and related keratinophlic fungi in soil of Parks and Agricultural Fields of Uttar Pradesh, India. Indian J. Dermatol. 53(3):306-308. Sparkes AH, Gruffy TJ, Shaw SE, Wright AI, Stokes CR (1993). Epidemiological and diagnostic features of canine and feline dermatophytosis in the United Kingdom from 1956 to 1991. Vet. Rec . 133: 57-61. Swai ES, Sanka PN (2012). Bovine dermatophytosis caused by Trichophyton verrucosum: a case report. Vet. World 5(5):297-300 Vol. 8(8), pp. 788-796, 19 February, 2014 DOI: 10.5897/AJMR2013.6518 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper Characteristics of nodule bacteria from Mimosa spp grown in soils of the Brazilian semiarid region Ana Dolores Santiago de Freitas1*, Wardsson Lustrino Borges2, Monaliza Mirella de Morais Andrade1, Everardo Valadares de SГЎ Barretto Sampaio 3,Carolina Etienne de RosГЎlia e Silva Santos1, Samuel Ribeiro Passos4, Gustavo Ribeiro Xavier4, Bruno Mello Mulato4 and Maria do Carmo Catanho Pereira de Lyra5 1 Universidade Federal Rural de Pernambuco (UFRPE), Recife-PE, Brazil. 2 Embrapa AmapГЎ, MacapГЎ-AP, Brazil. 3 Universidade Federal de Pernambuco (UFPE), Recife-PE, Brazil. 4 Embrapa Agrobiologia, SeropГ©dica-RJ, Brazil. 5 Instituto AgronГґmico de Pernambuco (IPA), Recife-PE, Brazil. Accepted 13 January, 2014 The Brazilian Northeastern dry forest (Caatinga) is one of the diversification centers of Mimosa species. We determined the characteristics of native rhizobia isolates from nodules of Mimosa tenuiflora and Mimosa paraibana grown in pots with soils collected under Caatinga vegetation and compared the restriction ribosomal DNA profiles of the isolates with those of 16 reference strains. All plants formed abundant indeterminate nodules and all nodule isolates formed fast growing colonies. No colony altered the medium to an alkaline reaction and most of them produced low or medium amounts of extracellular polysaccharides. White and creamy colonies predominated among the isolates but orange and green colonies were present. Differences among the isolates from the Mimosa species tested are indicated by the greater phenotypic diversity of those obtained from M. tenuiflora. The analysis of the 16S rDNA gene suggests that the isolates from M. tenuiflora and M. paraibana are closely related and closer to пЃўrhizobia than to О±-rhizobia. However, the similarity with all the tested пЃў-rhizobia reference strains was relatively low suggesting that the isolates may belong to different bacteria species. Key words: Biological nitrogen fixation, diversity, rhizobia, wild tree legumes. INTRODUCTION Legume species belonging to the genus Mimosa have received considerable attention in recent years because of their potential to fix large proportions of their nitrogen from the atmosphere (Freitas et al., 2010) and because of their preferential association with пЃў-rhizobia (Chen et al., 2005; Barrett and Parker, 2006; Bontemps et al., 2010; Elliott et al., 2009; Reis Jr et al., 2010; Liu et al., 2012). Mimosa is one of the richest Leguminosae genera, with over 500 species, mostly neotropical, occupying diverse habitats, including lowland tropical rainforest, savanna, tropical and subtropical dry forest and thorn scrub, mid-elevation subtropical forest, desert, grassland, and wetland (Simon et al., 2011). One of the diversification centers of Mimosa is the Brazilian Northeastern dry forest (Simon et al., 2011), locally called Caatinga. The Caatinga represents the largest and most isolated of the South American dry 2 forests. It covers more than 850,000 km (Albuquerque et *Corresponding author. E-mail: [email protected]. Tel: 55-81-32692660, 55-81-33206237. Fax: 55-81-33206200. de Freitas et al. al., 2012), from 02В°50’S at its northern limits, to 17В°20’S with a variety of different types of vegetation (Queiroz 2006). Caatinga occurs under a prevailing semi-arid climate, with a high evapotranspiration potential (1500 to -1 2000 mm year ) and a low precipitation (300 - 1000 mm -1 year ) that is usually concentrated within 3 to 5 months (Queiroz 2006). The region is rich in legume species, with more than 293 speies in 77 genera, many of them endemic ones (Queiroz et al., 2009). Few of these species were studied in relation to their potential to fix nitrogen and to their microsymbionts (Freitas et al., 2010; Teixeira et al., 2010). Mimosa paraibana Barneby and Mimosa tenuiflora (Willd.) Poir. are leguminous tree species with great nitrogen fixation capacity mean contributions of biological fixation for plant nitrogen reaching up to 50% in Caatinga (Freitas et al., 2010). M. tenuiflora is a species of wide distribution, occupying dry areas of Brazil to Mexico, Honduras and El Savador (Queiroz et al., 2009). This species is the main pioneer species in areas of caatinga with few years of regeneration (Souza et al., 2012). Its preferred symbionts are apparently ОІ-proteobacteria, belonging to the genus Burkholderia (Bontemps et al., 2010; Reis Jr et al., 2010). Moreover, M. paraiba is a species endemic to Northeast Brazil (Queiroz et al., 2009) and there is no studies on bacteria capable of forming symbiotic nodules on their roots. Research on Mimosa rhizobia have been conducted in several regions of Brazil (Chen et al., 2005; Barrett and Parker, 2006; Elliott et al., 2009; Liu et al., 2012). Isolation of rhizobia populations from Caatinga soils has been relatively rare (Bontemps et al., 2010; Reis Jr et al., 2010; Teixeira et al., 2010), mainly considering the diversity of environmental conditions in the region, that can affect the structure of rhizobia populations (Mishra et al., 2012). Moreover, most of this research centered on genetic characteristics and only Teixeira et al. (2010) described cultural characteristics of the rhizobia. Therefore, the diversity of bacteria able to nodulate Mimosa species in the region is little known. Considering this scarcity of information, we characterized Caatinga native rhizobia associated to two Mimosa species in relation to their cultural traits and compared the restriction profiles of their amplified ribosomal DNA (16S rDNA-ARDRA) with those of 16 reference strains. MATERIALS AND METHODS Soil sampling and Mimosa spp. cultivation Composite soil samples from the 0 to 20 cm superficial layer were collected in areas of preserved Caatinga vegetation in three municipalities, with different climate conditions (Table 1): 1) Santa Terezinha, in the sertГЈo zone of ParaГba state; 2) RemГgio, in the agreste zone of this same state; and 3) Serra Talhada, in the sertГЈo zone of Pernambuco state. The composition and structure of the vegetation in the three areas were described by Ferraz et al. 789 (2003), Souza (2010) and Pereira et al. (2003), respectively. Number of species and tree heights and stem diameters are higher in the agreste zone than in the sertГЈo zone and in this last zone higher in Serra Talhada than in Santa Terezinha, probably reflecting higher water availability. Soil subsamples were analyzed for some chemical and physical characteristics (Table 2), following the methodology described by Embrapa (1997). The samples were dried, passed through a 6 mm mesh sieve and portions of 1 kg were placed in pots maintained under greenhouse conditions. Seeds of two Mimosa species (Mimosa tenuiflora (Willd.) Poir. and Mimosa paraibana Barneby) were collected from a single mother tree in RemГgio caatinga. The seeds were surface disinfected in etanol (70% v/v - 3 min) and sodium hypochlorite (1 % v/v - 3 min), rinsed five times with sterile distilled water, rolled onto YMA plates to test for surface sterility and then were sown in the pots. Each legume species was sown in triplicate for each soil sample. The pots received 100 ml of nutrient solution without nitrogen (Hoagland and Arnon, 1939) every week until harvest, 120 days after seed germination. At harvest the root nodules were separated, dehydrated in silica gel and stored. Isolation and phenotypic characterization of rhizobia Rhizobia were isolated from the nodules in yeast mannitol agar medium (YMA, pH 6.8) (Vincent, 1970) with 25 mg kg-1 (w/v) of Congo red. The typical rhizobia colonies were purified and stored at -20В°C, in microtubes with 1 ml YM medium(YMA without agar) plus 15% sterilized glycerol. Isolates colonies in YMA with 25 mg kg-1 (w/v) bromethymol blue as pH indicator (Fred and Waksman, 1958) were observed for the following characteristics: growth period, pH alteration of growth medium, colony morphology (shape, size, border, transparency, surface) and amount of extracellular polysaccharides (EPS) (Xavier et al., 1998). These characteristics were converted to binary data employed in a cluster analysis using the UPGMA (Unweighted Pair Group Method Using Arithmetic Averages) algorithmand the Jaccard similarity index. The results of the cluster analysis were used to calculate richness (Taxa S and Margalef), diversity (Shannon H), dominance (Simpson 1-D) and uniformity (Equitability J) indices for the soils and species, where each morphological group, at 60% of the similarity (Jesus et al., 2005), was considered as one operational taxonomic unit. The Past (palaeontological statistics) program was used to perform cluster analysis and diversity indices calculation (Hammer et al., 2001). Restriction analysis (ARDRA) and reference strains DNA isolation, 16S rDNA gene amplification and restriction analysis of ribosomal DNA (ARDRA) using HinfI, MspI and DdeI endonucleases were prepared according to Teixeira et al. (2010). Twenty eight new strains were randomly selected (19 from M. paraibana and 9 from M. tenuiflora) and compared with 16 strains from Embrapa Agrobiologia bacterial diazotrophic collection: BR 7801 (Mesorhizobium loti), BR 527 (Sinorhizobium terangae), BR 7606 (Rhizobium leguminosarum bv trifoli), BR 2811 (Bradyrhizobium elkani), BR 114 (Bradyrhizobium japonicum), BR 5401 (Azospirilum doberaneae), BR5410 (Azorhizobium caulinodans), BR 2006 (Methylobacterium nodulans), BR 3407 (Burkholderia sabiae), BR 3437 (Burkholderia nodosa), BR 3454 (Burkholderia mimosarum), BR 3467 (Burkholderia mimosarum), BR 3471 (Cupriavidus taiwanensis), BR 3486 (Burkholderia phymatum), BR 3487 (Burkholderia tuberum) and BR 3498 (Burkholderia caribensis). The restriction fragment profiles were used to perform a cluster analysis using the Jaccard index, the UPMGA algorithm and the GelCompar II (Applied Maths) program. 790 Afr. J. Microbiol. Res. Table 1. General characteristics of preserved Caatinga areas in three municipalities, in the States of ParaГba (PB) and Pernambuco (PE), Brazil. Characteristic Coordinates Altitude (m) Annual rainfall (mm) Months with water deficit Average temperature (в—¦C) Santa Teresinha (PB) 07Вє03'S and 37Вє29'W 380 824 9 - 10 26 Municipality (state) RemГgio (PB) 6В°52’S and 35В°47’W 596 700 4-5 22 Serra Talhada (PE) 07Вє59'S and 38Вє18'W 500 768 6-7 24 Table 2. Soil characteristics of preserved Caatinga areas in three municipalities, in the States of ParaГba (PB) and Pernambuco (PE), Brazil. Soil characteristic Classification pH (water) P (mg dm -3) N (%) C (%) Sand (g kg-1) Silt (g kg-1) Clay (g kg-1) Santa Teresinha (PB) Litholic Neosol 8.8 7.3 0.07 0.73 623 224 153 (A) Municipality (state) RemГgio (PB) Regolithic Neosol 4.4 8.4 0.08 0.96 725 122 153 Serra Talhada (PE) Luvisol 6.8 4.9 0.10 1.09 651 227 122 (B) Figure 1. Shape of nodules found in Mimosa paraibana (A) and M. tenuiflora (B) roots from plants grown in soils collected under mature Caatinga vegetation. RESULTS Mimosa spp. nodulation All harvested plants, cultivated in all three soils, had nodules of indeterminate growth with dark red interior and sizes up to 3 cm in diameter (Figure 1). Sixty one isolates were obtained from the nodules of M. paraibana and 62 from the nodules of M. tenuiflora. All isolates developed very fast, in less than 24 h, and formed circular colonies in the YMA medium. Phenotypic characteristics of rhizobia isolates No isolate changed the medium pH to an alkaline reaction. Most of the isolates obtained from M. tenuiflora changed the medium pH to an acid reaction: 96% when de Freitas et al. Isolates (%) Acid A Neutral 100 90 80 70 60 50 40 30 20 10 0 MT MP MT Santa Teresinha Isolates (%) 791 None 100 90 80 70 60 50 40 30 20 10 0 MT MP MP RemГgio Low Moderate MT Santa Teresinha MP RemГgio MT MP Serra Talhada B Copious MT MP Serra Talhada Figure 2. pH change (A) and amount of extracellular polysaccharides (EPS) production (B) in YMA medium of bacterial nodule isolates from Mimosa tenuiflora (MT) and M. paraibana (MP) grown in soils collected under mature Caatinga vegetation. when grown in the soil from Santa Terezinha, 75% in the soil from RemГgio and 68% in the soil from Serra Talhada (Figure 2). Most of the isolates from M. paraibana grown in the soil from Serra Talhada (62%) also changed the pH to an acid reaction but the proportions were lower in the soils from Santa Terezinha (48%) and RemГgio (35%). Most of the colonies had a cream color (74% of those from M. tenuiflora and 67% from M. paraibana) but there were also white, orange and green colonies. At 48 h in YMA, the most common diameters of colonies from M. tenuiflora were punctiform (29%), 3 mm (19%) and 4 mm (16%) while those from M. paraibana were 2 mm (31%), punctiform (23%) and 1 mm (21%). Among the isolates from M. tenuiflora, the highest proportion (30 to 40% in the three soils) produced colonies with moderate amounts of extracellular polysaccharides (EPS), 26% were dry colonies and only in the colonies originating from the Santa Terezinha soil the proportion of high EPS producers (46%) surpassed the proportion of moderate producers (Figure 2). Among the isolates from M. paraibana most (30 to 95%) produced low amounts of EPS, except in the Santa Terezinha soil where the proportion of colonies with copious amounts of EPS was also high (48%). The isolates from M. tenuiflora were classified into 19 phenotypic groups and those of M. paraibana into 16 792 Afr. J. Microbiol. Res. Figure 3. Phenotipic similarity dendrogram among M. tenuiflora (A) and M. paraibana (B) nodule isolates froms oils of preserved Caatinga. The letters MT and MP indicates the isolates from M. Tenuiflora and M. Paraibana respectively. The letters M P, R and S indicates isolates native from soils of Santa Terezinha, RemГgio and Serra Talhada (municipalities in the States of ParaГba (PB) and Pernambuco (PE), Brazil.), respectively. groups (Figure 3). Eight groups from each plant species were composed of a single isolate which can be considered to belong to different or rare types. The isolates from M. paraibana had a tendency to group according to the soil, mainly the isolates originating from the soil of Santa Terezinha, 23 of them clustering into four groups exclusive of isolates from the soil of this area (Figure 3B). On the other hand, the isolates from M. tenuiflora had no clear tendency to group according to the soil. Richness, diversity and equitability were higher among de Freitas et al. 793 Figure 4. Taxa S, Margalef, Shannon H, Simpson 1-D and Equitability J indices for bacterial nodule isolates from Mimosa tenuiflora (MT) and M. paraibana (MP) grown in soils collected under Mature Caatinga vegetation. the isolates from M. tenuiflora than from M. paraibana (Figure 4). For the first species, the order of isolate diversity for the soils was Santa Terezinha, RemГgio and Serra Talhada while for the second species it was the inverse order. Restriction analysis (ARDRA) cluster Four large groups (Figure 5) were formed in the cluster analysis based on the restriction analysis of ribosomal DNA (ARDRA). One group was composed of 26 out of 28 of the new isolates, both from M. paraibana (17 out of 19 total new isolates) and from M. tenuiflora (9 new isolates). The second group was somewhat related to the first group and was composed mostly of strains typical of пЃў-rhizobia genera. The third group was composed of strains of the type typical of О±-rhizobia genera. The fourth group included only two isolates from M. paraibana (MPS5 and MPS10) and had a low similarity with both the пЃў-rhizobia and the О±-rhizobia groups. Two pairs of isolates (MPS 19 and MTP 16-2; MPS 17 and MPS 12) and one groups of five isolates (MPS1, MPS6, MPS7, MPS8 and MPS9) from M. paraibana had 100% similarity. DISCUSSION Mimosa spp. nodulation The spontaneous nodulation of M. paraibana and M. tenuiflora indicates the presence, in the three soils, of native populations of bacteria able to colonize the roots of both plant species. Ample populations of nodulating bacteria are common in the soils of the regions where the legume species are native. On the other hand, nodulation frequently fails when a legume species is planted outside its original region (Bala et al., 2003; Souza et al., 2007). M. tenuiflora has a large distribution in tropical dry forests, from Brazil to Mexico (Queiroz et al., 2009) and naturally occurs in the three Caatinga fragments where the soils were collected (Ferraz et al., 2003; Pereira et al., 2003; Souza, 2010). M. paraibana has a more restricted distribution, being endemic to the Caatinga, and spontaneously occurs only in the Caatinga fragment of RemГgio (Pereira et al., 2003). In spite of that, it also nodulated when planted in the soil of the two other areas. There is no information on the natural occurrence of rhizobia populations able to form symbiosis with the several Mimosa species growing in soils of the Brazilian semiarid, but the spontaneous nodulation of M. paraibana indicates that this occurrence may be quite general. These species may also be very promiscuous, nodulating with a large spectrum of microsymbionts, as observed for M. pudica (Bontemps et al., 2010). The nodules of M. tenuiflora and M. paraibana were indeterminate, as has been described for those of other Mimosoideae legumes. Indeterminate nodules, with a wide range of size, formats and ramifications are usually attributed to species of Mimosoideae (Sprent et al., 2007), without influence of the microsymbionts (Lammel et al., 2007).However, some of the nodules grew more than usually reported (Patreze and Cordeiro, 2004), reaching more than 20 mm in their longest axis (Figure 1). M. paraibana is one of the endemic species of 794 Afr. J. Microbiol. Res. Figure 5. Genetic similarity dendrogram among 28 bacterial nodule isolates from Mimosa tenuiflora (MT) and M. paraibana (MP) grown in soils collected under mature Caatinga vegetation and 16 О±- and пЃў-reference rhizobia strains based on PCR-ARDRA of the 16S rDNA gene. de Freitas et al. caatinga that only recently was identified as capable of fixing nitrogen (Freitas et al., 2010) and the description of its nodules is being reported for the first time. Phenotypic characteristics of rhizobia isolates The growing interest on microsymbionts associated to Mimosa spp. has resulted in a large number of articles on the subject (Chen et al., 2005; Barrett and Parker, 2006; Bontemps et al., 2010; Elliott et al., 2009; Reis Jr et al., 2010; Liu et al., 2012). However, few of these articles describe the characteristics of the culture colonies formed by these symbionts. Recently, Teixeira et al. (2010) observed that all the isolates obtained from nodules of M. tenuiflora grown in a soil from a Caatinga area (Petrolina, Pernambuco State, Brazil) had a rapid development and acidified the medium and that most of them produced a large quantity of EPS. Fast-growing acid-producing rhizobia are the most common symbionts of several African and Asian wild tree legumes (Wolde-Meskel et al., 2004; Shetta et al., 2011). The isolates obtained from M. paraibana and M. tenuiflora cultivated in the soils from Serra Talhada, Santa Terezinha and RemГgio also had rapid development but, contrasting with the African isolates, some of them did not modify the YMA culture medium (51% of the M. paraibana isolates and 19% of the M. tenuiflora isolates). Large production of EPS was only observed in 17 isolates (20% of all the M. paraibana isolates and 8% of the M. tenuiflora isolates). Rapid growth is a common characteristic of native isolates from the Brazilian semiarid region obtained from nodules of several species (Teixeira et al., 2010; Medeiros et al., 2009). Usually, isolates of rapid development do not form dry colonies (Teixeira et al., 2010) but this was the case in 16% of the isolates from M. tenuiflora and 6% of the isolates from M. paraibana (Figure 2). White, creamy or translucent colonies are commonly formed by bacteria associated with wild tree legumes such as Acacia spp. (Wolde-Meskel et al., 2004), Millettia pinatta (Rasul et al., 2012) and Mimosa tenuiflora (Teixeira et al., 2010). White and creamy colonies also predominated among the isolates from M. tenuiflora and M. paraibana but orange and green colonies were also present. Considering that descriptions of colonies formed by rhizobia associated to Mimosa spp. are scarce (Chen et al., 2005; Bontemps et al., 2010; Reis Jr et al., 2010; Teixeira et al., 2010), it is difficult to evaluate the frequency of these phenotypes. Medeiros et al. (2009) reported that punctiform colonies are commonly formed by isolates from nodules of Vigna unguiculata cultivated in soils from Caatinga areas. Cowpea associates with a large diversity of rhizobia and due to this characteristic it is frequently used as a trap culture (Melloni et al., 2006; Medeiros et al., 2009). However, only 29 and 23% of the isolates from the nodules of M. tenuiflora and M. paraibana formed this 795 type of colony. Therefore, the bacteria associated with M. paraibana and M. tenuiflora seem to differ, from a certain extent, from those described in native rhizobia collections obtained from soils of the region using cowpea as a trap culture. Mishra et al. (2012) demonstrated that different legume species can form associations with different rhizobia populations, in spite of being cultivated in the same soils. The wide phylogenetic distance from cowpea and Mimosa species, belonging to two distinct legume subfamilies (Papilionoidea and Mimosoidea), may explain part of the difference in their microsymbionts. Differences among the isolates from the two Mimosa species tested are indicated by the greater phenotypic diversity of those obtained from M. tenuiflora (Figure 4). This species may establish symbiosis with a larger array of rhizobia species, and this could be explained by its larger spatial distribution which may determine different patterns of co-evolution with the microsymbionts. Analysis of the 16S rDNA gene The analysis of the 16S rDNA gene suggests that the isolates from M. tenuiflora and M. paraibana are closely related, independently from the soil of cultivation, clustering in the first group of the dendrogram (Figure 5). All isolates show the same phenotypic characteristics of mucus production, acid or neutral reaction and homogeneous and circular colonies. Other characteristics such as differences in color of colonies and amount of mucus generated clustering on phenotypic dendrograms that cannot be observed in the genetic analysis. They were also closer related to пЃў-rhizobia than to О±-rhizobia, corroborating previous reports of prevalence of this group among species of the Mimosoideae subfamily (Chen et al., 2005; Reis Jr et al., 2010). However, the similarity with all the tested пЃў-rhizobia reference strains was relatively low. Two isolates (MPS5 and MPS10) are clustered apart these two groups. According to their position they could be alpha that were not well resolved by the analysis, or another class of proteobacteria. Conclusion The results demonstrate that the bacteria populations from the nodules of Mimosa spp. species native from the soils of the semiarid Brazilian region have cultural characteristics different from those obtained from the same soils but using other legume species as trap plants. In spite of fast growth, the isolates can form from dry colonies to colonies with large production of EPS. The isolates are more related to пЃў-rhizobia than to О±-rhizobia, but the low similarity with the strains from the Embrapa collection suggests that the rhizobia isolated from the nodules of M. tenuiflora and M. paraibana are different bacteria species. 796 Afr. J. Microbiol. Res. REFERENCES Albuquerque UP, AraГєjo EL, El-Deir ACA, et al. (2012) Caatinga revisited: ecology and conservation of an important seasonal dry forest, The Scientific World Journal: 18 p. Bala A, Murphy PJ, Osunde AO, Giller KE (2003).Nodulation of tree legumes and the ecology of their native rhizobial populations in tropical soils. Appl. Soil Ecol. 22:211-223. Barrett CF, Parker MA (2006). Coexistence of Burkholderia, Cupriavidus, and Rhizobium sp. nodule bacteria on two Mimosa spp. in Costa Rica. Appl. Environ. Microbiol. 77:1198-1206. Bontemps C, Elliott GN, Simon MF, Reis Jr FB, Gross E, Lawton RC, Elias Neto N, Loureiro MF, Faria SM, Sprent JI, James EK, Young JPW (2010). Burkholderia species are ancient symbionts of legumes. Mol. Ecol. 19:44-52. Chen WM, Faria SM, Straliotto R, Pitard RM, AraГєjo JLS, Chou JH, Chou YJ, Barrios E, Prescott AR, Elliott GN, Sprent JI, Young JPW, James EK (2005). Proof that Burkholderia strains form effective symbioses with legumes: a study of novel Mimosa-nodulating strains from South America. Appl. Environ. Microbiol. 71:7461-7471. Elliott GN, Chou JH, Chen WM, Bloemberg GV, Bontemps C, MartГnezRomero E, VelГЎzquez E, Young JPW, Sprent JI, James EK (2009).Burkholderia spp. are the most competitive symbionts of Mimosa, particularly under N-limited conditions. Environ. Microbiol. 11(4):762-778. EMBRAPA - Embrapa Brasileira de Pesquisa AgropecuГЎria (1997). Manual de mГ©todos de anГЎlise de solos, Embrapa, Rio de Janeiro. Ferraz EMN, Rodal MJ, Sampaio EVSB (2003).Physiognomy and structure of vegetation along an altitudinal gradient in the semi-arid region of northeastern Brazil. Phytocoenologia 33:71-92. Fred EB, Waksman SA (1958) Laboratory manual of general microbiology. Mc Grow Hill, New York. Freitas ADS, Sampaio EVSB, Fernandes AR, Santos CERS (2010). Biological nitrogen fixation in legume trees of the Brazilian Caatinga. J. Arid Environ. 74:344-349. Hammer Г�, Harper DAT, Ryan PD (2001). Past: paleontological statistics software package for education and data analysis. Palaeontologia Electronica 4:1-9 Hoagland DR, Arnon DI (1939). The water culture method growing plants without soil. U Calif Agric Exp Sta, California. Jesus EC, Moreira FMS, Florentino LA, Rodrigues MID, Oliveira MS (2005). Diversidade de bactГ©rias que nodulam siratro em trГЄs sistemas de uso da terra da AmazГґnia Ocidental. Pesq. Agropecu. Bras. 40:769-776. Lammel DR, Brancalion PHS, Dias CTS, Cardoso EJBN (2007). Rhizobia and other legume nodule bacteria richness in brazilian Araucaria angustifolia forest. Sci. Agric. 64(4):400-408. Liu XY, Wei1 S, Wang F, James EK, Guo XY, Zagar C, Xia LG, Dong X, Wang YP (2012).Burkholderia and Cupriavidus spp. are the preferred symbionts of Mimosa spp. in Southern China. FEMS Microbiol. Ecol. 80:417-426. Medeiros EV, Martins CM, Lima JAM, Fernandes YTD, Oliveira VR, Borges WL (2009). Diversidade morfolГіgica de rizГіbios isolados de caupi cultivado em solos do Estado do Rio Grande do Norte. Acta. Sci. Agron. 31(3):529-535. Melloni R, Moreira FMS, NГіbrega RSA, Siqueira JO (2006). EficiГЄncia e diversidade fenotГpica de bactГ©rias diazotrГіficas que nodulam caupi (Vigna unguiculata (L.) Walp) e feijoeiro (Phaseolus vulgaris L.) em solos de mineração de bauxita em reabilitação R. Bras. Ci. Solo. 30:235-246. Mishra RPN, Tisseyre P, Melkonian R, Chaintreuil C, MichГ© L, Klonowska A, Gonzalez S, Bena G, Laguerre G, Moulin L. (2012). Genetic diversity of Mimosa pudica rhizobial symbionts in soils of French Guiana: investigating the origin and diversity of Burkholderia phymatum and other beta-rhizobia. FEMS Microbiol. Ecol. 79:487503. Patreze CM, Cordeiro L (2004). Nitrogen-fixing and vesicular arbuscular mycorrhizal symbioses in some tropical legume trees of tribe Mimoseae. Forest Ecology and Management. 196: 275-285. Pereira IM, Andrade LA, Sampaio EVSB, Barbosa MRV (2003). Usehistory effects on structure and flora of Caatinga. Biotropica. 35:154165. Queiroz LP (2006). The Brazilian Caatinga: phytogeografical patterns inferred from distribution data of the Leguminosae. In: Pennington T, Lewis GP, Ratter JA (eds) Neotropical Savannas and Seasonally Dry Forests Plant Diversity, Biogeography and Conservation, CRC Press,New York, pp 121-157. Queiroz LP (2009). Leguminosas da Caatinga, Universidade Estadual de Feira de Santana, Royal Botanic Gardens Kew, Associação Plantas do Nordeste, Feira de Santana. Rasul A, Amalraj ELD, Kumar GP, Grover M, Venkateswarlu B (2012). Characterization of rhizobial isolates nodulating Millettia pinnata in India. FEMS Microbiol. Lett. 336:148-158. Reis Jr FB, Simon MF, Gross E, Boddey RM, Elliott GN, Neto NE, Loureiro MF, Queiroz LP, Scotti MR, Chen WM, NorГ©n A, Rubio MC, Faria SM, Bontemps C, Goi SR, Young JPW, Sprent JI, James EK (2010). Nodulation and nitrogen fixation by Mimosa spp. in the Cerrado and Caatinga biomes of Brazil. New Phytol. 186:934-946. Shetta ND, Al-Shaharani TS, Abdel-Aal M (2011). Identification and characterization of Rhizobium associated with woody legume trees grown under Saudi Arabia condition. Am. Eurasian J. Agric. Environ. Sci. 10:410-418. Simon MF, Grether R, Queiroz LP, SГ¤rkinen TE, Dutra VF, Hughes CE (2011). The evolutionary history of Mimosa (Leguminosae): toward a phylogeny of the sensitive plants. Am. J. Bot. 98(7):1201-1221. Souza LAG, Bezerra Neto E, Santos CERS, Stamford NP (2007). Desenvolvimento e nodulação natural de leguminosas arbГіreas em solos de Pernambuco. Pesq Agropec Bras. 42(2):207-217. Souza LQ (2010). Fitossociologia em ГЎreas com diferentes histГіricos de uso e fixação biolГіgica de nitrogГЄnio em Caatinga madura na ParaГba. M.Sc. dissertation, Universidade Federal de Pernambuco, Brazil. Souza LQ, Freitas, ADS, Sampaio EVSB, Moura PM, Menezes RSC (2012). How much nitrogen is fixed by biological symbiosis in tropical dry forests? 1. Trees and shrubs. Nutr. Cycl. Agroecosist. 94:171179. Sprent JI (2007). Evolving ideas of legume evolution and diversity: a taxonomic perspective on the occurrence of nodulation. New Phytol. 174:11-25. Teixeira FCP, Borges WL, Xavier GR, Rumjanek NG (2010). Characterization of indigenous rhizobia from caatinga. Braz J Microbiol. 41:201-208. Vincent JM (1970). A manual for the practical study of root nodule bacteria, Blackkwell Scientific, Oxford. Wolde-Meskel E, Berg T, Peters NK, Frostegard A (2004) Nodulation status of native woody legumes and phenotypic characteristics of associated rhizobia in soils of southern Ethiopia. Biol. Fertil. Soils. 40:55-66. Xavier GR, Martins LMV, Neves MCP, Rumjanek NG (1998). Edaphic factors as determinants for the distribution of intrinsic antibiotic resistance in a cowpea rhizobia population. Biol. Fertil. Soils. 27:386392. Vol. 8(8), pp. 797-802, 19 February, 2014 DOI: 10.5897/AJMR2013.6527 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper Microbiological assessment of dentists’ hands in clinical performance MГЎrcia Rosental da Costa CARMO1*, Jorge Kleber CHAVASCO1, Solange de Oliveira Braga FRANZOLIN2, Luiz Alberto BEIJO1, JГєlia Rosental de SOUZA CRUZ3 and Paulo Henrique WECKWERTH2 1 Universidade Federal de Alfenas – Unifal-MG, Rua Gabriel Monteiro da Silva, 700. Centro. 37.130-000 Alfenas- MG. Brazil. 2 Universidade Sagrado Coração – USC-Bauru, SГЈo Paulo, Brazil. 3 AcadГЄmica da Universidade Federal de Alfenas – Unifal-MG, Alfenas-MG, Brazil. Accepted 30 January, 2014 This study verified the presence of opportunist pathogenic bacteria in the hands of Surgeons Dentists. Biological materials were collected from the hands of 41 professionals, randomly selected. The professional washed his/her hands for around 30 s in a sterile plastic bag, filled with 250 mL of physiologic serum, in three distinct times: Timing 1 (T1), hands without wearing gloves, before attending to the patient; Timing 2 (T2), wearing gloves, right after the patient treatment, when the glove was contaminated with the patients’ biological material; and Timing 3 (T3), collected after removing the gloves. The material obtained was inoculated in culture mediums such as: Brain Heart Infusion Agar (BHI), Manitol Salt Agar (MSA), Eosin Methylene Blue (EMB) and Bile Esculin Agar (BEA). There were identified Staphylococcus aureus and not aureus strains, besides Gram-negative bacteria, suggesting deficient hygiene of the hands. An antibiogram was made for all the Gram-positive and Gram-negative bacteria found. The result shows a high number of strains resistant to the most common used antibiotics. The microbiological count was higher in the T1 for all the culture mediums, suggesting that the act of washing the hands for 30 s decreases the microbiota resident in the hands. Key words: Antimicrobial agents, hands washing, infection control, odontology, risk due to biological agents. INTRODUCTION Infection control has become one of the most discussed topics in odontology, being very important during the practice, so that professionals no longer question its importance. The knowledge about occupational hazards has been largely developed, but unfortunately it has been short to strengthen awareness and change behaviors, as policies of infection control are not being fully applied (Moraes, 2008). According to Lehotsky et al. (2010) the failure in hand disinfection before surgical procedures is considered the major cause of nasocomiais infections worldwide, contributing for the spread of multiresistant pathogens, besides playing an important role in the development of post operatory complications. Lately, multiresistant bacterial strains are responsible for outbreaks all over the world and the therapeutic arsenal has become more and more scarce, increasing costs and time expending on treatment. The Staphylococcus aureaus resistant to methicillin (MRSA) is responsible for important infections and hands are the most common way of transmission (CustГіdio et al., 2009). According to Myers et al. (2008) Odontology profes- *Corresponding author. E-mail: [email protected]. Tel: 55 (35)3291-1852. 798 Afr. J. Microbiol. Res. sionals must be bound to principles scientifically accepted and based on evidences of infection control, considering that hands hygiene is one of the most important processes to reduce the transmission of microorganisms between professional and patient. Thus, the ethical responsibility of health professionals in reducing the risks of contamination is expected. According to Dejours (1995), the Health Area may be a health provider or a pathogenic producer. This study aimed to isolate and identify bacterial strains in the collected material extracted from hands of dentists during clinical procedures, being a helpful matter in the awareness about the possibility of transmission of pathogenic microorganisms through hands. It also intends to determinate the profile of sensibility of microorganisms to antibiotics, building up consciousness and a reasonable use of antimicrobials. MATERIALS AND METHODS The research was developed starting with a list of 120 names, provided by the Odontology Regional Council from Minas Gerais (CRO-MG), and intermediated by the Regional Office from Alfenas. Later, based on the names enrolled in the list, 41 participants were randomly selected and invited to participate in the survey. Professionals were sought after in their workplaces and they were informed about the attribute of the study. The participation was linked to a consent form. On the research, dentists from both genders, specialists and general clinical dentist, who perform their activities in private and public offices, participated. The study was developed starting with the collection of biological material on the active hand of the dentist. On each sample an sterile bag measuring 15x32 centimeters containing 250 mL of sterile physiologic serum was used, where the professional washed their hands for about 30 s, over three different times: Timing 1 (T1), bare hands before seeing the patient; Timing 2 (T2), gloved hands right after the patient treatment, when the glove was contaminated with the patients’ biological material; and Timing 3 (T3), collected after glove removal looking forward to verify microbiota present within the glove. Expecting to obtain standardization during the material collection, sterile DescarpackВ® latex gloves were provided to all participants (sample) in the research. The material collection did not interfere with the professional routine, in other words, the dentist was told to act just like his/her would normally do, which means that the dentist had full choice to wash hands before starting treatments and wear sterile gloves in the manner they judged more suitable. Right after the three collecting timings in the physiologic serum, the obtained material was sent to the Microbiology Laboratory at the Universidade Federal de Alfenas, together with the glove used by the professional. The glove was filled with methylene blue and observed after 24 h in order to verify the presence of perforations. Overall, samples were collected 123 from the hands of 41 professionals. At the laboratory, 100 microliters (ВµL) of physiologic serum withdrew from hand washing was inoculated in the culture media: Brain Heart Infusion Agar (BHI - Himedia), Manitol Salt Agar (MSA), Eosin Methylene Blue (EMB) and Bile Esculin Agar (BEA), for each one of the timing (T1, T2, T3), in concentrations: undiluted and 1/10, in each one of the three times, and each sample for each one of the four culture medium, totaling 984 samples. The culture media were incubated at 37В°C (98.6В°F) in a bacteriological incubator for 48 h. The colonies quantification was made using a colony counter, and the results were obtained in CFU/mL (Colony-Forming Unit per Milliliters). Strains which were grown in MSA underwent the Gram Method, Catalase Test, DNase and Coagulase Test. Strains which were grown in BEA underwent the Gram Method and Catalase Test. Finally, the ones grown in EMB Agar underwent the Gram Method and were identified using BactrayВ® Kit, for biochemical identification of Gram Negative bacilli with Negative or Positive Oxidase. The antibiogram using the Agar Disc Diffusion Technique (also known as Agar Diffusion Method or Kirby- Bauer Test), according to CLSI (CLSI document, 2009), using antibiotics discs made by DMEВ® Sensidisc . There were made the following antibiotics for Gram positive bacteria: Amoxicillin/Clavulanic Ac. (AMC 30 - 20/10 Вµg), Azithromycin (AZI 15 - 15 Вµg), Ciplofloxacin (CIP 05 - 5Вµg), Clindamycin (CLI 02 - 2 Вµg), Doxycycline (DOX 30 - 30 Вµg), Norfloxacin (NOR 10 - 10 Вµg), Oxacillin (OXA 01 - 1 Вµg), Vancomycin (VAN 30 - 30 Вµg), Linezolid (LNZ 30 - 30 Вµg), Table 4. For the Gram negative were used: Cephalotin (30 Вµg), Sulfazotrin (25Вµg), Tobramycin (10Вµg), Chloramphenicol (30Вµg), Gentamicin (10Вµg), Doxycycline (30Вµg), Ciprofloxacin (05Вµg), Azithromycin (15Вµg), Norfloxacin (10Вµg), Table 6. The analysis of variance was used to evaluate the factors significance and the Scott-Knott test was applied at 5% level of significance to get the average difference. This research was carried out after the Committee of Ethics in Research had authorized the realization of the project on Protocol No 216/10 in November, 25th, 2010. RESULTS The timing 1 (T1) which represents the first collection of the material from professional hands, always presented the highest number of Colony-Forming Unit (CFU/ml), when compared to the others timing (T2 and T3) from the research (Table 2). T2 presented the lowest count of CFU/ml when compared to T1 and T3, with statistical significance for the media used, according to Scott-Knott Test (Table 1). 41 pairs of DescarpackВ® sterile gloves were used, which did not show any damage during the collection, except one glove that had a perforation on the middle finger. The glove that presented the perforation was used in a long duration surgical procedure. The material inoculation in the culture medium (BHI) was used to count the total bacteria, in each one of the three timing used in this research, totaling 246 samples. The results show that the T1 relative to the time when the professional gets ready to start the clinical procedure, in other words, before wearing gloves, presented the highest count of total bacteria, reaching up to more than double of the CFU/ml count in the three media used. The colonies count in the MSA was used to isolate the Gram positive cocci in the samples, specifically Staphylococcus sp. The colonies counting in this media followed the trend observed in BHI. In the same way, there was a reduction from T1 to T3, indicating that the act of washing hands in physiologic serum removes part of the microorganisms, thereby, reducing the number of CFU/ml (Table 3). In T2, 27 samples had zero count. So, the unfolding of the significance for all the variable T presented a statistical three timing used in this research. The results indicate the presence of 26 samples of S. aureus and 44 Coagulase-negative Staphylococci (CoNS), from analysis of the 246 samples distributed over the Carmo et al. 799 Table 1. Colonies’ counting average in the culture media BHI, MSA and EMB in CFU/ml. Culture media BHI MAS BEM T1 (CFU/mL) a 2624,27 1837,93a a 89,27 T2 (CFU/mL) c 701,83 c 48,66 a 0 T3 (CFU/mL) b 1074,32 b 807,93 a 20,49 T1= Bare hands before seeing the patient; T2= Gloved Hands, right after the patient treatment, when the glove was contaminated with the patients’ biological material; T3= collected after glove removal. BHI= Brain Heart Infusion Agar; MSA= Manitol Salt Agar; EMB= Eosin Methylene Blue Note 1: it was not possible to calculate the statistics for the BEA medium, because only one was collected in T1; of all the 246 made showed positive result. The values are means. The means followed by the same lower case letter in the line do not have difference between then by ScottKnott test, at level 5% of significance. Table 2. Minimum and Maximum CFU/ml counting in the 4 culture media used. Culture Media BHI MAS BEM BEA T1 (CFU/ml) Minimum Maximum 0 Countless 0 6,000 0 1,530 0 Countless T2(CFU/ml) Minimum Maximum 0 9,400 0 920 0 0 0 0 T3 (CFU/ml) Minimum Maximum 0 6,010 0 5,320 0 830 0 0 T1= Bare Hands before seeing the patient; T2= Gloved hands right after the patient treatment, when the glove was contaminated with the patients’ biological material; T3= collected after glove removal. BHI= Brain Heart Infusion Agar; MSA= Manitol Salt Agar; EMB= Eosin Methylene Blue; BEA= Bile Esculin Agar. Table 3. Identification of the strains of Staphylococcus aureus and CNS - Coagulase negative Staphylococcus, obtained in T1, T2 and T3. Timing T1 T2 T3 Total Staphylococcus aureus 13 03 10 26 CNS - Coagulase negative Staphylococcus 19 07 18 44 T1= Bare hand before seeing the patient; T2= Gloved hand right after the patient treatment, when the glove was contaminated with the patients’ biological material; T3= collected after glove removal. three timings established in this research, although, with a higher colonies concentration in T1, for both identifications (Table 3). Both S. aureus and Coagulase-negative Staphylococci strains isolated and identified in this study underwent an antibiogram, being totally, sensitive to Amoxicillin/ Clavulanic Acid and Norfloxacin. Also, they presented a high resistance to Azitromicin, Clindamicin and Vancomycin, according to Table 4. The culture medium EMB is used to differentiate and isolate Gram negative bacilli (Enterobacteriaceae and others Gram negative bacilli). Following up the tendencies of the others culture media, T1 in EMB presented the highest concentration of CFU/mL, resulting to positive in six cases with minimum counting as 90 CFU/ml and the highest counting as 1,530 CFU/ml. In T3, results were positive for two samples, and they were: 10 and 830 CFU/ml. The T2 was equal to zero and for 100% of the samples, indicating that those bacteria are not common in the oral cavity (Table 2). 246 samples were analyzed in the EMB culture medium, and for the three timings used in the research; there were no statistical significance in the results (Table 1). The presence of Escherichia coli in 8 samples was verified, Citrobacter freundii in 7 samples, and one sample presented Enterobacter cloacae, totaling 16 samples with positive results for Gram negative bacteria, for a total of 86 samples. After identification of the 16 samples positive for Gram negative bacteria, the antibiogram was done, and the strains were sensitive in 100% of the cases to Cephalotin, Gentamicin and Norfloxacin. It is important to point out the 800 Afr. J. Microbiol. Res. Table 4. Susceptibility profile of 26 strains of Staphylococcus aureus and 44 strains of CNS - coagulase negative Staphylococcus, in response to 9 clinical drugs. Antibiotic/Strain S. aureus SCNS AMC 30 R S 0 26 0 44 AZI R 10 26 15 S 16 18 CIP 05 R S 0 26 4 40 CLI R 9 26 02 S 17 18 DOX 30 R S 0 26 14 30 NOR 10 R S 0 26 0 44 OXA 01 R S 7 19 13 31 VAN 30 R S 12 14 25 19 LNZ 30 R S 0 26 1 43 AMC 30Вµg: Amoxicilin/Clavulanic Acid; AZI 15Вµg: Azitromicin; CIP 05Вµg: Ciprofloxacin; CLI 02Вµg: Clindamicin; DOX 30Вµg: Doxycycline; NOR 10Вµg: Norfloxacin; OXA 01Вµg: Oxacilin; VAN 30Вµg: Vancomycin; LNZ 30Вµg: Linezolid. Table 5. Distribution of the Gram negative strains (Enterobacteriaceae) isolated in the culture media. Gram negative Bacilli Escherichia coli Citrobacter freundii Enterobacter cloacae Total elevated number of strains resistant to Chloramphenicol, Sulfazotrin, Azithromycin, Ciprofloxacin (Table 6). The BEA is used to isolate and used as presumptive identification of Enterococo faecalis. This bacterium was found in only one sample in T1 (with formation of bacterial biofilm) for a total of 246 samples. DISCUSSION Professional’s choice of washing or not of hands before wearing gloves, was determinant to the highest CFU/ml counting found in all culture media used. It was so because T1 had the highest count of CFU/ml, when compared to T2 and T3. And, besides, in some cases in T1, the formation of biofilm could be noticed. This topic was also studied by Agbor and Azodo (2010), when only 63.4% of the interviewed reported the practice of hand washing. Poor hand hygiene (HH) among professionals on the health area has motivated a lot of researches. And, although this practice is a simple act, its interdependence with the behavior sciences makes them complex and it depends on a set of factors and attitudes, beliefs and knowledge (Pessoa-Silva et al., 2005). For researchers, although professionals valorized and recognize the importance of the HH, the inadequate habit results in the non adhesion and only the divulgation is not enough to change behavior (Larson et al., 2007). For the culture media EMB and BEA, where T2 was equal to zero, no result in T3 was higher than in T1; relevant fact considered is that Gram negative bacteria (EMB culture) and Enterococcus (BEA culture) are not usually found in the oral cavity, being found, most times in places poorly sanitized. The Gram negative bacilli are normally found in the environment and make part of the intestinal flora of humans and other animals, and may be Nп‚° (%) 08 (50.0) 07 (43.75) 01(6.25) 16 (100) associated to diarrhea and pyogenic infections (CustГіdio et al., 2009). In this study, in the MSA culture were found values that range from zero to 6,000 CFU/ml. Also isolated in the MSA, in T1 was the presence of 13 S. aureus and 19 other Staphylococcus; not aureus, from a total of 26 and 44 colonies, respectively (Table 3); totaling 86 samples in the MSA. In the same way Silva et al. (2003) found a high rate of contamination for Staphylococcus and a lower number of Gram negative bacilli, in a study that verified the microbiological contamination on surfaces, including the operator hands’ and the places touched by him. S. aureus is responsible for several types of infection in human body, and hands are the main way of transmission. In this way, MRSA can be transmitted from one patient to another if hands hygiene is neglected. Lately, MRSA has become an important topic, but it is not more aggressive than Staphylococcus not aureus, and the actual challenge is a shortage of antibiotics that can combat the bacterium and not its virulence (Johnston and Bryce, 2009). Due to the increasingly frequent and unnecessary use of antibiotics, infections for MRSA have become more frequent. The infections caused by S. aureus are usually treated with penicillin derivates such as Oxacilin, Cefazolin and Cefalotin; all of them were used in this study. The S. aureus strains were sensitive, in all cases to Amoxicilin and Clavulanic acid, Ciprofloxacin, Doxycycline, Norfloxacin and Linezolid, according to Table 4, and were resistant to Azitromicin, Clindamicin, Oxacilin and Vancomycin. The occurrence of bacteria resistance to antibiotics is a critical point, affecting sharply morbidmortality rate and treatment costs (Oliveira et al., 2010). MRSA rates clinical isolated from S. aureus vary from less than 1% in Norway and Sweden, from 5% to 10% in Canada, 25% to 50% in USA, reaching up to more than Carmo et al. 801 Table 6. Sensitivity profile of the 16 strains of Enterobacteriaceae in response to 9 clinical drugs. Antibiotic (Вµg) Cefalotin (30) Sulfazotrin (25) Tobramycin (10) Chloraphenicol (30) Gentamicin (10) Doxycycline (30) Ciprofloxacin (05) Azitromicin (15) Norfloxacin (10) Sensitive strain 16 8 13 5 16 14 10 5 16 50% in Hong Kong and Singapore (Michael and Martin, 2010). MRSA are not only resistant to all the regular antibiotics, but also to a combination of them. In this study 44 strains of Staphylococcus coagulase negative were found, for a total of 70 Staphylococcus sp. Until the last couple of years, the Staphylococcus coagulase negative, were seen as reduced risk in causing infections, due to presence in the skin of microbiota. However, the Negative Coagulase Staphylococcus begin to be identified as a pathogenic agent, being considered the main cause of bacteremia in the USA; caused by the increase in the incidence of infections (Grundman et al., 2006). The highest concentration of this pathogen was collected on the professionals’ hands in T1 and T3, according to Table 3. Due to similar finding, warning on how easy it is to transport the bacterium from one place to another, completing the circle of microbial infection should be done. The antibiogram for Coagulase Negative Staphylococcus was found in this study; 29.5% of strains were resistant to Oxacilin, 9% to Ciprofloxacin and 56.8% to Vancomycin. What makes the Staphylococcus a pathogen with the highest resistant rate to antibiotics is shown in Table 4. The World Health Organization (2007) has made reference to the excessive using of antibiotics worldwide, and shows that the resistance to them is one of the three biggest threats to human health. Odontology overuses antibiotics, and most of the time with no justification. This alert must be considered, because this study found 2.27% of strains resistant to Linezolid, 56.8% to Vancomycin, 29.5% to Oxacilin, 31.8% to Doxycycline, 59% to Clindamicin, 9% to Ciprofloxacin and 59% to Azitromicin. Only the Amoxicilin associated to the Clavulanic acid and the Norfloxacin, was shown to be effective in 100% to the cases in this study (Table 4). Nowadays, the main concern is also applied to the specific treatments for infections caused by Gram negative bacteria and multidrug resistant to E. coli, just like the ones that were isolated in this study, and are indicated in Table 5. These bacteria can survive for around 48 h after being deposited on surfaces (Rodrigues et al., 2008). The presence of those bacteria in T1 and T3, in other words on dentists’ hands indicate fecal contamination. Resistant strain 0 8 3 11 0 2 6 11 0 This situation is unacceptable in clinical offices. This Gram negative bacilli, was also found and it is the main cause of infections in the urinary tract and neonatal meningitis, causing 80% of mortality. It can also cause infections in wounded skin, peritonitis and septicemia (Fraser and Cunha, 2012) Strains of Citrobacter freundii (Gran Negative) identified in this study, (Table 5), usually can be found in human and other animals feces. Fraser and Cunha (2012) had already isolated strains in clinical samples of urine, throat swabs, expectorations, blood and wound swabs, with characteristics of opportunist pathogen. The presence of this bacterium on the hands and in the clinical offices environment is critical, and not only increases the risk of infection, but also chances of one be infected by a resistant bacterium. Besides epidemiological vigilance, this issue also needs prioritization of health programs, effective health education, and aiming a reasonable use of antibiotics (Oliveira et al., 2010). The strains of E. cloacae, also isolated in this study, are enterotoxigenic, and showed resistance to antibiotics, according to Table 6. Enterobacter can infect any surgical wounds, and these infections are clinically indistinguishable from infections caused by others bacteria (Fraser and Cunha, 2012). The antibiogram for Gram negative bacilli was made (Table 6). Most of the strains were resistant to most of the antibiotics tested, with exception to Cefalotin, Gentamicin and Norfloxacin. Among the samples analyzed in T1, a strain of E. faecalis was identified, commensal of human digestive tract, causing over 90% of the enterococci human infections (Johnston and Bryce, 2009). The strain isolated was resistant to Clindamicin, Cefalotin, Chloraphenicol and Oxacilin, with no inhibition, and with Norfloxacin, there was the formation of a ring of 14 mm. Although, it was sensitive to the others antibiotics used, including Vancomycin. A multinational study (including countries such as South Africa, Egypt, Saudi Arabia and Lebanon) on nosocomial pathogens has found a similar result, because none of the Enterococcus found in the study were resistant to Vancomycin. However, 7% of the Enterococcus isolated in Germany and 16.7% of the ones 802 Afr. J. Microbiol. Res. isolated in Switzerland and Greece were resistant to Vancomycin. Other studies show that environments frequented by patients with MRSA and Enterococcus resistant to Vancomycin is often contaminated by MRSA and Enterococcus, just like the same contamination found on hands, coats and equipments used by service providers (Johnston and Bryce, 2009). The scene is very critical, because in the late years the pharmaceutical industry did not invest on new antibiotics. According to Piddock (2011), this has occurred due to merging pharmaceutical companies, small profit rates, high costs and regulatory barriers. Besides all these barriers, when the new drug has been finally approved, it is will not be effective in a long term, for the bacterium will soon develop resistance mechanism. ACKNOWLEDGEMENTS Part of the financial resources was personal and the other part of the financial resources was donated by the Universidade Federal de Alfenas, Alfenas, Minas Gerais, Brazil. Conclusion This study found the presence of Gram negative and Gram positive bacteria, based on the collection of biological material on hands of Surgeons Dentists, during clinical procedures, showing deficiency in hand hygiene procedures. The CFU/ml count from hands of professionals before starting the procedure (Timing 1) was the highest for all the culture media used, suggesting that hand washing was neglected or was made improperly. The antibiogram showed the existence of strains resistant to most used antibiotics in the office. Thus, this press the recommendable need for effective programs in orienting professionals to a reasonable use of antibiotics. REFERENCES Agbor MA, Azodo CC (2010). Handwashing and barrier practices among Cameroonian dental professionals. Tanzan. Dent. J. 16(2):3538. CLSI (2009). Performance Standards for antimicrobial disk susceptibility tests. Approved standard – Tenth edition. CLSI document M02-A10. 29(1):3-34. CustГіdio J, Alves JF, Silva, FM, Dolinger EJO, Santos JGS; Brito DD (2009). Avaliação microbiolГіgica das mГЈos de profissionais da saГєde de um hospital particular de Itumbiara, GoiГЎs. Rev Cien Med. 18(1):7-11. Dejours C (1995). Com ment formuler une problГ©matque de la santГ© en ergonomie et en mГ©dicine du travail ? Trav. Hum. 58:1-16. Fraser SL, Cunha BA (2012). Enterobacter Infections Clinical Presentation. Medscape J Med (periГіdico na Internet) May 30 (acessado 2012 jul 12); DisponГvel em: http://emedicine.medscape.com/article/216845-clinical. Grundman H, Aires SM, Boyce J, Tiemersma E (2006). Emergence and resurgence of meticilin-resistant Staphylococcus aureus as a public health threat. Lancet Infect Dis. 368:874-885. Johnston BL, Bryce E (2009). Hospital infection control strategies for vancomycin-resistant Enterococcus, methicillin-resistant Staphylococcus aureus and Clostridium difficile. CMAJ 180(6):627631. Larson EL, Quiros D, Lin SX (2007). Dissemination of the CDC's Hand Hygiene Guideline and impact on infection rates. Am. J. Infect. Control 35(10):666-675. Lehotsky ГЃ, Nagy M, Haidegger T (2010). Towards the Objective Evaluation of Hand Disinfection. In: 26th Southerm Biomedical Engineering Conference. 32:92-96. Michael V, Martin MBE (2010). Antimicrobials and dentistry: Are we over prescribing? J. Marmara Univ. Dent. 1(1):15-19. Moraes MS (2008). Em ambiente de risco, conhecimento Г© fundamental. J. Glob. Infect. Dis. Ano XX; 65:3. Myers R, Larson E, Cheng B, Schwartz A, Silva K, Kunzel C (2008). Hand hygiene among general practice dentists. JADA 139(7): 948957. Oliveira DGM, Souza PR, Watanabe E, Andrade D (2010). Avaliação da higiene das mГЈos na perspectiva microbiolГіgica. Rev. Panam. Infectol. 12(3):28-32. Pessoa-Silva CL, Posfay-Barbe MD, Touveneau S, Perneger TV, Pittet D (2005). Attitudes and perceptions toward hand hygiene among healthcare workers caring for critically ill neonates. Cienc Enferm. 26(3):305-311. Piddock LJ (2011). The crisis of no new antibiotics--what is the way forward? Lancet Infect. Dis. 12(3):249-253. Rodrigues MVP, Fusco-Almeida AM, Nogueira NGP, Bertoni BW, Torres SCZ, Pietro RCLR (2008). Evaluation of the spreading of isolated bacteria from dental consulting-room using RAPD technique. Lat. Am. J. Pharm. 27(6):805-811. Silva FC, Antoniazzi MCC, Rosa LP, Jorge AOC (2003). Estudo da contaminação microbiolГіgica em equipamentos radiogrГЎficos. Rev. Bras. Biocienc. 9(2):35-43. World Health Organization (2007). The selection and use of essential medicines- Interventions for improvement of antimicrobial use. Geneva. (Accessed em 2012 abril 9); Avalible in: http://whqlibdoc.who.int/trs/WHO_TRS_946_eng.pdf Vol. 8(8), pp. 803-813, 19 February, 2014 DOI: 10.5897/AJMR2013.6233 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper Evaluation of marine macro alga, Ulva fasciata against bio-luminescent causing Vibrio harveyi during Penaeus monodon larviculture Krishnamoorthy Sivakumar, Sudalayandi Kannappan*, Masilamani Dineshkumar and Prasanna Kumar Patil Genetics and Biotechnology Unit, Central Institute of Brackishwater Aquaculture (Indian Council of Agricultural Research), 75, Santhome High Road, Raja Annamalai Puram, Chennai - 600 028, Tamilnadu, India. Accepted 23 January, 2014 Vibrio harveyi is one of the major disease causing bacterium in shrimp larviculture and grow-out practices. V. harveyi produces many virulence cum pathogenic factors. Application of antibiotics against luminescence causes development of antibiotic resistance among V. harveyi. Therefore, it is obligatory to develop bio-inhibitory agents as substitute in lieu of antibiotics. Under this study, Ulva fasciata was collected and extracted for crude compounds, 300 Вµg extract showed 12.3 mm of bioinhibition against V. harveyi through “agar well diffusion assay”. Further, U. fasciata extract at 300 Вµg/ml was treated against V. harveyi in LB broth and showed reductions on phospholipase and proteolysis. Production of bio-luminescence was reduced to 7.3, 7.7, 13.0, 17.0 counts per second (CPS) and growth also reduced to 24.91%. Further, U. fasciata extract at 200 пЃg/ml was tested against V. harveyi during Penaeus monodon larviculture and showed 32.40% reduction in the cumulative percentage mortality on postlarvae due to V. harveyi. Chemical constituents of U. fasciata was characterized by FTIR and GCMS. GC-MS analysis, reported to contain organic compounds such as Bis(2-ethylhexyl) phthalate was highest (88.42%), followed by 1,2- benzenedicarboxylic acid- butyl (2.47%). Therefore, it was concluded that U. fasciata may be a better bio-inhibitory agent against V. harveyi in shrimp larviculture. Key words: Ulva fasciata extracts, antagonism, virulence factors, Vibrio harveyi, challenging shrimp postlarvae, cumulative mortality reduction. INTRODUCTION Penaeid shrimp farming have become a momentous aquaculture activity in many countries in the tropics. However, this grow-out practice is constantly under threat due to the outbreak of infectious diseases. Among the infectious diseases the luminescent disease causing Vibrio harveyi is one of the most important bacterial pathogen, capable of causing higher mortality among the marine invertebrates (Vezzulli et al., 2010). In the last two decades, mass mortalities (80-100%) among Penaeid shrimps resulting from V. harveyi infections were fre- quently reported in hatcheries (Raissy et al., 2011) and grow-out ponds (Zhou et al., 2012). V. harveyi has been established as well-known bacterium to produce extra cellular products indicating its virulence factors such as luminescence, proteases, phospholipases, lipases, siderophores, chitinases and hemolysins (Soto-Rodriguez et al., 2012). The applications of antimicrobial chemicals, especially antibiotics, led to the emergence of more virulent as well as resistant among the bacterial pathogens (Rahman et al., 2010). Under this condition, it *Corresponding author. E-mail: [email protected]. Tel: +91-44-24616948 or +91-96770 39103. Fax: +91-44-24610311. 804 Afr. J. Microbiol. Res. Figure 1. Marine macro alga U. fasciata. is indispensible to develop an alternative agent in place of antibiotics that are commendably biodegradable and eco-friendly too. Marine resources are an unmatched reservoir of biologically active natural products, many of which exhibit structural features that has not been found in terrestrial organism (Saritha et al., 2013). There are numerous reports on compounds derived from macro algae with a broad range of biological activities such as the antimicrobial, antiviral, anti-tumor and anti-inflammatory as well as neurotoxins (Osman et al., 2013). In addition, the macro algae derived polysaccharides for example alginate, carrageenan was capable of improving the healthiness of marine candidate fish species in aquaculture, when they were added to the diets (Peso-Echarri et al., 2012). Current studies reported that the solvent extracts of the red seaweed Gracilaria fisheri prevent V. harveyi infections in Penaeus monodon postlarvae (Kanjana et al., 2011). The crude extract obtained from Sargassum hemiphyllum var. Chinense, show increased immunity and resistance against Vibrio alginolyticus and white spot syndrome virus (WSSV) infection on Litopenaeus vannamei (Huynh et al., 2011). Ulva fasciata is a green marine macro alga (Chlorophyceae), which grows abundantly in both intertidal and deep water regions of sea, and documented to be the potential sources of bioactive compounds (Paul and Devi, 2013). Furthermore, various extracts from U. reticulata and U. lactuca were tested for antagonism against human pathogens (Kolanjinathan and Stella, 2011). Aqueous extract of U. fasciata show inhibition against aquatic bacterial pathogens (Priyadharshini et al., 2012). Antimicrobial efficiency of U. fasciata, Chaetomorpha antennina was studied against many pathogenic bacteria (Premalatha, 2011). The efficacy of U. fasciata harveyi and Aeromonas spp. challenged with P.monodon tested against shrimp pathogens such as Vibrio fischeri, postlarvae (Selvin et al., 2011). incorporated diet was Vibrio alginolyticus, Vibrio The bio-potential of marine algae such as Skeletonema costatum, U. fasciata and Kappaphycus alvarezii were studied against luciferase and luminescence producing V. harveyi (Sivakumar and Kannappan, 2013). However, numerous studies showed the biological activity of U. fasciata against many aquatic pathogens, but not closely determined against luminescent disease causing V. harveyi and its virulence factors. Thus, this study was under taken to discover the antagonistic effect of crude U. fasciata extract against luminescent disease causing V. harveyi during P. monodon larviculture with the, description of functional compounds by FTIR and quantification of phytochemicals by GC-MS. MATERIALS AND METHODS Isolation of V. harveyi V. harveyi strains were isolated from the P. monodon larviculture tanks. The isolates were identified using standard biochemical tests and further confirmed by polymerase chain reaction (PCR) (Sivakumar and Kannappan, 2013). The pathogenicity of V. harveyi cells were ascertained by spotting in 3% blood agar (Hi-media, India). The isolates were re-confirmed by V. harveyi selective agar (VHSA) (Harris et al., 1996) and then stored in Luria-Bertani (LB) broth with sterile glycerol (15% v/v) (Hi-media, India). Macro alga collection The marine macro alga U. fasciata was collected with a knife from all over the substrate (rock, plant, wood, etc.) (Figure 1) from intertidal region of Tuticorin (Latitude 8.7874В°N; Longitude 78.1983В°E), Tamilnadu, India (Figure 2). The alga was washed in permanganate solution [1% KMnO4 (w/v)] to remove the epiphytes, sand and other extraneous matters and then shadow dried. The dried alga was weighed, pulverised using mechanical grinder and Sivakumar et al. 805 Figure 2. Map showing Tuticorin region (Latitude 8.7874В°N; Longitude 78.1983В°E), India where macro alga U. fasciata was collected. used for extracting crude fatty acids. Solvent extraction Ethyl acetate was used for extracting the crude compounds from alga at 30В°C called “cold extraction method”. The U. fasciata extract was prepared by taking 1.0 g of shadow dried powder, and then mixed with 10.0 ml of ethyl acetate and shaker incubated at 30В°C for 96 h at 50 rpm. Then the extract was filtered by Whatman filter paper No. 1, rotary evaporated (30В°C) under vacuum and stored at 4В°C for additional use. The resultant extract was liquefied with 5 mg/ml of 30% (v/v) dimethyl sulfoxide (DMSO) and used for testing antagonism against V. harveyi (Sivakumar and Kannappan, 2013). Estimation of MIC The minimum inhibitory concentration (MIC) of U. fasciata against V. harveyi was evaluated (Islam et al., 2008). Active 24 h old V. harveyi of 500 Вµl (1.8 OD) was inoculated into LB broth and shaker incubated at 28В°C/100 rpm/5 days. The growth with various virulence factors such as luminescence, proteolytic, lipolytic, phospholipase, thermonuclease activities, crude bacteriocin production, exopolysaccharide (EPS) and protease produced by V. harveyi were estimated. Cell surface hydrophobicity was examined by salt aggregations test (SAT) and cell adhesion was examined by bacterial adhesion to hydrocarbons test (BATH) (Soto-Rodriguez et al., 2012). Each test was performed in triplicates and values were expressed in average with SD. Fourier transform infra red spectroscopy (FTIR) analysis The shadow dried U. fasciata was ground to powder by pestle and mortar. The FTIR spectra was recorded using BRUKER IFS 66 model FTIR spectrometer in the region 4000-400 cm-1 by employing standard KBr pellet technique (D‟Souza et al., 2008). Gas chromatography and mass spectrometry analysis Antibacterial assay Antibacterial activity was ascertained against V. harveyi using the “agar well diffusion assay” (Sivakumar and Kannappan, 2013). Effect of crude U. fasciata extract against the growth and virulence of V. harveyi U. fasciata extract at 300 пЃg/ml was added in 100 ml of LB medium. Gas chromatography-mass spectrometry (GC-MS) analysis was performed by using Agilent GC-MS-5975C with the Triple-Axis Detector equipped with an auto sampler. The GC column used was fused with silica capillary column (length 30 m Г— diameter 0.25 mm Г— film thickness 0.25 пЃm) with helium at 1.51 ml for 1 min as a carrier gas. The mass spectrometer was operated in the electron impact (EI) mode at 70 eV in the scan range of 40-700 m/z. The split ratio was adjusted to 1:10 and injection volume was 1 Ојl. The injector temperature was 250В°C; the oven temperature was kept at 806 Afr. J. Microbiol. Res. 70В°C for 3 min, rose to 250В°C at 14В°C min-1 (total run time 34 min). The temperature of the transfer line and of the ion source was set to a value of 230В°C and the interface temperature at 240В°C, respectively. Full mass data was recorded between 50-400 Dalton per second and scan speed 2000. Mass start time is at 5 min and end time at 35 min. Peak identification of crude U. fasciata extract was performed by comparison with retention times of standards and the mass spectra obtained was compared with those available in the NIST libraries (NIST 11- Mass Spectral Library 2011 version) with an acceptance criterion of a match above a critical factor of 80% (Musharraf et al., 2012). Challenge of crude U. fasciata extract against V. harveyi during larviculture of P. monodon The plastic tubs were washed with 1% KMnO4 solution. Tubs were filled with 20 L of saline water at 20 Practical Salinity Units-PSU. Disease free postlarvae (PL 10) of P. monodon, procured from shrimp hatchery were acclimatized at 20 PSU for 5 days under laboratory conditions at 28 В± 1В°C with continuous aeration. The average body weight of PL ranged from 17 to 18 mg and stocked at 1000 numbers per each tub. The control tub was inoculated with V. harveyi (10 ml of 1.80 OD) alone. Second tub was considered as treatment inoculated with V. harveyi and 200 Вµg (2 gm/10L) of crude U. fasciata extract per ml. Third tub was considered as control where crude U. fasciata extract was added at 200 Вµg per ml alone with PL. The fourth tub was a control for PL, where neither V. harveyi nor extract was added. The aeration was given for each tub to provide oxygen level not more than 4 ppm. The PL feed was given twice at 15% of their body weight. The water quality parameters such as temperature, salinity and pH were measured once in 5 days. The mortality of PL was counted daily. No water exchange was given for all the tubs till 30 days. The water samples were collected once in 5 days by sterile water bottles. The total heterotrophic and V. harveyi bacterial counts were enumerated using LB medium and V. harveyi selective agar medium under spread plate method. All the experimental tubs were top covered to avoid any external contaminations. For each experiment, triplicates were maintained and the values are average of three determinations (Traifalgar et al., 2009; Kannappan et al., 2013). RESULTS Minimum inhibitory concentration (MIC) of U. fasciata The MIC of crude extracts of U. fasciata was established at 30 Вµg concentration. The zone of inhibition was 12.3 mm, established at 300 Вµg level of extract of U. fasciata whereas, the 200 and 100 Вµg level of concentrations showed 8.3 and 3.3 mm zones, respectively, against the growth of V. harveyi. Effect of crude extract of U. fasciata against the changes in growth and virulence factors produced by V. harveyi The treatment reduced the growth of V. harveyi (1.8 OD) st th from 1 to 5 day. The highest growth differences was rd st th observed on 3 day (0.532 OD) and lowest on 1 and 5 day (0.468 OD) as compare to the control (Figure 3a). The maximum reduction on bacteriocin production (OD) was on 4th and 5th day (0.177 and 0.184) and minimum st (0.064) observed on 1 day as compared to the control (OD 1.986 and 1.978 on 4th and 5th, and 2.082 on 1st days). Although, reductions of crude extra cellular protein released was noticed in all the treatment days (Figure 3b). The EPS production in the treatment was reduced to st th 0.525, 0.556, 0.585, 0.551 and 0.507 from 1 to 5 days as compared to the control (OD 2.026, 2.408, 2.242, 2.262 and 2.250) (Figure 3c). The protease level was reduced from 0.047 and 0.051 as compared to the control (OD 0.146 and 0.171) (Figure 3d). Further, the treated V. harveyi cells were subjected to phospholipase, proteolysis, lipolysis and thermonuclease activities, determined based on the hydrolysis of medium in the plate assay (Table 1). The activities were coded with qualitative parameters like weak, moderate, high and very high. In treatment, the moderate level of phospholipase and proteolysis activity was noticed on 1st, 2nd and 3rd days. Weak activities were noticed on 4th and 5th days (very high). But moderate level of lipolysis and thermonuclease activities was shown on 1st to 5th day as compared to the control (very high). Cell surface hydrophobicity was examined using SAT and BATH tests (Table 1). SAT test was determined as the lowest molarity of ammonium sulphate (0.05-4.0 M) that caused visible agglutination of a test organism. In SAT test, the control V. harveyi revealed strong hydrophobic activity for 1st to 5th day whereas, the treated showed moderate hydrophobic activity for 1st to 5th day. Similar way, BATH test also exhibited strong level of hydrophobic activity for control from 1st to 5th day. When crude extract of macro alga of U. fasciata was treated with V. harveyi, the production on luminescence was reduced to 7.3, 7.7, 13.0 and 17.0 CPS (counts per second) for the 4 days period (Figure 3e). The maximum reduction on luminescence was reported on 4thday (17.0 CPS) and minimum was observed on the 1st day (7.3 CPS) when compared with the control (39.6, 50.3, 59.3, 63.6 CPS). FTIR of U. fasciata The FTIR spectrum of dried powder of U. fasciata is shown in Figure 4 and functional groups identified were compared from the FTIR standard library data. FTIR spectrum showed the presence of significant functional groups such as alcohols, phenols, esters, ethers, alkanes, alkenes, primary amines, nitro compounds, aromatics and carboxylic acids, alkyl halides and aliphatic amines, etc (Table 2). GC-MS of U. fasciata GC-MS analysis of crude ethyl acetate extract of U. Sivakumar et al. 807 Figure 3. Crude extract of U. fasciata against the changes of growth and virulences produced by V. harveyi in LB broth for 5 days. fasciata was found to have mixture of volatile compounds. A total of 36 peaks were observed with retention times as shown in Figure 5. Chemical constituents were identified using spectrum data base NIST 11 software installed in GC-MS. The GC-MS analysis of the crude extract revealed that the main chemical-constituent was organic compound Bis(2-ethylhexyl) phthalate (tR = 23.21 min) (88.42 %) followed by 1,2-benzenedicarboxylic acid- butyl (tR = 18.14 min) (2.47%) (Figure 6a and b). It is possible that bioactive compounds primarily consisting of Bis(2ethylhexyl)phthalate (tR =23.21 min) (88.42%) may be involved in biological activity (Table 3) with other compounds. Challenge of crude U. fasciata extract against V. harveyi during P. monodon larviculture When U. fasciata extract was tested against V. harveyi in P. monodon postlarvae for 30 days, the reduction on cumulative percentage of mortality on postlarvae was noticed as 32.40% as compared to the control (76.30%). Two trails were maintained under larviculture as negative controls to distinguish any influence of U. fasciata extract on PL. However, it was noticed that treatment does not affect PL as compared to the control (76.30%) which showed less reduction on cumulative percentage mortality with extract and PL (29.56%) and with PL alone (28.39%). The weight of the PL was measured for both the control and treatments. There was no much weight difference observed both in the treatment and control. On 30th day, the average weight of the PL was 269.3 and 266.5 mg for control and treatment, respectively (initial weight of the PL for control was 17.7 and 18.1 mg for treatment, respectively). The maximum decrease on V. harveyi counts were observed on 5th, 10th, 15th and 20th days and mean values 4 4 3 for treatment were 2.38 x 10 , 1.56 x 10 , 4.30 x 10 and 808 Afr. J. Microbiol. Res. Table 1. Effect of U. fasciata extract against the changes of virulences produced by V. harveyi. Virulence studied Day 1 2 3 4 5 Proteolysis Control ++++ ++++ ++++ ++++ ++++ Treated ++ ++ ++ + + Phospholipase Control ++++ ++++ ++++ ++++ ++++ Treated ++ ++ ++ + + Lipolysis Control ++++ ++++ ++++ ++++ ++++ Treated ++ ++ ++ ++ ++ Thermonuclease Control ++++ ++++ ++++ ++++ ++++ Treated ++ ++ ++ ++ ++ Cell surface hydrophobicity SAT (M) BATH (%) Control Treated Control Treated 0.86В± 0.02 1.29В± 0.04 86.78В±4.11 46.33В±2.13 0.89В± 0.03 1.35В± 0.05 85.66В±3.91 43.11 В±1.65 0.91В± 0.04 1.44В± 0.06 82.33В± 3.03 39.56В± 1.33 0.91В± 0.03 1.49В± 0.04 76.31В±3.13 36.81В± 1.29 0.99В± 0.04 1.55В± 0.06 73.46В± 2.96 36.31В± 1.19 Control- V. harveyi untreated with crude extract; Treated- V. harveyi treated with crude extract of U. fasciata; Activity of V. harveyi + = weak; ++ = moderate; +++ = high; ++++ = very high; SAT test (0.0 to 1.0 molarity (M) = strongly hydrophobic, 1.0 to 2.0 M = moderately hydrophobic; 2.0 to 4.0 M = weakly hydrophobic, and >4.0 M = n ot hydrophobic); BATH-test (>50% partitioning = strongly hydrophobic, 20 to 50% partitioning = moderately hydrophobic; and <20 % partitioning = not hydrophobic). -1 Transmission/wavelength (cm ) Figure 4. FTIR spectrum of shadow dried powder of U. fasciata. Sivakumar et al. 809 Table 2. The wave number (cm-1) of dominant peak obtained from the FTIR absorption spectra of U. fasciata. Frequency (cm -1) 3425.4 Bond O-H stretch, H-bonded O-H stretch C-H stretch Functional groups Alcohols, phenols Carboxylic acids Alkanes 1647.7 -C=C- stretch N-H bend Alkenes Primary amines 1541.8 N-O asymmetric stretch Nitro compounds 1419.9 C-C stretch (in-ring) Aromatics 1256.1 C-N stretchC-O stretch C-H wag (-CH2X) Aromatic amines Alcohols, carboxylic acids, esters, ethers Alkyl halides 1154.9 C-O stretch C-H wag (-CH2X) C-N stretch Alcohols, carboxylic acids, esters, ethers Alkyl halides Aliphatic amines 1054.2 C-N stretch Aliphatic amines 897.65 =C-H bend C-H "oop" N-H wag Alkenes Aromatics Primary, secondary amines 848.08 =C-H bend N-H wag C-H "oop" C-Cl stretch Alkenes Primary, secondary amines Aromatics Alkyl halides 791.88 =C-H bend N-H wag C-H "oop" C-Cl stretch Alkenes Primary, secondary amines Aromatics Alkyl halides 2926.1 3.40 x 103 cfu/ml as compared to control which is 3.40 x 105, 1.44 x 105, 1.45 x 105 and 2.49 x 104 cfu/ml, respectively. Various water quality parameters like temperature, salinity and pH were observed in every sampling are presented in Table 4. There were not much changes of water quality parameters both in the treatment and control. Although, in the treatment, and with extract alone, light greenish coloration was observed when compared with control due to the crude nature of extract. DISCUSSION In the present study, U. fasciata extract reduced the growth of V. harveyi. The preliminary phytochemical characterization and antimicrobial efficacy of macro algae U. fasciata and Chaetomorpha antennina were studied against pathogenic bacteria (Premalatha, 2011). Priyadharshini et al. (2012) observed that aqueous and solvent based extracts of U. fasciata showed inhibition against fish-borne bacteria and fungal pathogens. Kolanjinathan and Stella (2011) reported that crude extracts of U. reticulata and U. lactuca are inhibitory to human pathogenic bacteria and fungi. The dietary administration of U. fasciata extracts controlled marine V. harveyi in shrimp grow-out system (Selvin et al., 2011). In a recent study, reductions on crude bacteriocin were noticed in all the days by U. fasciata extract on V. harveyi. The moderate and weak levels of reduction on proteolysis, phospholipase, lipolysis and thermonuclease of V. harveyi were observed treating against U. fasciata extract. Silva et al. (2013a) has observed that U. fascita extract exhibited antagonism against V. parahaemolyticus. In this study, the cell surface hydrophobicity of V. harveyi exhibit moderate hydro-phobicity by U. fasciata treatment when compared with the control. This was corroborated with the values reported by Sivakumar and Kannappan 810 Afr. J. Microbiol. Res. Figure 5. GC-MS chromatogram of the crude ethyl acetate extract of U. fasciata. Figure 6. Major compounds isolated from U. fasciata. (a) Structure of Bis(2-ethylhexyl)phthalate (C24H38O4) extracted and detected by GC-MS from U. fasciata (b) Structure of 1,2-benzenedicarboxylic acid, butyl 2-ethylhexyl ester (C20H30O4), extracted and detected by GC-MS from U. fasciata. (2013) from the marine algae such as S. costatum and K. alvarezii. The FTIR spectra of U. fasciata showed various functional groups of compounds which agreed with the FTIR values reported for marine macro algae Laminaria digitata (Dittert et al., 2012). Similarly, Azizi et al. (2013) observed various functional compounds like water, protein, polysaccharide and lipids from marine algae Sargassum muticum using FTIR. Though the GC-MS analysis of crude extract of U. fasciata revealed many components, the main chemical constituents observed in high percentage were Bis(2-ethylhexyl) phthalate and 1,2-benzenedicarboxylic acid-butyl which may also be involved in antagonism against V. harveyi. Challenge against V. harveyi during P. monodon postlarvae revealed that U. fasciata extract showed 32.40% Sivakumar et al. 811 Table 3. GC-MS profile of U. fasciata. Retention time (min) 4.03 5.29 8.75 8.88 9.37 11.67 11.77 13.15 14.21 14.29 15.21 15.44 15.70 16.46 16.53 16.91 16.97 17.18 17.36 17.66 17.84 18.14 18.32 18.51 18.56 19.89 20.36 20.87 21.70 22.08 22.24 22.37 22.80 23.02 23.21 26.89 Compound’s name Anisole 1-Decene 5-Tetradecene, (E)Dodecane Benzothiazole 1-Tetradecene Tetradecane Phenol, 2,4-bis(1,1-dimethylethyl) Cetene Hentriacontane 8-Heptadecene Heptadecane Phenol, 2-(1-phenylethyl)1-Octadecene Octadecane Bicyclo[3.1.1]heptanes, 2,6,6-trimethyl,(1.alpha.,2.beta.,5.alpha) 2-Undecanone, 6,10-dimethylDibutyl phthalate Phytol, acetate Phthalic acid, butyl isohexyl ester Phthalic acid, 2-ethylhexyl pentyl ester 1,2-Benzenedicarboxylic acid, butyl Phthalic acid, butyl isohexyl ester 5-Eicosene, (E)Dodecane, 1,1'-oxybisSilanetriamine,1-azido-N,N,N',N', N'',N''hexamethylBehenic alcohol 1,2-Benzenedicarboxylic acid, butyl 2ethylhexyl ester Methyl dehydroabietate Octacosanol Phenol, 2,4-bis(1-phenylethyl)Phenol, 2,4-bis(1-phenylethyl)Bis(2-ethylhexyl) phthalate Naphthalene, 6-chloro-1-nitroBis(2-ethylhexyl) phthalate Benzo[h]quinoline, 2,4-dimethyl- reduction in the cumulative percentage of mortality as compared to control; but, Saptiani et al. (2011) has reported that ethyl acetate, n-butanol fractions of crude Acanthus ilicifolius extract controlled P. monodon postlarvae from V. harveyi infections. The supplementation of Undaria pinnatifida and fucoidon incorporated diet proved to enhance growth with reduced mortalities among P. monodon postlarvae caused by V. harveyi (Traifalgar et Peak area (%) 0.80 0.09 0.34 0.05 0.14 0.52 0.07 0.34 0.60 0.10 0.23 0.06 0.19 0.47 0.06 Molecular formula C7H8O C10H20 C12H28 C12H26 C7H5NS C14H28 C14H30 C14H22O C16H32 C31H64 C17H34 C17H36 C14H14O C18H36 C18H38 Molecular weight 108.13 140.26 196.37 170.33 135.18 196.37 198.38 206.32 224.42 436.83 238.45 240.46 198.26 252.48 254.49 0.32 C10H18 138.24 0.13 0.30 0.11 0.45 0.09 2.47 1.12 0.66 0.10 C13H26O C16H22O4 C22H42O2 C18H26O4 C21H32O4 C20H30O4 C18H26O4 C20H40 C24H50O 198.34 278.34 338.56 306.39 348.47 334.44 306.39 280.53 354.65 0.21 C6H18N6Si 202.33 0.26 C22H46O 326.60 0.27 C20H30O4 334.44 0.10 0.12 0.25 0.49 0.45 0.13 88.42 0.22 C21H30O2 C28H58O C30H29N3O3 C30H29N3O3 C24H38O4 C10H6ClNO2 C24H38O4 C15H13N 314.46 410.75 479.56 479.56 390.55 207.61 390.55 207.27 al., 2009). Marine algae are impending source for owning extensive range of polyunsaturated fatty acids (PUFA), carotenoids, phycobiliproteins, polysaccharides and phycotoxins, etc (Chu, 2012). It was reported that lipids obstruct microbesby distracting cellular membrane (Bergsson et al., 2011) of bacteria, fungi and yeasts. These fatty acids may further distress the expression of bacterial virulence which was significant for establishing infections. 812 Afr. J. Microbiol. Res. Table 4. Challenging of crude extracts of U. fasciata against V. harveyi during P. monodon larviculture with the cumulative percentage mortality reduction. Cumulative percentage mortality Day 0 5th 10th 15th 20th 25th 30th Control tubs with V. harveyi 0.00 13.66В±0.3 26.05В±0.9 35.63В±1.1 47.33В±1.5 62.13В±2.3 76.30В±2.9 Treatment tubs extract with V. harveyi 0.00 06.96В±0.2 14.36В±0.3 21.33В±0.6 27.81В±1.1 36.63В±1.3 43.90В±1.3 Tubs with extract and PL alone 0.00 2.39п‚±0.1 6.19п‚±0.2 12.05п‚±0.5 18.13п‚±0.6 24.69п‚±0.9 29.56п‚±1.0 Tubs with PL alone 0.00 3.23п‚±0.1 6.03п‚±0.2 13.33п‚±0.5 17.43п‚±0.5 23.86п‚±1.0 28.39п‚±1.0 Treatment tubs (cfu/ml) Total plate V. harveyi count 1.24п‚ґ106 1.15п‚ґ106 2.42п‚ґ104 2.38п‚ґ104 2.15п‚ґ104 1.56п‚ґ104 4 7.40п‚ґ10 4.30п‚ґ103 4 1.29п‚ґ10 3.40п‚ґ103 9.40п‚ґ104 5.40п‚ґ103 4 8.20п‚ґ10 4.10п‚ґ103 Control tubs (cfu/ml) Average weight of postlarvae (mg) Total plate count V. harveyi Treatment tubs Control tubs 1.18п‚ґ106 3.18п‚ґ105 2.94п‚ґ105 1.51п‚ґ105 2.66п‚ґ104 1.80п‚ґ104 1.74п‚ґ104 2.41п‚ґ106 3.40п‚ґ105 1.44п‚ґ105 1.45п‚ґ105 2.49п‚ґ104 1.74п‚ґ104 1.51п‚ґ104 17.7 В± 3 60.9 В± 4 121.1 В± 4 156.3 В± 5 201.5 В± 9 236.9 В± 8 269.3 В± 9 18.1В±2 63.6В±3 127.5В±5 157.5В±5 197.9В±7 240.1В±9 266.5В±8 Water quality parameters for treatment and control tubs pH in pH in Temperature Salinity control treatment (В°C) (PSU) tubs tubs 29.0В±1.0 20В±0.5 8.40В±0.2 8.30В±0.2 29.5В±1.0 20В±0.5 8.50В±0.2 8.40В±0.2 29.0В±1.0 20В±0.5 8.20В±0.2 8.30В±0.2 30.0В±1.0 20В±0.5 8.40В±0.2 8.50В±0.2 30.0В±1.0 21В±0.5 8.10В±0.2 8.30В±0.2 31.0В±1.0 21В±0.5 8.40В±0.2 8.20В±0.2 30.0В±1.0 21В±0.5 8.10В±0.2 8.00В±0.2 Values of average of three determinations with standard deviation (SD) It has been demonstrated that fatty acids of chain length more than 10 carbon atoms would induce lysis of bacterial protoplasts. Due to the tough environments in which many macro algae exists, effective defense mechanisms have been established and consequently, amusing source of bioactive compounds, including polysaccharides, polyphenols, fatty acids and peptides, with dissimilar structures and activities than those found in terrestrial plants (Tierney et al., 2010). Many species of macro algae had foremost constituentslike tetradecanoic acid, hexadecanoic acid, octadecanoic acid methyl esters etc (Balamurugan et al., 2013) which may reveal antagonism against marine bacteria (Al-Saif et al., 2013). Lately, the secondary metabolites and organic extracts obtained from U. fasciata has potential applications (Silva et al., 2013b) and the diverse derivatives of diterpenoids extracted from U. fasciata exhibited antagonism against Vibrio parahaemolyticus and V. harveyi (Chakraborty et al., 2010). Thus, in the present study, biological activity of U. fasciata against V. harveyi was due to the presence of various chemical constituents as described. Hence, macro algae U. fasciata extract will have immense applications in aquaculture. Conclusion Results from this study proved that the crude extract of U. fasciata at 300 Вµg/ml inhibited the growth and modulated the virulences produced by V. harveyi. U. fasciata extract at 200 Вµg/ml also controlled the mortality caused by V. harveyi during shrimp larviculture. Based on this study, the U. fasciata extract can be used as alternative bio-inhibitors for the aquaculture practices. Application of such bio-products would moderate the undesirable contamination from applying the synthetic compounds with reduced cost and ecofriendly nature. ACKNOWLEDGEMENTS The authors greatly acknowledge the Department of Biotechnology (DBT), Government of India for sponsoring the project entitled “Development of inhibitors for controlling quorum sensing luminescence disease causing Vibrio harveyi in shrimp larviculture system” during 2010. This work was a component under this project (BT/PR/13383/AAQ/03/501/2009). REFERENCES Al-Saif SSAL, Abdel-Raouf N, El-Wazanani HA, Aref IA (2013). Antibacterial substances from marine algae isolated from Jeddah coast of Red Sea, Saudi Arabia. Saudi J. Biological Sci. (article in press). Azizi S, Namvar F, Mahdavi M, Ahmad MB, Mohamad R (2013). Biosynthesis of silver nanoparticles using brown marine macro alga, Sargassum muticum aqueous extract. Materials 6:5942-5950. Balamurugan M, Selvam GG, Thinakaran T, Sivakumar K (2013). Biochemical Study and GC-MS Analysis of Hypnea musciformis (Wulf) Lamouroux. American-Eurasian J. Sci. Res. 8(3):117-123. Bergsson G, Hilmarsson H, Thormar H (2011). Antibacterial, antiviral and antifungal activities of lipids. In: Thormar H. (eds), Lipids and essential oils as antimicrobial agents. John Wiley and Sons Limited, Chichester, United Kingdom. pp. 47-80. Sivakumar et al. Chakraborty K, Lipton AP, Paulraj R, Vijayan KK (2010). Antibacterial labdanediterpenoidsof Ulva fasciata Delile from southwestern coast of the Indian Peninsula. Food Chem. 119(4):1399-1408. Chu WL (2012). Biotechnological applications of microalgae. IeJSME 6(1):S24-S37. Dittert I M, Vilar VJP, da Silva EAB, de Souza SMAGU, de Souza AAU, Botelho CMS, Boaventura RA (2012). Adding value to marine macro algae Laminaria digitata through its use in the separation and recovery of trivalent chromium ions from aqueous solution. Chem. Eng. J. 193:348-357. D'Souza L, Devi P, Shridhar DM, Naik CG (2008). Use of Fourier Transform Infrared (FTIR) spectroscopy to study cadmium-induced changes in Padina tetrastromatica (Hauck). Anal. Chem. Insights 3:135-143. Harris L, Owens L, Smith S (1996). A selective and differential medium for Vibrio harveyi. Appl. Enviorn. Microbiol. 62(9):3548-3550. Huynh TG, Yeh ST, Lin YC, Shyu JF, Chen LL, Chen JC (2011). White shrimp Litopenaeus vannamei immersed in seawater containing Sargassum hemiphyllum var. Chinense powder and its extract showed increased immunity and resistance against Vibrio alginolyticus and white spot syndrome virus. Fish Shellfish Immunol. 31(2):286-93. Islam MA, Alam MM, Choudhury ME, Kobayashi N, Ahmed MU (2008). Determination of minimum inhibitory concentration of cloxacillin for selected isolates of methicillin-resistant Staphylococcus aureus (MRSA) with their antibiogram. Bangl. J. Vet. Med. 6(1):121-126. Kanjana K, Radtanatip T, Asuvapongpatana S, Withyachumnarnkul B, Wongprasert K (2011). Solvent extracts of the red seaweed Gracilaria fisheri prevent V. harveyi infections in the black tiger shrimp Penaeus monodon. Fish Shellfish Immunol. 30(1):389-396. Kannappan S, Sivakumar K, Patil PK (2013). Effect of garlic extract on the luciferase, bio-luminescence, virulence factors produced by V. harveyi with a challenge during Penaeus monodon larviculture. Afr. J. Microbiol. Res. 7(18):1766-1779. Kolanjinathan K, Stella D (2011). Comparative studies on antimicrobial activity of Ulva reticulata and Ulva lactuca against human pathogens. Int. J. Pharma. Biol. Archives 2(6):1738-1744. Musharraf SG, Ahmed MA, Zehra N, Kabir N, Choudhary MI, Rahman AU (2012). Biodiesel production from micro algal isolates of southern Pakistan and quantification of FAMEs by GC-MS/MS analysis. Chem. Cent. J. 6(1):1-10. Osman MEH, Aboshady AM, Elshobary ME (2013). Production and characterization of antimicrobial active substance from some macro algae collected from Abu- Qir bay (Alexandria) Egypt. Afr. J. Biotechnol. 12(49):6847-6858. Paul JJP, Devi SDKS (2013). Seasonal variability of Ulva species (Green seaweed) in Tirunelveli region, the southeast coast of Tamil Nadu, India. Res. J. Marine Sci. 1(1):14-17. Peso-Echarri P, Frontela-Saseta C, Gonzalez-Bermudez CA, RosBerruezo GF, Martinez-Gracia C (2012). Polysaccharides from seaweed as ingredients in marine aquaculture feeding: alginate, carrageenan and ulvan. Revista de Biologia Marina y Oceanografia 47(3):373-381. Premalatha M (2011). Phytochemical characterization and antimicrobial efficiency of seaweed samples, Ulva fasciata and Chaetomorpha antennina. Int. J. Pharma Bio Sci. 2(1):P288-293. Priyadharshini S, Bragadeeswaran S, Prabhu K, Sophia Rani S (2012). Antimicrobial and hemolytic activity of seaweed extracts Ulva fasciata (Delile 1813) from Mandapam, Southeast coast of India. Asian Pac. J. Trop. Biomed. S38-S39. Rahman S, Khan SN, Naser MN, Karim MM (2010). Isolation of Vibrio spp. from Penaeidshrimp hatcheries and coastal waters of Cox‟s Bazar, Bangladesh. Asian J. Exp. Biol. Sci. 1(2):288-293. 813 Raissy M, Momtaz H, Moumeni M, Ansari M, Rahimi E (2011). Molecular detection of Vibrio spp. in lobster haemolymph. Afri. J. Microbiol. Res. 5(13):1697-1700. Saptiani G, Prayitno SB, Anggoro S (2011). Inhibition test of jeruju (Acanthus ilicifolius) leaf extracts on the in vitro growth of the Vibrio harveyi. Paper. Simposium Nasional Kimia Bahan Alam XIX. Simnas KBA. Samarinda 11-12 p October (In Indonesian). Saritha K, Mani AE, Priyalaxmi M, Patterson J (2013). Antibacterial activity and biochemical constituents of seaweed Ulva lactuca. Global J. Pharmacol. 7(3):276-282. Selvin J, Manilal A, Sujith S, Kiran GS, Lipton AP (2011). Efficacy of marine green alga Ulva fasciata extracts on the management of shrimp bacterial diseases. Lat. Am. J. Aquat. Res. 39(2):197-204. Silva GC, Albuquerque-Costa R, Oliveira-Peixoto JR, Macedo-Carneiro PBD, Fernandes-Vieira RHSD (2013a).Tropical Atlantic marine macro algae with bioactivity against virulent and antibiotic resistant Vibrio. Lat. Am. J. Aquat. Res. 41(1):183-188. Silva M, Vieira L, Almeida AP, Kijjoa A (2013b). The marine macro algae of the genus Ulva: chemistry, biological activities and potential applications. Oceanography 1:101. doi:10.4172/ocn.1000101. Sivakumar K, Kannappan S (2013). Inhibitory effect of marine algae collected from the East and West coast of India against luciferase and luminescence producing Vibrio harveyi. Afri. J. Biotechnol. 12(22):3493- 3502. Soto-Rodriguez SA, Gomez-Gil B, Lozano R, del Rio-Rodriguez R, Dieguez AL, Romalde JL (2012). Virulence of Vibrio harveyi responsible for the "Bright-red" Syndrome in the Pacific white shrimp Litopenaeus vannamei. J. Invertebrate Pathol. 109(3):307-317. Tierney MS, Croft AK, Hayes M (2010). A review of antihypertensive and antioxidant activities in macro algae. Botanica Marina 53(5):387408. Traifalgar RF, Serrano AE, Corre V, Kira H, Tung HT, Fady RM, Kader Md. A, Laining A, Yokoyama S, Ishikawa M, Koshio S (2009). Evaluation of dietary fucoidan supplementation effects on growth performance and Vibriosis resistance of Peneaus monodon postlarvae. Aquaculture Sci. 57:167-174. Vezzulli L, Previati M, Pruzzo C, Marchese A, Bourne DG, Cerrano C (2010). Vibrio infections triggering mass mortality events in a warming Mediterranean Sea. Environ. Microbiol. 12:2007-2019. Zhou J, Fang W, Yang X, Zhou S, Hu L, Li X, Qi X, Su H, Xie L (2012). A non-luminescent and highly virulent V. harveyi strain is associated with „„bacterial white tail disease‟‟ of Litopenaeus vannamei shrimp. PLoS One 7(2): e29961. Vol. 8(8), pp. 814-818, 19 February, 2014 DOI: 10.5897/AJMR2013.6512 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper Characterization and determination of antibiotic susceptibility pattern of bacteria isolated from some fomites in a teaching hospital in northern Nigeria Aminu Maryam1*, Usman-Sani Hadiza1 and Usman M. Aminu2 1 Department of Microbiology, Faculty of Science, Ahmadu Bello University, Zaria, Kaduna State, Nigeria. 2 University Health Services, Ahmadu Bello University, Main Campus, Zaria, Kaduna State, Nigeria. Accepted 30 January, 2014 Fomites are inanimate objects that can serve as vehicles for pathogens transfer. This study was conducted to determine the antibiogram of bacteria isolated from fomites in a teaching hospital in Nigeria. Exactly 35 samples were used for the study. Twenty three (65.7%) isolates were obtained; the ratio of Gram positive to Gram negative organisms was 12 to 11. The bacteria isolated were Staphylococcus aureus (21.7%), Staphylococcus epidermidis (8.7%), Streptococcus spp. (8.7%), Bacillus spp. (13.0%), Escherichia coli (26.1%), Pseudomonas spp. (8.7%) and Klebsiella spp. (13.0%). The isolated bacteria showed varying susceptibility pattern to the antibiotics used and were all susceptible to erythromycin and streptomycin. Key words: Bacteria, fomites, antibiotics, susceptibility, teaching hospital, Nigeria. INTRODUCTION Fomites consist of either porous or nonporous surfaces or inanimate objects that whencontaminated with pathogenic microorganisms can transfer them to a new host thereby serving as vehicles in transmission (Greene, 2009; Cramer, 2013). Fomites are associated particularly with hospital acquired infections (HAIs) that remain a major cause of patient morbidity and mortality (Weber et al., 2010; Nwankiti et al., 2012). An estimated 20 to 40% of HAIs have been attributed to cross infection via the hands of health care workers (HCWs), who have become contaminated from direct contact with the patient or indirectly by touching contaminated hospital environmental surfaces (Kelly, 2002; Christensen et al., 2007; Mangicaro, 2012). Fomites can therefore serve as reservoir with pathogens being spread from the inanimate environment to an animate (patient) environment via the hands of HCWs (Bhalla et al., 2004; Kramer et al., 2006; Ikeh and Isamade, 2011; Nwankiti et al., 2012). Stethoscopes, neckties (Merlin et al., 2009; Williams and Davis, 2009), skin cells, hair, food, computer keyboards, pens, tables, artificial acrylic fingernails (McNeil et al., 2001), bedding and clothing are common hospital sources of pathogens (Boyce et al., 1997; Cramer, 2013). Up to 60% of hospital staff’s uniforms are usually colonized with potentially pathogenic bacteria, including drug-resistant organisms (Munoz-Price et al., 2012). Intravenous fluid (IVF) tubes/stands, catheters, water systems and life support equipment can also be carriers, when the pathogens form biofilms on the surfaces (Willey et al., 2011; Cramer, 2013). Identification of common fomites and associated pathogens in any hospital settings is important because the most important factor in prevention of a disease is to simply identify what has been transferring the disease in the first place (Cramer, 2013). Fomites are therefore an opportunity to interrupt the spread of infection. *Corresponding author. E-mail: [email protected]. Tel: +234 803 328 7031. Maryam et al. 815 Table 1. Distribution of growth and organisms isolated from fomites in the A&E ward of ABUTH, Zaria-Nigeria. Fomite Table Stethoscope Uniform Pen Total no. of sample 5 5 5 5 Number with growth (%) 3 (60) 3 (60) 4 (80) 3 (60) IVF Stand 5 4 (80) Door knob Chair Total 5 5 35 3 (60) 3 (60) 23 (65.7) By recognizing them, avoiding them, disinfecting them, or cleansing the hands after touching them, the spread of many infections can be halted (Greene, 2009; Cramer, 2013). This study was therefore conducted to isolate bacteria from fomites in the Accident and Emergency (A&E) ward of Ahmadu Bello University Teaching Hospital, Zaria, Nigeria and to determine their antibiotic susceptibility pattern. METHODOLOGY A total of thirty-five (35) samples were collected from fomites (tables, chairs, stethoscopes, pens, uniforms, doorknobs and IVF stands) after the early morning cleaning and disinfection process in the A&E ward of Ahmadu Bello University Teaching Hospital, Zaria between the months of July and October 2010. The samples were collected using sterile swab sticks, transported immediately to the laboratory and cultured using the streak plate method on nutrient agar, MacConkey agar, Eosin methylene blue, mannitol salt agar, blood agar and centrimide agar as described by Cheesbrough (2006). The plates were incubated at 37В°C for 24 h; the isolates were sub-cultured, maintained on Nutrient Agar slants and identified based on their cultural morphology, Gram and biochemical reactions (Cheesbrough, 2006). Antibiotic sensitivity testing was performed using Mueller-Hinton agar. Inoculums were prepared by standardizing using the McFarland’s standard. Standard antibiotic discs containing augmentin, ampiclox, septrin, ceftriaxone, ampicillin, ciprofloxacin, erythromycin, lincomycin, nitrofurantoin, ofloxacin, streptomycin, tetracycline and gentamycin with concentrations of 30, 3, 250, 30, 15, 25, 10 m, 30, 200, 10, 10, 25, 10 mcg, respectively were used. The discs were placed on the plates which were inverted and kept in the refrigerator for 30 min and then incubated at 37В°C for 24 h. A clear zone of growth inhibition around a disc determined the relative susceptibility of each isolate to the antibiotics. RESULTS AND DISCUSSION A total of 23 (65.7%) bacterial growths were obtained from the culture with uniforms and IVF stands showing highest number of growth each (80%: 4/5), followed by tables, stethoscopes, pens, door knobs and chairs each having 60% (3/5) (Table 1). The percentage of growth obtained was lower than the 99% obtained in a previous Organism(s) isolated S. aureus, Bacillus spp. S. epidermidis, E. coli Klebsiella spp. S. aureus, E. coli, Streptococcus spp., S. aureus, Bacillus spp, E. coli Streptococcus spp., S. epidermidis, Klebsiella spp. Pseudomonas spp. S. aureus, E. coli S. aureus, E. coli, Bacillus spp. study in Nigeria (Ikeh and Isamade, 2011). Majority of the isolates were Gram positives organisms (52.2%: 12/23) as compared to the Gram negative (47.8%: 11/23). Staphylococci were isolated from all the fomites; S. epidermidis (8.7%: 2/23) from IVF stand and stethoscope and S. aureus (21.7%: 5/23) from the other fomites (Table 2). Isolation of more Gram positive organisms is consistent with previous reports (Neely and Maley, 2000; Chikere et al., 2008) and agree with the statement that Grampositive bacteria have overtaken the Gram-negative as the predominant bacteria isolated from fomites (Inweregbu et al., 2005). Gram-positive organism have earlier been noted to be causing more serious infections than ever before in surgical patients, who are increasingly aged, ill and debilitated (Barie, 1998). In a more recent study, only Gram positive organisms were isolated (Ikeh and Isamade, 2011). Isolation of more Gram positive organisms is probably because they are members of the body flora of both asymptomatic carriers and sick persons. These organisms can be spread by the hand, expelled from the respiratory tract or transmitted by animate or inanimate objects (Chikere et al., 2008). Their main source(s) of colonization on the fomites might likely be nasal carriage by hospital personnel (Graham et al., 2006), likely facilitated by hand-to-mouth or hand-to-nose contact while using these fomites, and/or by poor hand-washing habits (ASM, 2005). Isolation of Staphylococcus aureus from almost all the fomites show their ubiquitous nature and that they can be sources of infection to patients as previously noted (Hartmann et al., 2004; Inweregbu et al., 2005; Ikeh and Isamade, 2011). Although the strains of the isolated S. aureus were not determined in this study, methicillin resistant Staphylococcus aureus (MRSA) strains have been shown to be transmissible from many fomites to skin (Desai et al., 2011). For example, an earlier study showed that one in three stethoscopes tested to harbour Staphylococcus aureus and that 15% of all stethoscopes tested were contaminated with MRSA (Williams and Davis, 2009). Staphylococcus epidermidis 816 Afr. J. Microbiol. Res. Table 2. Frequency of isolation of bacteria from fomites in the A&E Ward of ABUTH, Zaria-Nigeria (N = 23). Bacteria Isolated Staphylococcus aureus Staphylococcus epidermidis Streptococcus spp. Bacillus spp. Escherichia coli Pseudomonas spp. Klebsiella spp. Frequency 5 2 2 3 6 2 3 Percentage (%) 21.7 8.7 8.7 13.0 26.1 8.7 13.0 Table 3. Parentage susceptibility of bacterial isolates to common antibiotic. Organism S. aureus S. epidermidis Streptococcus spp. Bacillus spp. E. coli Pseudomonas spp. Klebsiella spp. CN 40 50 50 33.3 100 100 100 OFX 40 50 50 33.3 50 100 33.3 CPX 60 100 100 66.7 83.3 50 - CRO 60 100 50 100 66.7 50 100 SXT 60 50 100 100 16.7 50 10 E 100 100 100 100 - L 80 50 100 100 - S 100 100 100 66.7 - APX 80 100 50 66.7 - AG 20 50 50 - COX 100 66.7 C 100 50 100 N 83.3 66.7 PM 50 100 T 50 50 66.7 CN = Gentamycin; OFX = ofloxacin; CPX = ciprofloxacin; CRO = ceftriazone; SXT = cotrimozazole; E = erythromycin; L = lincomycin; S = streptomycin; APX = ampiclox; AG = augmentin; COX = cephalexin ; C = chloramphenicol; N = nitrifurantoin; PM = ampicillin; T= tetracyclin. was isolated with the lowest frequency in this study. Though these strains of staphylococci are known to be non-pathogenic on the body, when they harbor antimicrobial resistance genes they constitute serious health hazard. This coagulase negative Staphylococci have been isolated from keyboards on multiple user computers (Hartmann et al., 2004) and increased virulence of this organism resulting from the acquisition of methicillin resistance has been recognized (Ben-Saida et al., 2006). Other bacteria isolated were Streptococcus spp. (8.7%: 2/23) from IVF stand and uniforms, Bacillus spp. (13.0%: 3/23) from pens, tables and chairs, Escherichia coli (26.1%: 6/23) from all the fomites except table and IVF stand, Klebsiella spp. (13.0%: 3/23) from IVF stand and stethoscopes and Pseudomonas spp. (8.7%: 2/23) from only IVF stand. Bacillus spp., the only Gram positive bacilli encountered in this study has been isolated with the highest frequency in some studies in Nigeria: 84 (Nwankiti et al., 2012) and 90% (Ikeh and Isamade, 2011). This organism forms endospores, which, probably from the air can settle on the surface of fomites in the hospital, explaining why they were isolated mainly from tables and chairs. Although, Gram positive organisms were more frequently isolated in this study, the Gram negative bacterium Escherichia coli was the most prevalent. E. coli were isolated from almost all the fomites except IVF stands and tables probably due to fecal contamination as a result of improper hand washing after the use of toilet. This is evident in its isolation from pens, stethoscopes and doorknobs which are usually held and touched by hands. As previously reported (Williams and Davis, 2009), the Gram negative bacteria Klebsiella spp. and Pseudomonas spp. were isolated from stethoscopes and IVF stand in this study. Gram-negative bacteria are responsible for a high proportion of HAIs, particularly among the critically ill and those in hospital for long periods (Gould and Chamberlain, 1994). The isolated bacteria showed varying susceptibility pattern to the antibiotics used (Table 3). All the S. aureus and S. epidermidis isolates were sensitive to erythromycin and streptomycin (100%). Streptococcus spp. were most sensitivity (100%) to ciprofloxacin, septrin, erythromycin, streptomycin and ampiclox. All the isolated E. coli were susceptible to gentamycin, cephalexin and chloramphenicol while all the isolated Pseudomonas spp. were susceptible to gentamycin and ofloxacine. Similarly, all the Klebsiella spp. isolates were susceptible to gentamycin, ceftriazone, chloramphenicol and ampicillin. Susceptibility of all the organisms isolated to Erythromycin and Streptomycin does not necessary imply that these antibiotics may represent therapeutic options for infections caused by these organisms. S. aureus and S. epidermidis showed similar susceptibility pattern being Maryam et al. highly susceptible to Streptomycin and resistant to Augmentin. Augmentin may therefore not be a drug of choice for treatment of infections caused by these organisms. The Gram positive isolates were resistant to gentamycin and ofloxacin while the Gram negative isolates were resistant to Cotrimozazole, indicating that these antibiotics might not be very effective in the treatment of HAIs that might results from infection with these pathogens. Similar weakness and susceptibility in activity of antibiotics against bacteria from clinical specimens have been shown (Chikere et al., 2008). As more bacteria become resistant to antibiotics, the ability to control the spread of these bacteria with antibiotic treatments decreases. The isolation of potential pathogens such as S. aureus and Streptococcus spp. from IVF stands and uniforms of HCWs in the A&E ward confirms the possibility of cross infections from workers to patients. This implies that these fomites might act as vehicles for transfer of these pathogens hence etiologic agents for infectious pathogens. Many studies have shown uniforms to be potential reservoirs for hospital organisms, potentially reinfecting the hands of HCWs (Boyce et al., 1997; Snyder et al., 2008; Munoz-Price et al., 2012). Treakle et al. (2009) showed a large proportion of HCWs' white coats to be contaminated with S. aureus, including MRSA and postulated that white coats may be an important vector for patient-to-patient transmission of S. aureus. Potential pathogens such as S. aureus, Acinetobacter spp. and enterococci have been recently isolated from hands that were used to touch uniforms (Munoz-Price et al., 2012). Similarly, isolation of E. coli from door knobs simply implies that they can be easily transmitted to anybody that opened the door to the A&E ward. One can therefore easily postulate how these fomites could become vectors for the spread of pathogenic organisms in the A&E ward as a HCW moves from one patient to another and these fomites contacts different patients. In the A&E Ward of ABUTH, we observed that reusable cleaning cloths soaked in bucket of water containing OmoR detergent are used irregularly to clean door knobs and tables; while methylated spirit is used to clean the IV stands once or twice a week. Floors are cleaned with mops dipped in diluted SalvonR every morning and evening while JikR is used only when there is contamination with blood. The cloths and mops used in cleaning are however not adequately cleaned and disinfected, as most often, the water containing the disinfectant is not changed until the cleaning is completed. It has been shown that if water-disinfectant mixture used in cleaning is not changed regularly, the mopping procedure actually can spread heavy microbial contamination throughout the health-care facility (Mangicaro, 2012). Irregular cleaning and effective disinfection of door knobs to the A&E ward, tables, chairs and IV stands in the ward may allow pathogens that contaminate them by 817 settling on them or by hand, to survive and be transmitted to patient or HCWs. Although surface cleaners play a role in reducing the spread of infections, not all disinfectants work equally well at killing all pathogens (Boskey, 2011). Some pathogens are more susceptible to specific detergents than others. Therefore, the need for regular cleaning and effective disinfection of fomites identified to be easily contaminated with specific pathogens is very crucial. The effective use of disinfectants constitutes an important factor in preventing HAIs and improved cleaning/disinfection of environmental surfaces and hand hygiene have been shown to reduce the spread of hospital acquired pathogens (Rutala and Weber, 2001; Nicolle, 2002; Christensen et al., 2007; Weber et al., 2010; Boskey, 2011). Conclusion and recommendation The isolation of pathogenic bacteria from fomites in this study indicates that they can be vehicles for disease transmission. In the light of this, there is need therefore for thorough disinfection and conscientious contact control procedures to minimize the spread of these pathogens in the A&E ward where interaction between patients, HCWs and caregivers is very common and frequent. It is also necessary to encourage the effective use of disposable hand gloves between patients and to avoid touching fomites with gloved hands, which may be acting as sources of infection. Limitation of study Small sample size and inability to determine if the S. aureus isolated were MRSA. ACKNOWLEDGEMENTS We acknowledge all the personnel at the Accident and Emergency ward of ABUTH for their cooperation during sample collection. REFERENCES American Society for Microbiology (ASM) (2005). Women better at hand hygiene habits, hands down. ASM Press Releases: 2005. Available from: http://www.asm.org/Media/index.asp. Cited 2013 July 9. Barie PS (1998). Antibiotic-resistant Gram-positive cocci: implications for surgical practice. Wld. J. Surg. 22(2):118-126. Ben-Saida N, Ferjeni A, Benhadjtaher N, Monastiri K, Boukadida J (2006). Clonality of clinical methicillin resistant Staphylococcus epidermidis isolates in a neonatal intensive care unit. Patholo. Biol. 54:337-342. Bhalla A, Pultz NJ, Gries DM, Ray AJ, Eckstein EC, Aron DC, Donskey CJ (2004). Acquisition of nosocomial pathogens on hands after contact with environmental surfaces near hospitalized patients. Infect. Control Hosp. Epidemiol. 25:164-167. 818 Afr. J. Microbiol. Res. Boskey E (2011). What is Fomite Transmission. Updated April 06, 2011. th Accessed 13 Nov 2013. Available from: http://std.about.com/od/glossary/g/What-Is-Fomite-Transmission.htm. Boyce JM, Potter-Bynoe G, Chenevert C, King T (1997). Environmental contamination due to methicillin-resistant Staphylococcus aureus: possible infection control implications. Infect. Control Hosp. Epidemiol. 18:622-627. Cheesbrough M (2006). District Laboratory Practice in Tropical Countries. Part 2. Cambridge University Press, United Kingdom. Chikere, CB, Omoni VT, Chikere BO (2008). Distribution of potential nosocomial pathogens in a hospital environment. Afri J. Biotech. 7(20):3535 -3538. Christensen TE, JГёrgensen JS, Kolmos HJ (2007). The importance of hygiene for hospital infections. Ugeskr Laeger. 169(49):4249-4251. Cramer L (2013). Fomites, fomite, fomite! Available from: http://www.microbiology.com//p=961. Accessed 19 Nov 2013. Desai R, Pannaraj PS, Agopian J, Sugar CA, Liu GY, Miller LG (2011). Survival and transmission of community-associated methicillinresistant Staphylococcus aureus from fomites. Am. J. Infect. Contrl. 39(3):219-225. Gould D, Chamberlain A (1994). Gram-negative bacteria: the challenge of preventing cross-infection in hospital wards: a review of the literature. J. Clin. Nurs. 3(6):339-345. Graham P, Lin S, Larson EA (2006). US population based survey of Staphylococcus aureus colonization. Ann. Internal Med. 144:318-325. Greene A (2009). Fomites. Available from: http://www.drgreene.com/articles/fomites/. Reviewed by Le-Bucklin K-V, Hicks R January 12, 2009. Accessed 4 Nov 2013. Hartmann B, Benson M, Junger A, Quinzio L, RГ¶hrig R, Fengler B, FГ¤rber UW, Wille B, Hempelmann G (2004). Computer keyboard and mouse as a reservoir of pathogens in an intensive care unit. J. Clin. Monitor Comput.18 (1):7-12. Ikeh EI, Isamade ES (2011). Bacterial flora of fomites in a Nigerian multi-disciplinary intensive care unit. Lab. Med. 42:411-413. Inweregbu K, Dave J, Pittard (2005). Nosocomial infections. Contin. Educ. Anaesth, Crit. Care Pain 5(1):4-17. Kelly MP (2002). Fomites role in disease transmission is still up for debate. Cited 2012 August 12. Available from: http://www/infectioncontroltoday.com. Kramer A, Scwebke I, Kampf G (2006). How long do nosocomial pathogens persist on inanimate surfaces? A systematic review. BMC Infect. Dis 6:130. Mangicaro S (2012). Fomites: a vector for infection transmission. Updated March 20, 2012; cited July 9 2013. Available from: http://www.gnyhaservices.com/801/File.aspx. McNeil SA, Foster CL, Hedderwick SA, Kauffman CA (2001). Effect of hand cleansing with antimicrobial soap or alcohol-based gel on microbial colonization of artificial fingernails worn by health care workers. Clin. Infect. Dis. 32(3):367-372. Merlin MA, Wong ML, Pryor PW, Rynn K, Marques-Baptista A, Perritt R, Stanescu CG, Fallon T (2009). Prevalence of methicillin-resistant Staphylococcus aureus on the stethoscopes of emergency medical services providers. Prehosp. Emerg. Care. 13(1):71-74. Munoz-Price LS, Arheart KL, Mills JP (2012). Associations between bacterial contamination of health care workers' hands and contamination of white coats and scrubs. Am. J. Infect. Contrl. 40(9):e245-8. doi: 10.1016/j.ajic.2012.03.032. Neely AN, Maley MP (2000). Survival of enterococci and staphylococci on hospital fabrics and plastic. J. Clin. Microbiol. 38(2):724-726. Nicolle EL (2002). Nosocomial infections. Available from: http://www.sciencedirect.com/. Accessed 7 August 2012. Nwankiti OO, Ndako JA, Nwankiti AJ, Okeke OI, Uzoechina AR, Agada GO (2012). Computer keyboard and mouse: etiologic agents for microbial infections. Nat. Sci. 10(10):162-166. Rutala WA, Weber DJ (2001). Surface disinfection: should we do it? J. Hosp. Infect. 48 Suppl A:S64-68. Snyder GM, Thom KA, Furuno JP, Perencevich EN, Roghmann MC, Strauss SM, Netzer G, Harris AD (2008). Detection of methicillinresistant Staphylococcus aureus and vancomycin-resistant enterococci on the gowns and gloves of healthcare workers. Infect. Control Hosp. Epidemiol. (7):583-9. Treakle AM, Thom KA, Furuno JP, Strauss SM, Harris AD, Perencevich EN (2009). Bacterial contamination of health care workers' white coats. Am. J. Infect. Control 37(2):101-5. Weber DJ, Rutala WA, Miller MB, Huslage K, Sickbert-Bennett E (2010). Role of hospital surfaces in the transmission of emerging health care-associated pathogens: norovirus, Clostridium difficile, and Acinetobacter species. Am. J. Infect. Control 38(5 Suppl 1):S25-33. Willey JM, Sherwood LM, Woolverton CJ. (2011). Epidemiology and public health microbiology: Nosocomial infections. In: Willey JM, Sherwood LM and Woolverton CJ. edited Prescott’s Microbiology.8th Edition, New York. The McGraw Hill Companies. International Edition. pp. 873,884-886. Williams C, Davis DL (2009). Methicillin-resistant Staphylococcus aureus fomite survival. Clin. Lab. Sci. 22(1):34-38. Vol. 8(8), pp. 819-824, 19 February, 2014 DOI: 10.5897/AJMR2013.6517 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research paper Prevalence of different enterococcal species isolated from blood and their susceptibility to antimicrobial drugs in Vojvodina, Serbia, 2011-2013 MihajloviД‡-Ukropina Mira*, MediД‡ Deana, JelesiД‡ Zora, Gusman Vera, MilosavljeviД‡ Biljana and RadosavljeviД‡ Biljana Institute of Public Health of Vojvodina, Centre for Microbiology, University of Novi Sad, Faculty of Medicine, Serbia. Accepted 20 January, 2014 Enterococci are one of the leading causes of nosocomial infections worldwide. Enterococcus faecalis and Enterococcus faecium are the most commonly isolated. The aim of this study was to determine prevalence of these species isolated from blood samples of hospitalized patients and their susceptibility to antibiotics particularly to vancomycin and high concentrations of aminoglycosides. A total of 89 enterococcal strains isolated from blood samples between January 1st 2011 and August 31st 2013 were tested. The species identification and susceptibility to antimicrobial drugs were performed using automated VITEK 2 system. The most common species was E. faecalis (55.05%), followed by E. faecium (41.57%). The enterococcal isolates were multidrug resistant with E. faecium resistance to vancomycin of 54.05%, while resistance in E. faecalis was not found. All vancomycin resistant enterococci had VanA phenotype of resistance. Thirty three (89.18%) isolates of E. faecium were high-level gentamycin resistant and 32 (91.4%) were resistant to high concentration of streptomycin, whereas frequency of resistant E. faecalis was 61.2 and 63.04%, respectively. This study shows that resistance in enterococcal species is a serious clinical problem in our hospital and suggests the need for regular susceptibility test and species level identification of enterococcal isolates. Key words: Enterococci, blood culture, antimicrobial resistance. INTRODUCTION Enterococci are part of normal flora of gastrointestinal tract of humans and animals, but they have also emerged as significant cause of serious infection such as endocarditis, urinary and blood stream infections, intraabdominal end intra-pelvic abscesses (Moellering, 1992; Teixeira and Facklan, 2003). Among enterococci, Enterococcus faecalis (E. faecalis) and Enterococcus faecium (E. humans. Over the last two decades, they became one of faecium) are responsible for the majority of infections in the most frequent causes of intrahospital infections particularly because of increasing resistance to a wide range of antibiotics (Schaberg et al., 1991; Low et al., 2001; Chou, 2008; Hidron et al., 2008; Bereket, 2012; Sievert et al., 2013). Enterococci have both an intrinsic and acquired resistance (Murray, 1990, 2000; Leclercq, 1997). They *Corresponding author. E-mail: [email protected]. Tel: +381638657743. Fax: +381216613989. Abbreviations: E. faecalis, Enterococcus faecalis; E. faecium, Enterococcus faecium; ATCC, American Type Culture Collection; PBP, penicillin binding protein; HLAR, high-level aminoglycoside resistance; VRE, vancomycin resistant enterococci; SPSS, statistical package for the social sciences; ICU, intensive care unit. 820 Afr. J. Microbiol. Res. are intrinsically resistant to penicillinase-susceptible penicillins (low level), penicillinase-resistant penicillins, cephalosporins, sulphonamides, clindamycin and lowlevel concentrations of aminoglycosides. Acquired resistance to penicillins, chloramphenicol, tetracyclins, aminoglycosides (high-level) and vancomycin develops either by mutation or transfer of plasmids and transposons. Resistance of many beta-lactams is as a result of overproduction and modification of penicilin-bindingproteins (PBPs), particularly PBP5, with low affinity for antibiotics. High-level aminoglycoside resistance (HLAR) can be mediated by single mutation within a protein of the 30S ribosome subunit or by production of amino-glycosidemodifying enzymes. Acquired resistance to glycopeptides occurs because of synthesis of modified cell wall precursors with decreased affinity for these drugs. Nine phenotypes of glycopeptide resistance (VanA, B, C, D, E, G, L, M, N) have been detected (Arthur, 1993; Perichon et al., 1997; Fines et al., 1999; Xu et al., 2010; Lebreton et al., 2011). The most common and clinically significant are VanA, that determine high-level resistance to both vancomycin and teicoplanin, and VanB with variable resistance to vancomycin only. Resistance to wide range of antibiotics is a great problem to clinicians because it has seriously affected the treatment of enterococcal infections leaving limited therapeutic options. Keeping in mind that antimicrobial susceptibility of enterococci is not predictable and that it differs by enterococcal species and changes rapidly over time, species identification and its susceptibility to antimicrobial drugs are important for clinicians for choosing the most effective drug and also useful for epidemiological investigations. The aim of this study was to determine prevalence of E. faecalis and E. faecium isolated from blood and their susceptibility to antibiotics particularly, vancomycin and high concentration of aminoglycosides. MATERIALS AND METHODS This study was conducted at the Centre for Microbiology of Institute of Public Health, Vojvodina. A total of 89 enterococcal strains that were isolated from blood samples of hospitalized patients between January 1st 2011 and August 31st 2013 were included in the study. All blood samples were routinely cultured in blood culture bottles (Bio Merieux, France) using semi-automated blood culture system (Bact/Alert, Bio Merieux, Marcyl’ Etoile, France). The positive samples were inoculated onto blood and MacConkey agar plate (HiMedia, India) that were incubated aerobically for 24 h at 37В°C. Enteococcal genus identification was based on colony morphology, Gram staining results, catalase reaction, growth on bile-esculin agar and tolerance to 6.5% NaCl. The species identification was done using automated VITEC 2 system (BioMerieux). Susceptibility to ampicillin, gentamycin (high-level), streptomycin (high-level), ciprofloxacin, vancomycin, teicoplanin, linezolid, tigecycline, chloramphenicol and quinopristin/ dalfopristin was determined using VITEK 2 system according to Clinical Laboratory Standards Institute guideline (2010, 2011, 2012). E. faecalis American Type Culture Collection (ATCC) 29212 was used as control. Statistical analysis The statistical differences were analyzed using x2 test. The test was performed using SPSS (statistical package for the social sciences). A p-value of < 0.05 was considered significant . RESULTS Among 89 enterococci isolated from blood samples, the most common species was E. faecalis (55.05%), followed by E. faecium (41.57%). There was no significant difference between prevalence of these two species (p value = 0.196). Prevalence of all enterococcal species isolated from blood is given in Table 1. Susceptibility of E. faecium and E. faecalis to antibiotics is shown in Table 2. Resistance of E. faecium isolates to all antibiotic tested, except to chloramphenicol, was higher as compared to E. faecalis strains. A high percentage of E. facium resistant to vancomycin (54.05%) was detected, while resistance in E. faecalis was not found. All vancomycin resistant enterococci (VRE) were resistant to teicoplanin also, belonging to VanA phenotype of resistance. Thirty three (89.18%) isolates of E. faecium were high-level gentamycin resistant and 32 (91.4%) were high-level streptomycin, whereas the number of resistant E. faecalis was 30 (61.2%) and 29 (63.04%), respectively. The difference in resistance to gentamycin and streptomycin in these two species was statistically significant (p = 0.004 and p = 0.003, respectively). The most effective antibiotics were linezolid and tigecycline against all isolates tested. Unlike E. faecium, all isolates of E. faecalis were susceptible to vancomycin and teicoplanin also. E. faecium isolates were susceptible to quinopristin/dalfopristin. Resistance to other antibiotics range from 37.2% for chloramphenicol to 83.3% for ciprofloxacin in E. faecalis isolates. In E. faecium it was between 9.3% for chloramphenicol and 97.2% for ampicillin. All E. faecium 89.7% isolates of E. faecalis were resistant to three or more groups of antibiotics and the most common multidrug resistant profile in E. faecium was resistance to ampicillin, high-level concentrations of aminoglycosides, vancomycin, and ciprofloxacin. Resistance to ampicillin, high-level concentrations of aminoglycosides, quinipristin/ dalfopristin and ciprofloxacin was the most commonly found pattern in isolates of E. faecalis. The rates of VRE isolates from different wards are given in Table 3. Enterococcal species and VRE were most commonly found in patients from intensive care unit (ICU), followed by those from haematology/oncology ward. There was no significant difference between proportion of enterococcal isolates and VRE found in different hospital wards (p value=0.068 and p value=0.894, respectively). Demographic characteristics of patients with Mira et al. 821 Table 1. Prevalence of enterococcal species isolated from blood. Species E. faecalis E. faecium E. gallinarum E. caseiflavus Total No. (%) of isolates 49 (55.05%) 37 (41.57%) 2 (2.24%) 1 (1.12%) 89 (100%) Table 2. Susceptibility of E. faecium and E. faecium to antibiotics. Antibiotic Ampicillin Gentamycin (hl) Streptomycin (hl) Ciprofloxacin Vancomycin Teicoplanin Linezolid Tigecycline Chloramphenicol Quinopristin/ dalfopristin No. of isolates tested 37 37 E. faecium No. (%) of resistant isolates 36 (97.2) 33 (89.1) No. of isolates tested 49 49 E. faecalis No. (%) of resistant isolates 28 (57.1) 30 (61.2) 35 32 (91.4) 46 29 (63.0) 26 37 37 37 37 32 25 (96.1) 20 (54.05) 19 (53.1) 0 (0) 0 (0) 3 (9.37) 36 49 49 49 46 43 30 (83.3) 0 (0) 0 (0) 0 (0) 0 (0) 16 (37.2) 29 0 (0) 30 30 (100) hl- High-level. Table 3. Distribution of E. faecium, E. faecalis and VRE within hospital ward. Ward Intensive care unit (ICU) Haematology/oncology Internal Other Total No. of E. faecium and E. faecalis 32 20 17 17 86 positive blood cultures and VRE are showed in Table 4. Proportion of E. faecalis and E. faecium isolates in males (62.7%) was higher than in females (32.2%), (p = 0.018). Prevalence of VRE also was higher in males (25.9%) than in females (18.8%), but the difference was not statistically significant (p = 0.619). The number of enterococcal isolates found in patients above 60 years of age was higher than in other age groups (p = 0.004). There was no significant difference in proportion of VRE between different age groups (p = 0.737). DISCUSSION Enterococci are one of the leading causes of nosocomial infections worldwide because of increasing resistance to No. (%) of VRE 8(25) 5(25) 4(23) 3(17) 20 a wide range of antibiotics. Until 1990s, glycopeptides were antibiotics of choice in treating serious infections caused by enterococci, but occurrence of strains resistant to these drugs significantly decreased their efficiency. VRE were first detected in France and United Kingdom in 1986, a year later similar strains were isolated in hospitals in United States and since then VRE have been discovered throughout the world (Uttley, 1988; Murray, 2000; Edmond et al., 1999; Treitman et al., 2005; Goossens, 1998). The main reason for emergence of resistant isolates is widespread use of vancomycin. Broad spectrum antibiotics, such as third-generation cephalosporins and fluoroquinolons, also contributed to the selection of resistant isolates (Sood et al., 2008; Heath et al., 1996). In some European countries the outbreaks of VRE were related to the extensive use of avoparcin, as growth 822 Afr. J. Microbiol. Res. Table 4. Demographic characteristics of patients. Variable Sex Male Female Age group 0-19 20-39 40-59 ≥60 No. (%) of E. fecium and E. faecalis No. (%) of VRE 54 (62.7) 32 (37.2) 14 (25.9) 6 (18.8) 23 (26.7) 11 (12.7) 18 (20.9) 34 (39.5) 0 (0) 3 (27.3) 7 (38.9) 10 (29.4) promoter in farm animals (McDonald et al., 1997; Bates, 1997; Bager et al., 1997). Avoparcin causes bacterial crossresistance to vancomycin and teicoplanin. Resistant enterococcal isolates are reported all over the world, but prevalence of enterococcal species and their resistance vary widely in different geographic regions. In this study, E. faecalis (55.04%) was the most common enterococcal species isolated from blood samples, followed by E. faecium (41.57%). E. faecalis was predominant isolate in studies from India (62.2% by Ajay et al. (2012), 76% by Sreeja et al. (2012) and 82% by Bose et al. (2012), UK (62% by Brown et al. (2008) and 63% by Fisher and Phillips (2009) and Turkey (76% by Shah et al. (2012). Until the early to mid-1990s this species was the most frequent isolated enterococci in US hospitals (Treitman et al., 2005). Since then there has been an important increase in the incidence of E. faecium as a cause of nosocomial infections (Hidron et al., 2008). Prevalence of vancomycin resistant E. faecium (50.05%) in this study was very high, much higher than that reported in most of the other countries. Some European countries (Bulgaria, Cyprus, Estonia, Iceland, Malta, Slovenia and Sweden) reported an absence or very low prevalence (Denmark-1.3%, Norvey-1.8%, Netherland-1% and France-1.4%) of vancomycin resistance (European Centre for Disease Prevention and Control, 2012). Similar results were reported from India (Sreeja et al., 2012) and Turkey (Shah et al., 2012). Among European countries, the highest rates of VRE were obtained from Ireland (34.9%), Greece (23.1%) and Portugal (20.2%). In other parts of the world the highest frequency of vancomycin resistant E. faecium was found in US (60% by Bearman et al (2005), 67% by Forrest (2008), 80% by Arias et al. (2010). Resistance to vancomycin is still very rare in E. faecalis isolates. In this study all E. faecalis were susceptible to vancomycin. Bose et al. (2012), Sunilkumar and Karthika (2012) and Bearman and Wenzel (2005) also reported low prevalence of resistant isolates (0, 1 and 2%, respectively). All E. faecium in this study had VanA phenotype of resistance. This type is widely distributed and predominant type of resistance in Iran (Talebi et al., 2007), Czech Republic (Kolar et al., 2006), Poland (Sadowy et al., 2013), Serbia (Mihajlovic-Ukropina et al., 2011) and other European countries (Werner et al., 2008). Enterococcal infections develop usually in patients with some risk factors, such as severe underlying disease, long hospital stay, particularly in ICU, immune-suppression and haematological malignance. The largest number of vancomycin resistant E. faecium in this study was found in samples of patients from ICU and haematology/oncology ward that is in agreement with results of other authors (Kolar et al., 2006; Brown et al., 2008). In addition to intrinsic resistance to low-level resistance to aminoglycosides, enterococci can acquire resistance to high concentrations of aminoglycosides. Very high percentages of HLAR in E. faecium (~90%) and E. faecalis (~60%) were found in this study, similar to the results reported in India (Sood et al., 2008; Jain et al., 2011), Iran (Talebi et al., 2007) and Turkey (Baldir et al., 2013). HLAR in E. faecalis was reported from all European counties except Iceland. The majority of countries reported frequency of resistant isolates between 25 and 50%. The highest percentages were detected in Italy (50%), Slovakia (49.5%), Hungary (48.6%) and Poland (48.4%). (European Centre for Disease Prevention and Control, 2012). Combinations of aminoglycosides with beta-lactam antibiotics or glycopeptides are the treatment of choice for serious enterococcal infections, such as endocarditis, due to their synergistic activity. Occurrence of resistance to these antibiotics and loss of their synergistic bactericidal activity significantly limited therapeutic options. Newer antibiotics, such as linezolid, tygecyclin, daptomycin and quinopristin/dalfopristin have been suggested as an alternative option for treating infections caused by multidrug resistant enterococci (Aksoy and Unal, 2008; Yemisen et al., 2009, Arias et al., 2010; Tsai et al., 2012). The results obtained in this study confirmed good activity of linezolid and tygecyclin against both enterococcal species tested and quinopristin/dalfopristin against E. faecium only. Unfortunately, their clinical use Mira et al. may be limited by emergence of resistance that is reported in several studies (Werner et al., 2008; Berdal and Eskesen, 2008; Bonora et al., 2006; Kainer et al., 2007). In conclusion, this study shows a very high prevalence of multi drug resistant enterococci isolated from blood samples. These results suggest that regular susceptibility test and species level identification of enterococcal isolates are important in order to treat enterococcal infections effectively and implement appropriate infection control measures to limit the spread in nosocomial settings. REFERENCES Ajay KO, Rajeshwari H, Nagaveni S, Kelmani CR (2012). Antimicrobial susceptibility pattern of Enterococcus species isolated from clinical samples in South India. JRAAS. 27:5-10. Aksoy DY, Unal S (2008). New antimicrobial agents for the treatment of Gram-positive bacterial infections. Clin. Microbial. Infect. 14:411-420. Arias CA, Conreras GA, Murray BE (2010). Management of multidrugresistant enterococcal infections. Clin. Microbiol. Infect. 16(6):555562. Arthur M, Courvalin P (1993). Genetics and mechanisms of glycopeptides resistance in enteroocci. Antimicrob. Agents Chemother. 37:1563-1571. Bager F, Madsen M, Christensen J, Aarestrup FM (1997). Avoparcin used as a growth promoter is associated with the occurrence of vancomycin-resistant Enterococcus faecium in Danish poultry and pig farms. Prev. Vet. Med. 31:95-112. Baldir G, Engin DO, Kucukercan M, Inan A, Akcay S, Ozyuker S, Asaray S (2013). High-level resistance to aminoglycoside, vancomycin and linezolid in enterococci strains. J. Microbiol. Infect. Dis. 3(3):100-103. Bates J (1997). Epidemiology of vancomycin-resistant enteroccoci in the community and the relevance of farm animals to human jnfection. J. Hosp. Infect. 37:89-101. Bearman GML, Wenzel RP (2005). Bacteriemias: a leading cause of death. Arch. Med. Res. 36(6):646-659. Berdal JE, Eskesen A (2008). Short-term success, but long-term treatment failure with linezolid for enterococcal endocarditis. Scand. J. Infect. Dis. 40:765-766. Bereket W, Hemalatha K, Getener B, Wondwossen T, Solomon A, Zeynudin A, Kannan S (2012). Update on bacterial nosocomial infections. Eur. Rev. Med. Pharmacol. Sci. 16(8):1039-1044. Bonora MG, Solbiati M, Stepan E, Zorzi A, Luzzani A, Catania MR, Fontana R (2006). Emergence of linezolid resistance in the vancomycin-resistant Enterococcus faecium multilocus sequence typing C1 epidemic lineage. J. Clin. Microbiol. 44(3):1153-1155. Bose S, Ghosh AK, Barapatre R (2012). Prevalence of drug resistance among Enterococcus spp from a tertiary care hospital. Int. J. Med. Health. Sci. 1(3):38-44. Brown DFJ, Hope R, Livermore DM, Brick G, Broughton K, George RC, Reynolds R (2008). Non-susceptibility trends among enterococcci and non-pneumococcal streptococci from bacteraemias in UK and Ireland, 2001-06. J. Antimicrob. Chemother. 62(2):ii75-ii85. Chou Y, Lin T, Lin J, Wang N, Peng M, Chang F (2008). Vancomycinresistant enterococcal bacteremia: comparison of clinical features and outcome between Enterococcus faecium and Enterococcus faecalis. J. Immunol. Infect. 41(2):124-129. Edmond MB, Wallace SE, McClish DK, Pfaller MA, Jones RN, Wenzel RP (1999). Nosocomial bloodstream infections in United States hospitals: A three-year analysis. Clin. Infect. Dis. 29(2):239-244. European Centre for Disease Prevention and Control (2012). Antimicrobial resistance surveillance in Europe 2011. Annual Report of the European Antimicrobial Resistance Network (EARS-Net). Stockholm; ECDC:59-63. Fines M, Perichon B, Reynolds P, Sahm DF, Courvalin P (1999). Van E, 823 a new type of acquired glycopeptides resistance in Enterococcus faecalis. BM4405. Antimicrob. Agents Chemother. 42(9):2161-2164. Fisher K, Phillips C (2009). The ecology, epidemiology and virulence of Enterococcus. Microbiology 155(6):1749-1757. Forrest (2008). Enterococcal Bacteremia. Antimicrob. Agents. Chemother. 52(10):3558-2563. Goossens H (1998). Spread of vancomycin-resistant enterococci: Differences between the United States and Europe. Infect. Control. Hosp. Epidemiol. 19(8):546-551. Heath CH, Blackmore TK, Gordon DL (1996). Emerging resistance in Enterococcus spp. Med. J. Aust. 164(2):116-120. Hidron AL, Edwards JR, Patel J, Horan TC, Sievert DM, Pollock DA, Fridkin SK (2008). NHSN annual update: antimicrobial-resistant pathogens associated with healthcare-associated infections: annual summary of data reported to the National Healthcare Safety Network at the Centre for Disease Control and Prevention, 2006-2007. Infect. Control Hosp. Epidemiol. 20(11):996-1011. Jain S, Kumar A, Kashyap B, Kaur JR (2011). Clinico-epidemiological profile and high-level aminoglycoside resistance in enterococcal septicemia fro tertiary care hospital in Delhi. Int. J. App. Basic. Med. Res.1:80-83. Kainer MA, Devasia RA, Jones TF, Simmons BP, Melton K, Chow S, Broyler J, Moore KL, Craig AS, Schaffners W (2007). Response to emerging infection leading to outbreak of linezolid-resistant enterococci. Emerg. Infect. Dis. J. 13(7):1024-1030. Kolar M, Pantucek R, Vagnerova I, Sauer P, Kesselova M, Cekanova L, Koukalova D, Doskar J, Ruzickova V (2006). Prevalence of vancomycin-resistant enterococci in hospitalized patients and those living in the community in the Czeech Republic, New Microbiologica 29:121-125. Lebreton F, Depardieu F, Bourdon N, Fines-Guyon M, Berger P, Camiade S (2011). VanN-type transferable vancomycin resistance in Enterococcus faecium. Antimicrob. Agents Chemother. 55:46064612. Leclercq R (1997). Enterococci acquire new kinds of resistance. Clin. Infect. Dis. 24(1):s80-84. Low DE, Keller N, Barth A, Jones RN (2001). Clinical prevalence, antimicrobial susceptibility,and geographic resistance patterns of enterococci: Results from the SENTRY Antimicrobial Surveillence program, 1997-1999. Clin. Infect. Dis. 32:S133-145. McDonald LC, Kuehnert MJ, Tenover FC, Jarvis WR (1977). Vancomycin- resistant enteroccoci outside the health-care setting:prevalence,source and public health implications.Emerg.Infect.Dis.3:311-317. Mihajlovic-Ukropina M, Medic D, Jelesic Z, Gusman V, Milosavljevic B (2011). Frequency of vancomycin-resistant enterococci isolated from blood cultures from 2008 to 2010, Med. Preg. 64(9-10):481-485, Moellering RC Jr. (1992). Emergence of Enterococcus as a significant pathogen. Clin. Infect. Dis. 14(6):1173-1176. Murray BE (1990). The life and times of enterococcus. Clin. Microbiol. Rev. 3:45-65. Murray BE (2000). Vancomycin-resistant enterococcal infections. N. Engl. J. Med. 10:710-721. Perichon B, Reynolds P, Courvalin (1997). VanD-type glycopeptides resistant Enterococcus faecium BM4339. Antimicrob. Agents Chemother 41(9):2016-2018. Sadowy E, Sienko A, Gawryszewska J, Bojarska A, Malinowska K, Hryniewicz W (2013). High abundance and diversity of antimicrobial resistance determinants among early vancomycin-resistant Enterococcus faecalis in Poland.Eur.J. Clin. Microbiol. Infect. Dis. 32(9):1193-1203. Schaberg DR, Culver DH, Gaynes RP (1991). Major trends in the microbial etiology of nosocomial infection. Am. J. Med. 91(3B):72S75S. Shah L, Mulla S, Patel KG, Rewadiwala S (2012). Prevalence of enterococci with higher resistance level in a tertiary care hospital: a matter of concern. Natl. J. Med. Res. 291:25-27. Sievert DM, Ricks P, Edwards JR, Schneider A, Patel J, Srinivasen A, Kallen A, Limbago B, Fridkun S (2013). Antimicrobial-resistant pathogens associated with healthcare-associated infections: Summary of data reported to the National Healthcare Safety Network at the Centres for Disease Control and Prevention, 2009-2010, Infect. 824 Afr. J. Microbiol. Res. Control Hosp. Epidemiol. 34(1):1-14. Sood S, Malhotra M, Das BK, Kapil A (2008). Enterococcal infection and antimicrobial resistance. Indian J. Med. Res.128:111-121. Sreeja S, Babu PRS, Prathab AG (2012). The prevalence and the characterization of the enterococcus species from various clinical samples in the tertiary care hospital. J. Clin. Diagn. Res. 6(9):14861488. Sunilkumar J, Karthika J (2012). Prevalence of Enteroccocus species from various clinical specimens in Shri Sathya Sai Medical College and Research Institute with special reference to speciation and their resistance to vancomycin.Int. J. Med. Clin. Res. 3:154-160. Talebi M, Eshraghi SS, Pourshafle MR, Pourmand MR, Eshraghian MR (2007). Characterization of vancomycin resistant Enterococcus faecium. Iranian. J. Publ. Health 36(4):20-25. Teixeira LM, Facklan RR (2003). Enterococcus In: Murray PR, Baron EJ, Jorgensen JH,Pealler MA, Yolken RH (2003). Mannual of clinical th microbiology.8 ed. Washington. AMS Press ДЌ423-433. Treitman AN, Yarnold PR, Warren J, Noskin G (2005). Emerging incidence of Enterococcus faecium among hospital isolates 19932002. J. Clin. Microbiol. 43:462-463. Tsai HY, Liao CH, Chen YH, Lu PL, Huang CH, Lu CT, Chuang YC, Tsao SM, Chen YS, Lui YC, Chen WY, Jang TN, Lin HC, Chen CM, Shi ZY, Pan SC, Yang JL, Kung CE, Liu CE, Cheng YJ, Liu JW, Sun W, Wang LS, Ko WC, Yu KW, Chiang PC, Lee MH, Lee CM, Hsu GJ, Hsueh PR (2012). Trends in susceptibility of vancomycin-resistant Enterococcus faecium to tigecyclin, daptomycin and linezolid and molecular epidemiology of the isolates: results from the tigecyclin in vitro surveillance in Taiwan study, 2006 to 2010. Antimicrob. Agents Chemother. 56(6):3402-3405. Uttley AH, Collins CH, Naidoo J, George R (1988). Vancomycin resistant enteroccoci. Lancet.1:57-58. Werner G, Coque TM, Hammerum AM, Hope R, Hryniewicz W, Johnson A, Klare I, Kristinsson KG (2008). Emergence and spread of vancomycin resistance among enterococci in Europe. Eurosurvailance,13:8-18. Werner G, Gfrorer S, Fleige C, Witte W, Klare I (2008). Tigecyclinresistant Enreococcus faecium strain isolated from a German intensive care unit patient. J. Antimicrob. Chemother. 61(5):11821183. Xu X, Lin D, Yan G, Ye X, Wu S, Guo Y, Zhu D, Hu F Zhang Y, Wang M (2010). VanM, a new glyopeptide resistance gene cluster found in Enterococcus faecium. Antimicrob. Agents Chemother. 54:46434647. Yemisen M, Demirel A, Mete B, Kaygusuz A, Mert A, Tabak F, Ozturk R (2009). Comparative in vitro antimicrobial activity of tigecyclin against clinical isolates of vancomycin-resistant enterooccus. Indian. J. Med. Microbiol. 27:373-374. Vol. 8(8), pp. 825-829, 19 February, 2014 DOI: 10.5897/AJMR2013.6128 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research paper Prevalence of anti-Anaplasma phagocytophilum antibodies among dogs from Monterrey, Mexico J. A. Salinas-MelГ©ndez, R. Villavicencio-Pedraza, B. V. Tamez-HernГЎndez, J. J. HernГЎndezEscareГ±o, R. Avalos-RamГrez, J. J. Zarate-Ramos, F. J. PicГіn-Rubio and V. M. Riojas-ValdГ©s* Universidad AutГіnoma de Nuevo LeГіn, UANL. Facultad de Medicina Veterinaria y Zootecnia. Av. Universidad S/N, Ciudad Universitaria, San NicolГЎs de los Garza, Nuevo LeГіn, CP 66451, MГ©xico. Accepted 23 January, 2014 Infection with Anaplasma phagocytophilum is of importance in dogs. It is called canine anaplasmosmosis and causes persistent clinical signs for long periods of time. Its main vector is a tick of the genus Ixodes. Diagnosis of anaplasmosis can be achieved either by serological or molecular methods. Presence of the disease has been reported in the U.S.A., Europe and Asia, but little is known about its prevalence in Mexico. In the present study, the enzyme-linked immunosorbent assay (ELISA) diagnostic method was used to determine the prevalence of antibodies against A. phagocytophilum at the city of Monterrey, Mexico. A total of 391 dogs were tested using a commercial kit. A 3% prevalence was found that included dogs of the breeds Doberman, French Puddle and Maltese, as well as mixed breed. Key words: Anaplasma phagocytophilum, dogs, Mexico. INTRODUCTION Anaplasma phagocytophilum produces infection in some animal species including man. It has been informed that this disease can cause fever, anorexia, pain, neutropenia, thrombocytopenia, as well as the formation of cytoplasmatic inclusion bodies in granulocytic neutrophiles (Rikihisa, 1991; Greig et al., 1996; Engvall et al., 1997; Engvall and Engvall, 2002). The genus Anaplasma was previously known as the Ehrlichia phagocytophila group (Dumler et al., 2001). Infection with A. phagocytophilum was first reported in canines at Minnesota and Wisconsin states in 1996 (Greig et al., 1996). It is a zoonotic disease transmitted by vectors and apparently its presence in dogs is related to its presence in humans (Bakken et al., 1994). Confirmed clinical cases by A. phagocytophilum in humans have been informed in the U.S.A. (Chen et al., 1994; Demma et al., 2005), as well as in Europe (Petrovec et al., 1997; ArneЕѕ et al., 2001; Walder et al., 2003). Studies in dogs have shown seroprevalence ranging from 17 to 50% at European countries (Barutzki et al., 2006; Liebisch et al., 2006; Jensen et al., 2007; Krupka et al., 2007; Schaarschmidt-Kiener and Miller, 2007). The clinical disease in dogs is often associated to the acute infection. Development of clinical signs during the acute phase can vary, lasting from one to several days (Engvall et al. 1998). Persistent infection, either clinical or subclinical, in dogs experimentally inoculated with A. phagocytophilum has been documented for time lapses of more than six months (Engvall et al., 2000; Alleman et al., 2006). This pathogen has been reported in 8 years old dogs or older, and is more common in certain breeds (Greig et al,. 1996; Engvall et al., 1997; Beall et al., 2008). *Corresponding author. E-mail: [email protected]. Tel.: 83294000, Ext. 3610. 826 Afr. J. Microbiol. Res. Clinical signs more often found in dogs infected with A. phagocytophilum are articular pain and lameness resulting from poli-artritis; other less often observed signs can be gastrointestinal such as vomit and diarrhea, and some respiratory clinical signs like coughing and disnea. In some cases the central nervous system can be affected causing meningitis, leading to neurologic manifestations like ataxia and convulsions. Infection with A. phagocytophilum is often unapparent, but after eight to 15 days incubation period it can cause fever, generalized adenopathy, leucopenia, moderate anemia, moderate hypogammaglobulinemia, hypoalbuminemia, hypocalcaemia and specially thrombocytopenia (Engvall et al. 1998; Engvall et al., 2000; Alleman et al., 2006). The main vector for A. phagocytophilum in Europe is Ixodes ricinus (Parola and Raoult, 2001, Strle, 2004). In the U.S.A. it is associated to Ixodes scapularis and Ixodes pacificus (Barlough et al., 1997a; Chang et al., 1998). Other authors indicate that the main vector is I. scapularis in the east coast and I. pacificus in the west coast (Parola et al., 2005). There are also reports about its detection in Ixodes spinipalis and Ixodes dentatus in the U.S.A. (Zeidner et al., 2000; Goethert and Telfort, 2003). Studies in the Asian countries mention the presence of A. phagocytophilum in Ixodes perseculatus and Ixodes ovatus (Cao et al., 2000; Ohashi et al., 2005). In NorthAmerica it has been observed that certain rodents in particular and White-tail deer can act as natural hosts of A. phagocytophilum (Bunnell et al., 1998; Belongia et al., 1997). Other wild animals detected as positive for the disease include foxes, wild hogs (Petrovec et al., 2003), bison, donkey, moose, hare and lynx (Grzeszczuk et al., 2004, de la Fuente et al., 2005, Jenkins et al., 2001). Canine anaplasmosis is often diagnosed directly by microscopic identification of A. phagocytophilum morulae in circulating neutrophyles an in some cases in synovial fluid. These findings can be seen at the acute phase of the disease. Using serological tests as a diagnostic tool, the early phases of the disease and the dogs at terminal phase can show negative results; in the former because there has not been enough time for the immune response and in the latter because it is exhausted (Weisiger et al., 1975; Waner et al., 2001; Cohn, 2003). In the blood serum antibodies can be detected around 7-28 days after infection (Ristic et al., 1972; Buhles et al., 1974); at 20 days almost all dogs are seropositive, reaching maximum values of antibodies titers at 80 days (Buhles et al., 1974; Maeda et al., 1987). Antibody detection is the most utilized way to identify the disease, including immunofluoresence and ELISA techniques. However, some reports exist about false-positive results due to crossreactions with Ricketsias such as Ehrlichia chafensis (Blanco and Oteo, 2002). Polymerase chain reaction is a fast and sensitive tool for A. phagocytophilum detection and identification from blood and skin samples, as well as from ticks. 16 SrRNA gen has been used as reference for studies on the phylogenetic classification of the bacteria (Blanco and Oteo, 2002). MATERIALS AND METHODS Blood samples were obtained from 391 dogs of different breeds in the city of Monterrey, using as inclusion factor only dogs with fixed address, age over 6 months. It was decided to sample only one dog per house in case of having more than one dog. The examination of the dogs started with physical evaluation followed by blood sampling. All dogs showed no clinical signs of any disease. This study was carried out in the city of Monterrey, Nuevo Leon, located in the northeast of Mexico, with a territorial extension of 451.30 km2. Location coordinates are 25В°40Вґ17ВґВґ N, 100В° 18Вґ31ВґВґ W. Altitude is 530 m above sea level. The climate of the region has an average of 21В°C, but because of annual thermal oscillation of 18В°C, with important contrast among seasons. In summertime temperatures above 30В°C are common with an average in July and august of 34В°C. In winter, cold air arrive constantly to the region, often accompanied of humidity from the coast, making the temperature descend drastically, and every year at least 2 to 3 days are recorded with 0В°C or less. The average annual precipitation is of 600 m spread mainly in summer, with September as the rainiest month. The city was divided in quadrants in accordance with its cartographic plan. From this map, the 15 most urbanized quadrants were chosen, since the others belonged to not well developed neighborhoods and little human population. Sampling was performed according the dog population density and owner cooperation, sampling only one dog per city block and only one dog in each house. To determine the sample size, calculations were made in basis of the population’s representative sample (infinite), with precision level of 5%, confidence level of 95% and a power of statistical test of 80% in order to ensure reliability of the results and that they could be translated to the population under study using a 16% prevalence, according to previous studies in the country. Sample size was determined using Epidat 3.1. Blood was extracted from the jugular vein with Vacutainer vacuum tubes and sterile needles, drawing close to 5 m from each animal. No anesthetic or tranquilizer was used. The samples were carried in a container with refrigerant material to the laboratory and kept al 4o C until they were centrifugated at 3000 rpm for 5 min to separate the serum, after which were processed to determine the presence of antibodies against Anaplasma phagocytophilum. For the in vitro detection of the mentioned antibodies in the samples, the commercial kit “canine SNAP*4Dx” (IDEXX labs, Inc. USA) was used, according to the manufacture’s instructions. Before starting the procedure samples must be at room temperature. The sera, either fresh or refrigerated, were utilized after no more than a week from the sampling. Sensibility and specificity of the kit for the disease are reported with a minimum of 98.8 and 100%, respectively. RESULTS For the present work, 391 blood samples were taken from dogs located in the city of Monterrey, Mexico; antibodies against Anaplasma phagocytophilum were found in 12 samples, resulting in 3% prevalence. Regarding to sex, dogs’ samples comprised 173 males Salinas-MelГ©ndez et al. 827 Table 1. Seropositive dogs to Anaplasma phagocytophilum. Breed Sex Place of stay Parasite treatment Vaccination Presence of ticks Yes Yes No Both Outside Kind of floor 2 grass 1 soil Cement Cement Doberman 3 Females Outside French Poodle Maltese 2 Males 2 Females No Yes Yes Yes No No Mixed-breed 3 Males 2 Females 5 outside 1 inside 4 cement 1 mixed* 5 Yes 1 No 5 Yes 1 No 3 Yes 3 No *Mixed: cement and soil. and 218 females of which five males and seven females were positive, giving a prevalence of 3.4% and 3.2% respectively (Table 1). Positive dogs varied in age from 21 to 132 months old. Only 3 positive dogs presented ticks (2 females and 1 male); however, the questionnaire applied to the dog’s owners revealed that 11 dogs of the 13 that resulted positive had ticks within a period of two months before the sampling. Additionally, only three owners mentioned the use of anti-tick baths and treatment against internal parasites in a constant way every 3 months. Only one among the 13 positive dogs had record of anti-rabies vaccination (Table 1). Regarding the place of stay, 12 of the positive dogs were kept outside of the owner home and only one lived in the house all the time. Among the positive dogs, 8 lived on cement floor, 2 on grass, 2 in both and one on soil. With regard to breed, 6 were mixed-breed, 3 dogs were Doberman, 2 French Poodle and 2 Maltese (Table 1). DISCUSION Anaplasmosis is a disease that must be considered for differential diagnosis in dogs because due to its diverse clinical manifestations, it can be confused with other common diseases of dogs. Currently there are not data on the prevalence of this disease in the area studied, as well as in many states of the country. In the present study, a prevalence of 3% was found, whereas a work done at Switzerland reported 7.5% prevalence (Pusterla et al., 1998). The disease has been reported in the following domesticated species: horse (BjГ¶ersdorff et al., 2002; Engvall et al., 1996, Engvall and Engvall, 2002), dog (Engvall et al., 1996; Engvall and Engvall, 2002; Skotarczak, 2003; Lester et al., 2005, Poitout et al., 2005), cat (BjГ¶ersdorff et al., 1999), cattle (Engvall et al., 1996), sheep (Steere et al., 1998) and lama (Barlough et al., 1997b). At some European countries, prevalence in dogs varying from 17 to 50% have been found (Barutzki et al., 2006; Liebisch et al., 2006; Jensen et al., 2007; Krupka et al., 2007; Schaarschmidt-Kiener and Miller, 2007), which represents a higher value than the one informed in the present work. The clinical disease has often been reported in 8 year old and older dogs and with some breeds such as Labrador and Golden Retriever among the most affected; these findings are in agreement with the results presented in this study, since positive dogs having 11 years of age were found (Greig et al., 1996; Engvall et al., 1997; Beall et al., 2008). Recent studies report higher frequencies of A. phagocytophilum in dogs, from 14% in Poland (Ryamasewka et al., 2011) to 46.9% in Germany (Kohn et al., 2010). However, in other countries the results are closer that the ones reported in the present work, since absence of the bacteria was informed at Canada (Bryan et al., 2011) and Korea (Lim et al., 2010). Little work on this disease has been realized in Mexico because of its relatively new presence; therefore, information in our geographical area is scarce. This is not the case of European countries, where many cases have been documented and much more knowledge exists about this disease of dogs. On the other hand, other members of the same Rickettsia family such as Ehrlichia canis, which causes monocytic canine ehrlichiosis, have been documented in the metropolitan area of Monterrey by serological methods like ELISA; this study reported a general seropositivity of 44%, which is much higher than the one informed here for A. phagocytophilum. The results were also in disagreement according to age, since E. canis was found more often in four year old dogs, whereas for A. phagocytophilum was e years old. One possible reason for these discordances could be that in the present work only dogs living in the urban area were sampled, whereas it can be assume that a bigger number of ticks will be present in the country side, outside the city. Conclusion The results observed in the present study allows the 828 Afr. J. Microbiol. Res. conclusion that A. phagocytophilum is being transmitted amongst the canine population at Monterrey county through ticks, although at a frequency lower than the one informed for other countries or other infectious agents of the same family. New studies will be necessary to confirm the presence of the bacteria in the ticks, as well as to determine its presence in humans. ACKNOWLEDGEMENT We will like to thank MHICO de Mexico, S.A. de C.V., Monterrey, Nuevo Leon, for support with laboratory supplies REFERENCES Alleman AR, Chandrashekar R, Beall M (2006). Experimental inoculation of dogs with a human isolate (Ny18) of Anaplasma phagocytophilum and demonstration of persistent infection following doxycycline therapy. J. Vet. Int. Med. 20:763. ArneЕѕ M, Petrovec M, Lotric-Furlan S, Avsic Zupanc T, Strle F (2001). First European Pediatric Case of Human Granulocytic Ehrlichiosis. J. Clin. Microbiol. 39:4591-4592. Bakken JS, Dumler JS, Chen SM (1994). Human granulocytic ehrlichiosis in the upper Midwest United States. A new species emerging? J.A.M.A. 272:212-218. Barlough JE, Madigan JE, Kramer VL, Clover JR (1997a). Ehrlichia phagocytophila genogroup rickettsiae in Ixodid ticks from California collected in 1995 and 1996. J. Clin. Microbiol. 35:2018-2021. Barlough JE, Madigan JE, Turoff DR, Clover JR (1997b). An Ehrlichia strain from a llama (Lama glama) and Llama-associated ticks (Ixodes pacificus). J. Clin. Microbiol. 35:1005-1007. Barutzki D, De Nicola A, Zeziola M, Reule M (2006). SeroprГ¤valenz der Anaplasma phagocytophilum-Infektion bei Hunden in Deutschland. Berl. MГјnch. TierГ¤rztl. Wochenschr. 119:342-347. Beall MJ, Chandrashekar R, Eberts MD, Cyr KE, Diniz PP, Mainville C, Hegarty BC, Crawford JM, Breitschwerdt EB (2008). Serological and molecular prevalence of Borrelia burgdorferi, Anaplasma phagocytophilum, and Ehrlichia species in dogs from Minnesota. Vector Borne Zoonotic. Dis. 8(4):455-464. Belongia EA, Reed KD, Mitchell PD, Kolbert CP (1997). Prevalence of granulocytic Ehrlichia infection among white-tailed deer in Wisconsin. J Clin Microbiol. 35:1465-1468. BjГ¶ersdorff A, Bagert B, Massung RF (2002). Isolation and characterization of two European strains of Ehrlichia phagocytophila of equine origin. Clin. Diagn. Lab. Immunol. 9:341-343. BjГ¶ersdorff A, Svendenius L, Owens JH, Massung RF (1999). Feline granulocytic ehrlichiosis- a report of a new clinical entity and characterization of the infectious agent. J. Small. Anim. Pract. 40:2024. Blanco JR, Oteo JA (2002). Human granulocytic ehrlichiosis in Europe. Clin. Microbiol. Infect. 8:763-772. Bryan HM, Darimont CT, Paquet PC, Ellis JA, Goji N, Gouix M, Smiths JC (2011). Exposure to infectious agents in dogs in remote coastal British Columbia: Possible sentinels of disease in wildlife and humans. Can. J. Vet. Res. 75:11-17. Buhles WC Jr., Huxsoll DL, Ristic M (1974). Tropical canine pancytopenia: clinical, hematologic, and serologic responses of dogs to Ehrlichia canis infection, tetracycline therapy, and challenge inoculation. J. Infect. Dis. 130:357-367. Bunnell JE, Dumler JS, Childs JE, Glass GE (1998). Retrospective serosurvey for human granulocytic ehrlichiosis agent in urban whitefooted mice from Maryland. J. Wildl. Dis. 34:179-181. Cao WC, Zhoa QM, Zhang PH, Dumler JS, Zhang XT, Fang L, Yang H (2000). Granulocytic Ehrlichiae in Ixodes persulcatus Ticks from an Area in China Where Lyme Disease is Endemic. J. Clin. Microbiol. 38:4208-4210. Chang YF, Novosel V, Chang CF, Kim JB (1998). Detection of human granulocytic ehrlichiosis agent and Borrelia burgdorferi in ticks by polymerase chain reaction. J. Vet. Diagn. Invest. 10:56-59. Chen SM, Dumler JS, Bakken JS, Walker DH (1994). Identification of a granulocytotropic Ehrlichia species as the etiologic agent of humen disease. J. Clin. Microbiol. 33:589-595. Cohn LA (2003). Ehrlichiosis and related infections. Vet. Clin. North. Am. Small Anim. Pract. 33:863-884 De La Fuente J, Torina A, Caracappa S, Tumino G (2005). Serologic and molecular characterization of Anaplasma species infection in farm animals and ticks from Sicily. Vet. Parasitol. 5:357-362. Demma L J, Holman R C, McQuiston J H, Krebs J W, Swerdlow D L (2005). Epidemiology of human Ehrlichiosis and anaplasmosis in the United States, 2001- 2002. Am. J. Trop. Med. Hyg. 73:400-409. Dumler J S, Barbet AF, Bekker CPJ, Dasch GA, Palmer GH, Ray SC, Rikihisa Y, Rurangirwa FR (2001). Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51:2145-2165. Engvall A, BjГ¶ersdorff A, Lilliehöök I (1998). Early manifestations of granulocytic ehrlichiosis in dogs inoculated experimentally with a Swedish Ehrlichia species isolate. Vet. Rec. 143:412-417. Engvall A, Lilliehöök I, BjГ¶ersdorff A (2000). Detection of granulocytic Ehrlichia species DNA by PCR in persistently infected dogs. Vet. Rec. 146:186-190. Engvall AE, Hedhammar AA, BjГ¶ersdorff AI (1997). Clinical features and serology of 14 dogs affected by granulocytic ehrlichiosis in Sweden. Vet. Rec. 140:222-226. Engvall EO, Engvall A (2002). Granulocytic ehrlichiosis in Swedish dogs and horses. Int. J. Med. Microbiol. 291:100-103. Engvall EO, Pettersson B, Persson M, Artursson K, Johansson KE (1996). A 16S rRNA-based PCR assay for detection and identification of granulocytic Ehrlichia species in dogs, horses, and cattle. J. Clin. Microbiol. 34(9):2170-2174. Goethert HK and Telford SR (2003). Enzootic transmission of the agent of human granulocytic ehrlichiosis among cottontail rabbits. Am. J. Trop. Med. Hyg. 68:633-637. Greig B, Asanovich KM, Armstrong PJ, Dumler JS (1996). Geographic, clinical, serologic, and molecular evidence of granulocytic ehrlichiosis, a likely zoonotic disease, in Minnesota and Wisconsin dogs. J. Clin. Microbiol. 34:44-48. Grzeszczuk A, Ziarko S, Prokopowicz D, Radziwon PM (2004). Evidence of Anaplasma phagocytophilum infection in European Bisons in the Bialowieza Primeral Forest, Poland. Med. Weter 60:600-601. Jenkins A, Handeland K, Stuen S, Schouls L (2001). Ehrlichiosis in a moose calf in Norway. J. Wildl. Dis. 37:201-203. Jensen J, Simon D, Escobar H, Soller J T, Bullerdieck J, Beelitz P, Pfister K, Nolte I (2007). Anaplasma phagocytophilum in dogs in Germany. Zoonoses Public Health 54:94-101. Kohn B, Silaghi C, Galke D, Arndt G, Pfister I (2010). Infection with A. phagocytophilum in dogs in Germany. Res. Vet. Sci. 91:71-76. Krupka I, Pantchev N, Lorentzen L, Weise M, Straubinger RK (2007). Durch Zecken Гјbertragene bakterielle Infektionen bei Hunden: SeroprГ¤valenzen von Anaplasma phagocytophilum, Borrelia burgdorferi sensu lato und Ehrlichia canis in Deutschland. Der praktische Tierarzt. 88:776-788. Lester SJ, Breitschwerdt EB, Collis CD, Hegarty BC (2005). Anaplasma phagocytophilum infection (granulocytic anaplasmosis) in a dog from Vancouver Island. Can. Vet. J. 46:825-827. Liebisch G, Thiet W, Liebisch A (2006). Die canine monocytГ¤re (CME) und die canine granulocytГ¤re Ehrlichiose (CGE), zwei durch Zecken Гјbertragene Infektionskrankheiten bei Hunden in Deutschland. Der praktische Tierarzt. 87:342-353. Salinas-MelГ©ndez et al. Lim S, Irwin PJ, Lee S, Oh M, Ahn K, Myung B, Shin S (2010). Comparison of selected canine vector-borne disease between urban animal shelter and rural hunting dogs in Korea. Parasit. Vectors 3:32. Maeda K, Markowitz N, Hawley RC, Ristic M, Cox D, McDade JE (1987). Human infection with Ehrlichia canis a leukocytic rickettsia. N. Engl. J. Med. 316:853-856. Ohashi N, Inayoshi M, Kitamura K, Kawamori F, Kawaguchi D, Nishimura Y, Naitou H, Hiroi M, Masuzawa T (2005). Anaplasma phagocytophilum-infected ticks, Japan. Emerg. Inf. Dis. 11:1780-1783. Parola P, Davoust B, Raoult D (2005). Tick- and flea-borne rickettsial emerging zoonoses. Vet. Res. 36:469-492. Parola P, Raoult D (2001). Tick-borne bacterial diseases emerging in Europe. Clin. Microbiol. Infect. 7: 80-83. Petrovec M, Lotric-Furlan S, Avsic-Zupank T, Strle F, Brouqui P, Roux V, Dumler S (1997). Human Disease in Europe caused by a Granulocytic Ehrlichia Species. J. Clin. Microbiol. 35:1556-1559. Petrovec M, Sixl W, Schweiger R, Mikulasek S (2003). Infections of wild animals with Anaplasma phagocytophila in Austria and the Czech Republic. Ann. N. Y. Acad. Sci. 990:103-106. Poitout FM, Shinozaki JK, Stockwell PJ, Holland CJ (2005). Genetic variants of Anaplasma phagocytophilum infecting dogs in Western Washington State. J. Clin. Microbiol. 43:796-801. Pusterla N, Berger J, Pusterla, Deplazes P, Wolfensberger C, MГјller W, HГ¶rauf A, Reusch C, and Lutz H (1998). Seroprevalence of Ehrlichia canis and of canine granulocytic Ehrlichia infection in dogs in Switzerland. J. Clin. Microbiol. 36:3460 3462. Rikihisa Y (1991). The tribe Ehrlichieae and ehrlichial diseases. Clin. Microbiol. Rev. 4:286-308. Ristic M, Huxsoll DL, Weedier RM, Hildebrandt PK, Nyindo, MB (1972). Serological diagnosis of tropical canine pancytopenia by indirect immunofluorescence. Infect. Immun. 6:226-231. Ryamasewka A, Adamska M (2011). Molecular evidence of vectorborne pathogens coinfecting dogs from Poland. Acta Vet. Hung. 59: 215-229. Schaarschmidt-Kiener D, Miller W (2007). Labordiagnostische und klinische Aspekteder kaninen Anaplasmose. TierГ¤rztl. Prax. 35:129136. Skotarczak B (2003). Canine ehrlichiosis. Ann. Agric. Environ. Med. 100:137-141. 829 Steere AC, Sikand VK, Meurice F, Parenti DL, Fikrig E, Schoen RT, Nowakowski J, Schmid CH, Laukamp S, Buscarino C, Krause DS (1998). Vaccination against Lyme disease with recombinant Borrelia burgdorferi outer-surface lipoprotein A with adjuvant. New Engl. J. Med. 339: 209-215 Strle F (2004). Human granulocytic ehrlichiosis in Europe. Int. J. Med. Microbiol. 293 (Suppl. 37):27-35. Walder G, Tiwald G, Dierich M P, WГјrzner R (2003). Serological Evidence for Human Granulocytic Ehrlichiosis in Western Austria. Eur. J. Clin. Microbiol. Infect. Dis. 22:543-547. Waner T, Harrus S, Jongejan F, Bark H, Keysary A, Cornelissen AW (2001). Significance of serological testing for ehrlichial diseases in dogs with special emphasis on the diagnosis of canine monocytic ehrlichiosis caused by Ehrlichia canis. Vet. Parasitol. 95:1-15. Weisiger RM, Ristic M, Huxsoll DL (1975). Kinetics of antibody response to Ehrlichia canis assayed by indirect fluorescent antibody method. Am. J. Vet. Res. 36:689-694. Zeidner NS, Burkot TR, Massung R, Nicholson WL, Dolan MC, Rutherford JS, Biggerstaff BJ, Maupin GO (2000). Transmission of the agent of human granulocytic ehrlichiosis by Ixodes spinipalpis ticks: evidence of an enzootic cycle of dual infection with Borrelia burgdorferi in Northern Colorado. J. Infect. Dis. 182:616-619. Vol. 8(8), pp. 830-838, 19 February, 2014 DOI: 10.5897/AJMR2013.6537 ISSN 1996-0808 В©2014 Academic Journals http://www.academicjournals.org/AJMR African Journal of Microbiology Research Full Length Research Paper Novel simple diagnostic methods compared to advanced ones for the diganosis of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasmas hominis in patients with complicated urinary tract infections Hala Badawi1*, Aisha Abu Aitta1, Maisa Omar1, Ahmed Ismail2, Hanem Mohamed3, Manal El Said1, Doaa Gamal1, Samah Saad El Dine1 and Mohamed Ali Saber3 1 Microbiology Department, Theodor Bilharz Research Institute, Giza, Egypt. Urosurgery Department, Theodor Bilharz Research Institute, Giza, Egypt. 3 Biochemistry Department, Theodor Bilharz Research Institute, Giza, Egypt. 2 Accepted 23 January, 2014 Chlamydia trachomatis is responsible for the most common sexually transmitted bacterial infection worldwide. Infections with Ureaplasma urealyticum and genital Mycoplasma hominis have been recognized for about a decade as common sexually transmitted infections (STIs) in developed countries. The aim of this study was to assess the diagnostic value of novel simple diagnostic kits used in the detection of C. trachomatis, U. urealyticum and M. hominis in urine of patients with complicated urinary tract infections (UTIs) and to compare these simple methods to molecular and cultural ones as gold standards. This study was conducted on two male patient’s groups; group I: 30 patients with compilcated UTIs and Group II: 50 patients with non complicated UTIs. Twenty (20) healthy male control subjects (Group III) were also included. The patients were chosen from those admitted to the urosurgery department or attending the urosurgery outpatient clinic in Theodor Bilharz Research Institute (TBRI). First voided urine (FVU) samples and mid-stream urine (MSU) were collected from patients and controls. FVU samples were investigated for C. trachomatis plasmid DNA using polymerase chain reaction (PCR) and for C. trachomatis antigen using Chlamyfast OIA test. MSU samples were used for inoculating of conventional culture media and three culture kits; Mycoplasma DUO, Mycoplasma IST and Mycokit NUM. Blood samples were investigated for the presence of C. trachomatis IgG antibodies using enzymelinked immunosorbent assay (ELISA) and ImmunoComb Chlamydia Kit and for mycoplasmal antibodies using mycokit sero. C. trachomatis infection was found in 35% (28/80) of patients in both groups, 56.7% (17/30) was detected in group I and 22% (11/50) in group II compared to none of the controls. C. trachomatis infection was significantly higher in group I versus group II (PЛ‚0.05). Chlamyfast OIA test was less sensitive but more specific than serological assays. ImmunoComb assay had a higher sensitivity but lower specificity than ELISA. A total of 34 cases (42.5%) were positive in a pathogenic level for U. urealyticum and or M. hominis and 30% were positive for U. urealyticum only, 7.5% were positive for M. hominis only and 5% had mixed infection with both organisms. Mycoplasmas infection in group I was found to be significantly higher than in group II (PЛ‚0.05). Mycoplasma IST has the highest sensitivity (100%) andin identification of U. urealyticum while both mycoplasma ISTand mycoplasma DUO showed the highest sensitivity in identification of M.hominis. Serological evidence was detected in 16/24 (66.7%), 2/6 (33.3%) and 4/4 (100%) of U. urealyticum, M. hominis and mixed infections respectively. The serological response to each infection is significantly higher in group I than in group II (P value Л‚0.05). Our study detects a high prevalence rate of C. trachomatis, M. hominis and U. urealyticum in cases with complicated UTI. Commercially available kits are simple and sensitive methods to use in laboratories which do not routinely test for these pathogens. Key words: Chlamydia trachomatis, urinary tract infections (UTIs), non gonorrheal urethritis (NGU). Badawi et al. 831 INTRODUCTION Urinary tract infections (UTI) are frequent type of infectious pathology treated in primary care clinics. The participation of microorganisms associated with sexually transmitted infection has been reported recently as possible cause of UTI (GonzГЎlez-Pedraza et al., 2003). According to a World Health Organization (WHO, 2001) report, Chlamydia trachomatis is responsible for the most common sexually transmitted bacterial infection worldwide, affecting more than 90 million people and has been known to have a significant effect on human reproduction (Paavonen and Eggert-Kruse, 1999; Al-Sweih et al., 2012). The prevalence of C. trachomatis in woman under 25 years of age is very high (up to 30%) hence, young sexually active women are the most at risk (Mangin et al., 2012). C. trachomatis is one of the causes of acute and chronic urinary tract infections and acute or silent salphingitis (Wanic-Kossowska et al., 2001) that if not treated in an early stage can lead to severe complications, such as pelvic inflammatory disease (PID), ectopic pregnancy and tubal infertility (Marrazo and Stamm, 1998; Gaydos et al., 2004). Most C. trachomatis genital tract infections in men and women are asymptomatic, so the opportunity for unchecked transmission is high even in countries with advanced public health care systems (Dean et al., 2012; Vicetti Miguel et al., 2013). Dysuria and increased urinary frequency associated with presumed urinary tract infection are extremely common reasons for seeking treatment in primary care. About 10% of women suffer from symptoms of a urinary tract infection in any year, and seeking treatment provides a potential opportunity to detect both symptomatic and asymptomatic infection with C. trachomatis (Mangin et al., 2012). C. trachomatis infection is easily treatable with antibiotics, so detection and treatment of infected individuals is a key element of Chlamydia control programs (Gaydos et al., 2004; Van der Helm et al., 2013). Although there are a variety of methods for testing for C. trachomatis, no single test is ideal (Mangin et al., 2012). Culture, nucleic acid hybridization tests, and nucleic acid amplification tests (NAATs) are available for the detection of C. trachomatis. Culture and hybridization tests require urethral swab specimens, whereas NAATs can be performed on urine specimens. The sensitivity and specificity of the NAATs are clearly the highest of any of the test platforms for the diagnosis of chlamydial infections (Lee and Lee, 2013). Infections with Ureaplasma urealyticum and genital mycoplasmas (M. hominis and M. genitalium) have been recognized for about a decade as a common STD in developed countries (Yoshida et al., 2002). Genital ureaplasmas and mycoplasmas are natural inhabitants of the male urethra, contaminating the semen during ejaculation. However, U. urealyticum, are implicated in invasive *Corresponding author. E-mail: [email protected]. diseases such as urethritis, postpartum endometritis, chorioamnionitis, spontaneous abortion and premature birth, as well as low birth weight, pneumonia, bacteremia, meningitis and chronic lung disease in prematurely born infants (Dhawan et al., 2012; Al-Sweih et al., 2012). Mycoplasma hominis is also associated with bacterial vaginosis, pelvic inflammatory disease, arthritis and even neonatal meningitis (Hopfe et al., 2013). The aim of this study was to asses diagnostic value of novel simple diagnostic kits used in the detection of C. trachomatis, U. urealyticum and M. hominis in urine of patients with complicated urinary tract infections (UTIs) and to compare these simple methods to molecular and cultural ones as gold standards. MATERIALS AND METHODS Patients This study was conducted on 80 patients that were divided into two patient’s groups; group I: 30 male patients with clinically diagnosed complicated UTIs complained of recurrent UTI that resist treatment with conventional antibiotics (cystitis, prostatitis, epididymititis, cancer bladder, urethral stricture,stone fomation, hydronephrosis and urinary bilharziais), their Group II: 50 male patients with non complicated UTIs. Twenty male healthy control subjects (Group III) were also included. The patients were chosen from those admitted to urosurgery department or attending the urosurgery outpatient clinic in TBRI. The controls were selected from those admitted, during the same period, for Surgery Department with normal urine analysis. The patients diagnosis was based on complete history taking including increased frequency of micturation, dysuria, haematuria, uretheral discharge, antischistosomal treatment, instrumentation or any previous pelvic troubles. Complete clinical assessment, radiological investigation, cystoscopy and histopathological examination, urine analysis and culture were also performed. The patients or controls did not receive antibiotics two weeks before the study. Sample collection Early morning first voided urine (FVU) samples and mid-stream urine (MSU) were collected from patients and controls. FVU samples were stored at -70В°C untill investigated for C. trachomatis antigen using enzyme immunoassay (EIA) and C. trachomatis plasmid DNA using PCR. MSU samples were centrifuged and the pellets were then used for inoculating of three culture kits; Mycoplasma DUO, Mycoplasma IST and Mycokit NUM and conventional culture media. Blood samples were collected and sera were stored at -70В°C to be investigated for the presence of C. trachomatis antibodies and mycoplasmal antibodies using ELISA and ImmunoComb Chlamydia Kit and Mycokit Sero respectively. Detection of Chlamydia trachomatis PCR analysis of C. trachomatis plasmid DNA in urine specimens Eight (8) ml of FVU samples were mixed thoroughly and centrifuged 832 Afr. J. Microbiol. Res. at 3000 rpm for 30 min at room temperature. The precipitate was transferred to 1.5 ml microcentrifuge tube and centrifuged at 14000 rpm for 30 min. The pellets were stored at -20В°C until DNA extraction. DNA extraction was performed using QIA amp Viral RNA Mini kit (Qiagen GmbH, Germany) because the AVL buffer used in this kit, inactivates the numerous unidentified PCR inhibitors found in urine. The extraction was done following the QIA amp using spincolumn protocol with slight modification as follows: The urine pelet was dissolved in 1ml PBS. 250 Ојl of urine solution were added to 560 Ојl of the buffer AVL/carrier RNA followed by vortexing and incubation for 15 min at room temperature. 750 Ојl of absolute ethanol were then added and mixed by pulse-vortex for 20 s. The mixture was then applied to the QIA amp spin column and centrifuged at 8000 rpm for 2 min followed by washing with buffer AW1 then AW2. DNA adsorbed onto the QIA amp silica gel membrane was eluted by adding 60 Ојl buffer AVE followed by incubation for 5 min and centrifugation for 5 min at 8000 rpm. The elution step was repeated to increase the yield of DNA. The eluted solution was stored in aliquots at -20oC untill performance of amplification. PCR amplification: performed with PCR kit (DiaSorin, Italy-UAS). Primers set used : It delineated PCR amplification product of 207 bp within the cryptic plasmid of C. trachomatis : PC24 : 5`GGG ATT CTT GTA ACA ACA AGT CAGG 3` and PC 27 : 5`CCT CTT CCC CAG AAC AAT AAG AAC AC 3`. The 207 bp product obtained with primers PC24 and PC27. Reaction mixture: The reaction volume was 100 Ојl containing 1 Г— PCR buffer, 2.5 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, 2.5U Taq DNA polymerase (Promega, Madison WI, USA), 50 P mole of each primer. Ten microliters of extracted DNA were added to 100 Ојl of the PCR mixture in the reaction tube. Enzymatic amplification was performed using a programmable thermal cycler 480 version (Perkin Elmer Ceteus, Norwalk, Conn). Amplification started with an initial denaturation step at 94В°C for 5 min followed by 35 cycles. Each cycle consisted of denaturation at 94В°C for 1 min, annealing at 60В°C for 1 min and primer extension at 72В°C for 1 min. The reaction was stopped by cooling at 4В°C. Detection of amplification product: Fifteen microliters of the PCR product were electrophoresed through 2% agarose gel containing ethidium promide (0.5 mg/ml) at constant current 100 volt for 45 min. Bands were observed under UVR light and photographed. Optical immunoassay (Chlamyfast OIA, International Microbio, France) in urine Optical immunoassay is a two-step procedure involving antigen extraction and detection. The test surface is a silicon water reflecting white light into a predominant gold color. The sample was placed on the test surface. If it contains the antigen, binding would occur between the antigen and the water surface and it was then recognized by the anti-LPS conjugate. After washing to remove unbound components, an optical enhancer was applied to the test surface. Its precipitation leads to an increased thickness in the molecular thin film with subsequent change in the color of the reflected light from gold to blue/purple. If chlamydial antigen was not present in the sample, there would be no change in color. EIA ImmunoComb Chlamydia Kit for determination of Chlamydia IgG in serum semi-quantitative The ImmunoComb Chlamydia Bivalent IgG Kit (ImmunoComb, PBS, Orgenics, France) is an EIA test intended for the semiquantitative of IgG antibodies to C trachomatis in serum. ImmunoComb consist of a solid-phase EIA. The solid phase is a comb with 12 projections. Each tooth is sensitized at two positions; upper spot: goat antibodies to human immunoglobulin (Internal Control), lower spot: inactivated antigens of C. trachomatis. The developing plate has 6 rows (A-F) of 12 wells, each row containing a reagent solution ready for use at a different step in the assay. The test was performed stepwise, by moving the comb from row to row, with incubation at each step. Serum specimens were added to the diluent in the wells of row A of developing plate. The comb was then inserted in the wells of row A. Anti-C. trachomatis antibodies, if present in the specimens, will specifically bind to the respective chlamydial antigens on the lower spot of each tooth of the comb. Simultaneously, immunoglobulins present in the specimens would be captured by the anti-human immunoglobulin on the upper spot (Internal Control). Unbound components would be washed away in row B. In row C, the human IgG captured on the teeth will react with alkaline phosphatase-labeled anti-human IgG. In the next two rows, unbound components were removed by washing. In row F, the bound alkaline phosphatase will react with chromogenic components. The results were visible as gray-blue spots on the surface of the teeth of the comb. A positive control (anti- C. trachomatis IgG) and a negative control were included in each assay run. Upon completion of the test, the tooth used with the positive control should show 2 gray-blue spots. The tooth used with the negative control should show the upper spot and either no other spot or a faint lower spot. The upper spot should also appear on all other teeth, to confirm the addition of the specimen, proper functioning of the kit and correct performance of the test. Detection of mycoplasmas Conventional Culture for Mycoplasmas Urine sediment was cultured for M.hominis by direct plating on enriched heart infusion (HN) mycoplasma agar and indirect inoculation of HN mycoplasma broth, which were then incubated at 37В°C in a candle Jar. It was also cultured for U. urealyticum on U9 broth and A7 agar (Int-mycolpasma-France) and incubated anaerobically according to El-Mishad et al. (1992). The plates were then examined under a dissecting microscope for up to 10 days. The results have been determined in terms of identification and quantification of U. urealyticum and M. hominis. For quantification; two different levels have been determined for both U. urealyticum and M. hominis: a non-pathogenic level which was determined as <104 colour changing units (CCUs)/ml and a pathogenic level which was determined as ≥104 CCU/ml. Detection and Antibiotic Susceptibility Testing of Urogenital Mycoplasmas The centrifuged pellets were resuspended in sterile saline and then processed with the following 3 kits: Enzyme-linked immunosorbent Chlamydia IgG in serum assay for detection of Enzyme-linked immunosorbent assay (ELISA) (DRG Diagnostics, Germany) was performed and interpreted according to manufacturer’s instractions. IgG titer greater than 1:512 was a criterion for serodiagnosis of acute or current infection. Mycoplasma DUO (Sanofi, Diagnostics Pasteur, France): The kit composed of microplates, each of 6 wells containing substrates and growth factors for mycoplasma to ensure optimal sensitivity, besides inhibitors for polymorphic flora to ensure optimal selectivity. It was designed for identification and enumeration of mycoplasmas. Identification was based on specific metabolic properties; hydrolysis Badawi et al. of urea by U. urealyticum or arginine by M.hominis which was indicated, after 24 or 48 h of incubation, by a change in colour of the well containing the relevant substrate without clouding of the medium. Titration was based on applying successive dilutions of the specimens to the lower three wells. The titer was expressed as the number of CCUs/ml specimen. The technique allowed titration around the level of 103 and 104/ml which were the accepted pathogenicity levels Mycoplasma IST (bioMerieux, France): The principle and components were similar to those of DUO with the addition of eleven more wells for determining the susceptibility of the strain to six antibiotics including doxycycline, josamycine, ofloxacine, erythromycine, tetracycline and pristinamycin. Mycokit-NUM (PBS-Orgenics, france): Serial tenfold dilutions were made from the urine and inoculated into the transport medium; urea broth (U9) for U. urealyticum in the first column and into arginine broth (M42) for M. hominis in the second column; in presence of appropriate PH indicator. After 48 h incubation, the titer was estimated in CCU/ml as the reciprocal of the highest dilution revealing a colour change. Serological assessment for mycoplasmas (Mycokit-SERO, PBS-Orgenics, France) For detection of mycoplasmal antibodies; anti-U.urealyticum and anti-M.hominis; in sera. The principle and components of the kit were similar to those of Mycokit-NUM, except that lyophlized U.urealyticum and M.hominis were added to U9 and M42 columns respectively. After incubation for 48 h at 37В°C, growth of mycoplasma induced a pH change of the medium, turning its colour from yellow to blue. If serum contained specific antibodies, inhibition of multiplication of mycoplasma would occur preventing the colour change (metabolic inhibition test). The antibody titer was the least dilution showing no colour change (remained yellow). Statistical analysis The statistical analysis was performed using SPSS version 10.0 statistical software (SPSS Inc, Chicago, IL). Data were presented as mean В± SD and range or as an absolute number and percentage. Sensitivity, specificity and predective values were calculated. Chi-square tests were used for the analysis of the categorical variables and Quantitative data with uneven distribution were analyzed with the Mann-Whitney U test. P < 0.05 was considered statistically significant. RESULTS Two groups of patients were included in the present study; Group (I): consists of 30 male patients with clinical diagnosis of complicated UTIs. Their ages were ranged from 29 to 54 years with a mean of 30 В± 9.8 years (average В± SD) (Table 1). Group (II): consists of 50 patients with simple non complicated UTIs. Their ages were ranged from 32 to 59 years with a mean of 32 В± 8.7 years (average В± SD). Using amplified PCR assay, C. trachomatis infection was found in 35% (28/80) of patients in both groups, 56.7% (17/30) was detected in group I and 22% (11/50) in group II compared to none of 833 Table 1. Distribution of 30 patients Group I among different complicated clinical condition. Complicated Clinical Status* Cystitis Prostatitis Epididymitis Cancer bladder Urethra stricture Stone formation Hydronephrosis Urinary Bilharzial No. % 8 15 13 9 6 11 4 27 50 43 30 20 37 13 16 53 *One patient may have more than one clinical status the controls. Serological evidence was detected in 76% (13/17) and in 27% (3/11) of positive cases of group I and group II respectively. C. trachomatis infection was significantly higher in group I versus group II (PЛ‚0.05). Table 2 shows the diagnostic performance of different tests used for the detection of C. trachomatis infection among all studied patients using PCR assay (Figure 1) as reference standard. It was noticed that Chlamyfast OIA test which detects chlamydial antigen in urine specimens was less sensitive but more specific than serological assays that detect IgG antibodies in serum. ImmunoComb assay had a higher sensitivity but lower specificity than ELISA. In this study, out of 80 urine specimens of infected groups, a total of 34 cases (42.5%) were positive in a pathogenic level for U. urealyticum and or M. hominis by at least one of the diagnostic procedures used. It was found that 30% were positive for U. urealyticum only and 7.5% were positive for M. hominis only and 5 % had mixed infection with both organisms. In the control group, U. urealyticum and M. hominis were isolated from 5 and 2.5% of normal subjects respectively in a non-pathogenic level. The distribution of different types of mycoplasma among the studied groups are shown in Table 3. Mycoplasmas infection in group I was found to be significantly higher than in group II (PЛ‚0.05). The diagnostic value of different identification procedures for U. urealyticum and M. hominis among studied groups were shown in Table 4. It was observed that Mycoplasma IST has the highest sensitivity (100%) and absolute negative predictive value (NPV) in identification of U. urealyticum while both Mycoplasma ISTand Mycoplasma DUO showed the highest sensitivity and absolute NPV in identification of M. hominis. The serologic reactivity to U. urealyticum and M. hominis infection among positive cases was illustrated in Table 5. Serological evedince was detected in 16/24 (66.7%), 2/6 (33.3%) and 4/4 (100%) of U. urealyticum, M. hominis and mixed infections respectively. Serologic reactivity to C. trachomatis, U. urealyticum, 834 Afr. J. Microbiol. Res. Table 2. Diagnostic performance of recent tests used for detection of C. trachomatis among all studied patients with UTI. C. trachomatis PCR On urine sediment Pos. (No=28) Neg. (No=52) Test result Sensitivity Specificity PNV* NPV** Chlamyfast OIA Pos Neg 17 11 9 43 61 83 65 80 ELISA IgG Pos Neg 16 12 11 41 57 79 59.5 77.4 ImmunoComb IgG Pos Neg 26 2 14 38 93 67 61 95 *NPV: Negative predictive value. **Positive predictive value. Figure 1. PCR Results for FVU specimens from male patients with recurrent urogenital infections. The 207 bp product obtained with primers PC 24 and PC27. Lane 1: molecular weight marker, Lanes 2-5: amplification products of four Chlamydia trachomatis positive specimens, Lane 6: a positive control and Lane 7: negative control. M. hominis among studied groups are shown in Table 6. It was noted that the serological respond to each infection is significantly higher in group I than in group II (P value Л‚0.05). DISCUSSION Chlamydia trachomatis is one of the most common sexually transmitted pathogens of humans. According to the Centers for Disease Control (CDC), C. trachomatis infection is among the most prevalent of all STDs, and since 1994, has comprised the largest proportion of all STDs reported to CDC (CDC, 2010). Since most of infected men and women are asymptomatic, this high number of unrecognized infected individuals may provide the reservoir for spreading the infection to other men and women via sexual intercourse Badawi et al. 835 Table 3. Distribution of different types of mycoplasmas among disease groups. Group isolates Group I (No=30) Group II (No=50) Total (No=80) M. hominis No. % 4 13.3 2 4 6 7.5 U. urealyticum No. % 18 60 6 12 24 30 Mixed No. % 2 6.7 2 4 4 5 Total No. 24* 10 34 % 80 20 42.5 *P value Л‚0.05 versus group II. Table 4. Diagnostic value of different identification for U. urealyticum and M. hominis in disease groups. Culture system Sensitivity (%) Diagnostic performance Specificity (%) PPV (%) NPV (%) Mycoplasma IST U. urealyticum M. hominis 100 100 89.7 98.6 78.6 90 100 100 Mycoplasma DUO U. urealyticum M. hominis 90.9 100 89.7 97.2 76.9 80 96.3 100 Mycokit - NUM U. urealyticum M. hominis 80 70 90 100 72.7 100 93.1 95.9 Table 5. Serologic Reactivity to U.urealyticum and M.hominis among positive cases using Mycokit-NUM. Positive case U. urealyticum (No. = 24) M. hominis (No = 6) Mixed infection (No.= 4) Total (No. =34) Positive No. 16 2 4 22 (Nassar, 2007). Reported rates of chlamydial infection have increased dramatically over the past decade, reflecting expansion of chlamydial screening activities, highly sensitive nucleic acid amplification tests and improvements in information systems used for reporting rather than a true increase in disease burden (Workowski and Berman 2007 ; Geisler, 2010). However, screening and treatment are focused on females, with the burden of this infection and infertility sequelae considered to be a predominantly female problem, although the prevalence of chlamydial infection is similar in males and females (Cunningham and Beagley 2008; FernГЎndez-BenГtez et al., 2013). Prevalence of C. trachomatis varies according to geographic area, age and status of patients (Ghazvini et al., 2012; FernГЎndez-BenГtez et al., 2013). In developing countries, infections caused by Chlamydia and Mycoplasma have Negative % 66.7 33.3 100 64.7 No. 8 4 0 12 % 33.3 66.7 0 35.3 not been adequately studied and the prevalence of C. trachomatis, genital ureaplasmas and genital mycoplasmas has not been determined so infections by these pathogens may be higher than those reported (Gdoura et al., 2008; Ghanaat et al., 2008). In our study C. trachomatis infection was found in 35% (28/80) of patients in both groups, 56.7% (17/30) was detected in group I and 22% (11/50) in group II compared to none of the controls. These results were similar to a study done by Vasic et al. (2004) who reported that Chlamydia infection has been determined in 35.55% (128/360) of male patients with urethritis symptoms. Our results was comparable to a previous study in Egypt by El Sayed et al. (2006) where C. trachomatis was detected in 25 out of 50 (50%) of examined urine samples. In a Japanese study, 47.7% (73/153) of FVU specimens in men with urethritis were positive for C. trachomatis 836 Afr. J. Microbiol. Res. Table 6. Serologic reactivity to C. trachomatis, U. urealyticum, M. hominis among studied groups. Test result Group I (No. = 30) No. % Group II (No. = 50) No. % Total (No. = 80) No. % C. trachomatis Positive Negative 18 12 60 40 9 41 18 82 27 53 33.8 66.2 U. urealyticum Positive Negative 17 13 56.7 43.3 3 47 6 94 20 60 25 75 M. hominis Positive Negative 4 26 13.3 86.7 2 48 4 96 6 74 7.5 92.5 (Maeda et al., 2004). Wiggins et al. (2006) reported that up to 30% of urethritis cases were due to a C. trachomatis infection, compared to only 4% in healthy control subjects. C. trachomatis is a frequent pathogen associated with upper and lower urinary tract infections (El-Sayed et al., 2006). Chlamydial infection in the male urethra can be complicated by urethritis, epididymitis and prostatitis (Gdoura et al., 2008), Although the role of Chlamydia in the development of prostatitis is controversial, it is highly suggested that Chlamydia is considered to be an etiological agent, with incidences of up to 39.5% reported in patients with prostatitis (Cunningham and Beagley, 2008). This may explain the higher prevalence of C. trachomatis in the group of complicated UTI, as 50% of our patients suffer from prostatitis, 43% suffer from epididymitis and 30% had urethral stricture. In this study, the diagnostic performance of different tests used for the detection of C. trachomatis infection among all studied patients was compared using PCR as a reference standard. Chlamyfast OIA test which detects chlamydial antigen in urine specimens was less sensitive but more specific than ImmunoComb assay that detect IgG antibodies in serum. ImmunoComb IgG had a higher sensitivity but lower specificity than ELISA IgG. Vasic et al. (2004) reported that Chlamyfast OIA test detected significant percentage of the Chlamydia infections in patients, which emphasizes the diagnostic importance in diagnosing STIs. Chernesky et al. (1998) concluded that supplemental to the C. trachomatis antigen detection, the easily performed ImmunoComb IgG is of great value in routine diagnosis of genital chlamydial infections. However, Bakardzhie et al (2011) noted a lack of specificity of the ImmunoComb IgG compared to PCR. In an Egyptian study performed by El-Sayed et al. (2006), ELISA IgG showed high level of specificity (100%) and low level of sensitivity (40%) when compared to the cell culture method. As sensitivity of the ELISA test is low, this can assist but cannot replace direct antigen detection or isolation of the organism by the culture technique (Kamel, 2013). Mycoplasma pathogens have been discovered in the urogenital tract of patients suffering from PID, urethritis and other urinary tract diseases (Goulet et al., 1995). M. hominis is frequently recovered from the genitourinary tract. In addition, M. hominis causing bacterial vaginosis in women, has been proposed as one cause of NGU in men (Workowski and Berman, 2007). In our study pathogenic level for U. urealyticum and or M. hominis was found in 42.5% of our patients; 30% were positive for U. urealyticum only and 7.5% were positive for M. hominis only and 5 % had mixed infection with both organisms. U. urealyticum and M. hominis were isolated in a non-pathogenic level from 5% and 2.5% of normal subjects respectively. Our results were comparable to those in a previous study from Turkey in which U. urealyticum was found in 48% of patients (24/50) with non-gonococcal urethritis. Thirteen (13) of these patients had only U. urealyticum, and the rest had mixed pathogenic organisms; 14% (7/50) U. urealyticum with M. hominis; 6% (3/50) U. urealyticum with C. trachomatis and 2% (1/50) U. urealyticum with M. hominis and C. trachomatis (KД±lД±Г§ et al., 2004). Also Takahashi et al. (2006) in Japan detected Mycoplasma and Ureaplasma in FVU of young men at comparable rates of 4% for M. hominis and 12% for U. urealyticum. Whereas in Tunisia genital M. huminis and genital ureaplasmas affected a large number of infertile male patients, reaching 10.6% and 15.4% respectively (Gdoura et al., 2008). Mycoplasma IST and Mycoplasma DUO showed high sensitivity compared to culture as gold standard method of detection. This finding was similar to previous studies which found no difference between Mycoplasma IST and culture regarding isolation of Mycoplasma (KД±lД±Г§ et al., 2004) and considered Mycoplasma Duo assay as a simple and a sensitive method comparable to culture and Badawi et al. PCR for the detection of Ureaplasma spp. (Cheah et al., 2005; Ekiel et al., 2009). Biernat-Sudolska et al. (2013) reported that the sensitivity and specificity of the Mycoplasma IST test when compared to the culture method as a “gold standard” were determined as 91 and 96%, respectively, while the positive and negative predictive value of the commercial test was 27 and 99%, respectively for detection of M. hominis in clinical samples. Clegg et al. (1997) demonstrated sensitivity of 93% and specificity of 87% of Mycoplasma IST kit compared to the culture of M. hominis. These findings make the current tests suitable for use in diagnostic laboratories that do not currently test for Ureaplasma spp. or Mycoplasma. It is interesting that 53% of our patients were suffering from urinary bilharziasis. This coexistence between urogenital schistosomiasis and sexually transmitted infection including Chlamydia trachomatis and Mycoplasma genitalium has been previously reported in the area of Madagascar, where Schistosoma haematobium is endemic. Authors in that study suggested that similar situation can be anticipated in most other schistosoma-endemic areas in sub-Saharan Africa presenting the two disease entities as a diagnostic challenge for the local health care providers in these areas (Leutscher et al., 2008). Conclusion Our study detects a high prevalence rate of C. trachomatis, M. hominis and U. urealyticum in cases with complicated UTI. Patients with urinary symptoms should be evaluated for three pathogens as common causes of NGU. Commercially available kits are simple and sensitive methods to use in laboratories which do not routinely test for these pathogens. The association between STD and S. haematobium requires further studies. REFERENCES Al-Sweih NA, Al-Fadli AH, Omu AE, Rotimi VO (2012). Prevalence of Chlamydia trachomatis, Mycoplasma hominis, Mycoplasma genitalium, and Ureaplasma urealyticum infections and seminal quality in infertile and fertile men in Kuwait. J. Androl. 33(6):13231329. Bakardzhie I, Pehlivanov G, Kovachev E (2011). Correlations between Contemporary Methods in the Diagnosis of Chlamydia Trachomatis urogenital infections. J. IMAB 17(1):158-160. /DOI: 10.5272/jimab.2011171.158 Biernat-Sudolska M, Rojek-Zakrzewska D, ZawiliЕ„ska B, Magdalena KV (2013). The need to verify of positive Mycoplasma hominis results obtained using the Mycoplasma IST2 tests. J of Lab Diag, 49 (1):5-8. Centers for Disease Control (CDC) (2010). Sexually transmitted diseases surveillance, 2010. Cheah F-C, Anderson TP, Darlow BA, Murdoch DR (2005). Comparison of the mycoplasma duo test with PCR for detection of Ureaplasma species in endotracheal aspirates from premature infants. J Clin Microbiol, 43(1):509. DOI: 10.1128/JCM.43.1.509-510.2005. Chernesky M, Luinstra K, Sellors J, Schachter J, Moncada J, Caul O, Paul I, Mikaelian L, Toye B, Paavonen J, Mahony J (1998). Can 837 Serology diagnose upper genital tract Chlamydia trachomatis infection? Studies on women with pelvic pain, with or without chlamydial plasmid dna in endometrial biopsy tissue. Sex. Transm. Dis. 25(1):14-19. Clegg A, Passey M, Yoannes M, Michael A (1997). High rates of genital mycoplasma infection in the highlands of Papua New Guinea determined both by culture and by a commercial detection kit. J. Clin. Microbiol. 35:197-200. Cunningham KA, Beagley KW (2008). Male genital tract chlamydial infection: Implications for pathology and infertility. Biol. Reprod. 79(2):180-189. Dean D, Turingan RS, Thomann H-U, Zolotova A, Rothschild J, Joseph SJ, Read TD, Tan E, Selden RF (2012). A multiplexed microfluidic PCR assay for sensitive and specific point-of-care detection of Chlamydia trachomatis. PLoS ONE 7(12): e51685. doi:10.1371/ journal.pone.0051685. Ekiel AM, Friedek DA, Romanik MK, Jozwiak J, Martirosian G (2009). Occurrence of Ureaplasma parvum and Ureaplasma urealyticum in women with cervical dysplasia in Katowice, Poland. J. Korean Med. Sci. 24(6):1177-1181. El-Mishad AM, Mokhtar S, Adu Aitta AM, Ahmed A (1992). Ocurrence of U. urealyticum, M. hominis and anaerobic bacteria in urine of patients with UTI and haematobiasis. Med. J. Cairo Univ. 60(1):167-176. El-Sayed M, Badwy W, Bakr A (2006). Rapid hybridization probe assay and PCR for detection of Chlamydia trachomatis in urinary tract infections: a prospective study, Curr. Microbiol., 53(5):379-383. FernГЎndez-BenГtez C, Mejuto-LГіpez P, Otero-Guerra L, MargollesMartins MJ, SuГЎrez-Leiva P, Vazquez F, Chlamydial Primary Care Group (2013). Prevalence of genital Chlamydia trachomatis infection among young men and women in Spain. BMC Infect. Dis. 13:388. Gaydos CA, Theodore M, Dalesio N, Wood BJ, Quinn TC (2004). Comparison of three nucleic acid amplification tests for detection of Chlamydia trachomatis in urine specimens. J. Clin. Microbiol. 42(7):3041-3045. Gdoura R, Kchaou W, Chaari C, Znazen A, Keskes L, Rebai T, Hammami A (2008). Assessment of Chlamydia trachomatis, Ureaplasma urealyticum, Ureaplasma parvum, Mycoplasma hominis, and Mycoplasma genitalium in semen and first void urine specimens of asymptomatic male partners of infertile couples. J. Androl. 29(2):198-206. Geisler WM (2010). Duration of untreated, uncomplicated Chlamydia trachomatis genital infection and factors associated with chlamydia resolution: a review of human studies. J. Infect. Dis. 201(2):S104113. Ghanaat J, Afshari JT, Ghazvini K, Malvandi M (2008). Prevalence of genital chlamydia in Iranian males with urethritis attending clinics in Mashhad. Eastern Mediterranean Health J. 14(6):1333-1337. Ghazvini K, Ahmadnia H, Ghanaat J (2012). Frequency of Chlamydia trachomatis among male patients with urethritis in northeast of iran detected by polymerase chain reaction. Saudi J. Kidney Dis. Transpl. 23(2):316-320. GonzГЎlez-Pedraza A, Ortiz C, Mota R, DГЎvila R, Dickinson E (2003). Role of bacteria associated with sexually transmitted infections in the etiology of lower urinary tract infection in primary care. Enferm Infecc. Microbiol. Clin. 21(2):89-92. Goulet M, Dular R, Tully JG, Billowes G, Kasatiya S (1995). Isolation of Mycoplasma pneumoniae from the human urogenital tract. J Clin Microbiol, 33(11):2823-2825. Hopfe M, Deenen R, Degrandi D, KoВЁhrer K, Henrich B (2013). Host Cell Responses to Persistent Mycoplasmas - Different Stages in Infection of HeLa Cells with Mycoplasma hominis. PLoS ONE 8(1): e54219. doi:10.1371/journal.pone. 0054219. Kamel RM (2013). Screening for Chlamydia trachomatis infection among infertile women in Saudi Arabia. Int J Women’s Health, 5: 277-284. KД±lД±Г§ D, Basar MM, kaygusuz S,Yilmaz E, Basar H, Batislam E (2004). Prevelance and treatment of chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasma hominis in patients with nongonococcal urethritis. Jpn. J. Infect Dis. (8):17-20. Lee Y-S, Lee K-S (2013). Chlamydia and Male Lower Urinary Tract Diseases. Korean J. Urol. 54:73-77. Leutscher PDC, Ramarokoto C-E, Hoffmann S, Jensen JS, Ramaniraka 838 Afr. J. Microbiol. Res. V, Randrianasolo B, Raharisolo C, Migliani, R, Christensen N (2008).Coexistence of urogenital schistosomiasis and sexually transmitted infection in women and men living in an area where Schistosoma haematobium is endemic. Clin. Infect. Dis. 47(6):775. Maeda S-I, Deguchi T, Ishiko H, Matsumoto T, Naito S, Kumon H, Tsukamoto T, Onodera S, Kamidono S (2004). Detection of Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma parvum (biovar 1) and Ureaplasma urealyticum (biovar 2) in patients with non-gonococcal urethritis using polymerase chain reaction-microtiter plate hybridization. Int. J. Urol. 11(9):750-754. Mangin D, Murdoch D, Wells JE, Coughlan E, Bagshaw S, Corwin P, Chambers S, Toop L (2012). Chlamydia trachomatis testing sensitivity in midstream compared with first-void urine specimens. Ann. Fam. Med. 10:50-53. doi:10.1370/afm.1323. Marrazo J, Stamm WE (1998). New approaches of chlamydial infection. Curr. Top Clin. Infect. Dis.18:37-59. Nassar F (2007). Chlamydia trachomatis, Mycoplasma hominis, Mycoplasma genitalium, and Ureaplasma urealyticum in Patients with Sterile Pyuria in Gaza-Palestine. Master thesis in Microbiology, Biological Sciences, Faculty of Science, The islamic University-Gaza. Paavonen J, Eggert-Kruse W (1999). Chlamydia trachomatis: impact on human reproduction. Hum. Reprod. Update 5(5):433-447. Sethi S, Singh G, Samanta P, Sharma M (2012). Mycoplasma genitalium: An emerging sexually transmitted pathogen. Indian J. Med. Res. 136(6):942-955. Takahashi S, Takeyama K, Miyamoto S, Ichihara K, Maeda T, Kunishima Y, Matsukawa M, Tsukamoto T (2006). Detection of Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum, and Ureaplasma parvum DNAs in urine from asymptomatic healthy young Japanese men. J. Infect. Chemother. 12(5): 269-271. Van der Helm JJ, Bom RJM, GruВЁnberg AW, Bruisten SM, Schim van der Loeff MF, Sabajo LOA, de Vries HJC (2013). Urogenital Chlamydia trachomatis Infections among Ethnic Groups in Paramaribo, Suriname; Determinants and Ethnic Sexual Mixing Patterns. PLoS ONE 8(7): e68698. doi:10.1371/ journal.pone.0068698 Vasic A, Tasic NM, Zdravkovic D, Tasic S (2004). Chlamyfast-OIA test in the genital chlamydia male infection diagnosis. Acta Medica Medianae 43:33-36. Vicetti Miguel RD, Harvey SAK, LaFramboise WA, Reighard SD, Matthews DB, Cherpes TL (2013). Human Female Genital Tract Infection by the Obligate. Intracellular bacterium Chlamydia trachomatis elicits robust type 2 immunity. PLoS ONE 8(3): e58565. doi:10.1371/journal.pone.0058565. Wanic-Kossowska M, KozioЕ‚ L, Bajew L, Czekalski S (2001). Acute and chronic urinary tract infections caused by Chlamydia trachomatis. Int. Urol. Nephrol. 32(3):437-438. Wiggins RC, Holmes CH, Andersson M, Ibrahim F, Low N, Horner PJ (2006). Quantifying leukocytes in first catch urine provides new insights into our understanding of symptomatic and asymptomatic urethritis. Int. J. STD AIDS 17(5):289-295. Workowski KA, Berman SM (2007). Centers for Disease Control and Prevention sexually transmitted diseases treatment guidelines. Clin. Infect. Dis. 44 (3):S73-76. World Health Organization (WHO) (2001). Global prevalence and incidence of selected curable sexually transmitted infections. overviews and estimates. Geneva, Switzerland: WHO. Yoshida T, Maeda S, Deguchi T, Ishiko H (2002). Phylogeny-based rapid identification of mycoplasmas and ureaplasmas from urethritis patients. J. Clin. Microbiol. 40(1):105-110. UPCOMING CONFERENCES 7th Asia-Pacific Organization for Cell Biology Congress, Biopolis, Singapore, 24 February 2014 18th Annual International Conference on Research in Computational Molecular Biology Pittsburgh, Pennsylvania April 2-5, 2014 Conferences and Advert February 2014 7th Asia-Pacific Organization for Cell Biology Congress, Biopolis, Singapore, 24 February 2014 March 2014 VIII International Symposium on Antimicrobial Resistance, Cartegena, Colombia, March 5- 7, 2014 April 2014 Annual Meeting of the Association of Medical Microbiology and Infectious Disease Canada, Victoria, Canada, April 2-5, 2014 18th Annual International Conference on Research in Computational Molecular Biology Pittsburgh, Pennsylvania April 2-5, 2014 African Journal of Microbiology Research Related Journals Published by Academic Journals African Journal of Biotechnology African Journal of Biochemistry Research Journal of Bacteriology Research Journal of Evolutionary Biology Research Journal of Yeast and Fungal Research Journal of Brewing and Distilling
© Copyright 2024 Paperzz
