close

Enter

Log in using OpenID

Doç. Dr. Serdar Ceylaner

embedDownload
+
Doç. Dr. Serdar Ceylaner
İntergen Genetik Merkezi
Argekent Bilimsel Araştırma Merkezi
+
Gündem

Eski yöntemlerde yeni gelişmeler (QF-PCR/FISH)

Yeni yöntemlerin eski yöntemlere katkısı (Array-CGH ve
yeni jenerasyon dizi analizi)

Maternal serum DNA analizi

Maternal serum RNA analizi

Yakın gelecek
+
Down sendromu- Çözülemeyen
derdimiz

1/800 sıklıkta

USG ile bulgu vermeme ihtimali var

İkili ve üçlü tarama %15-40 vakayı görmüyor.

USG-İkili-üçlü taramayı beraber bile yapsak % 10 kadar
vakayı kaçırırız.
+
Down sendromu- Çözülemeyen
derdimiz

Onkoloğun hastası ölürse herkes ağlar- doktor elinden geleni
yapmış olur-herkes teşekkür eder. Kanser ölümcül bir
durumdur.

Gebelik bir hastalık olmadığından ve herkesin bir sevinç
yaşamayı beklediği bir durum olduğundan annenin yada
bebeğin ölümü yada her ikisinden birinin kalıcı hastalığı
meydana geldiğinde kıyamet kopar.
+
Amniyosentez ve koryon villus
örneklemesi

Kitaplara göre 1/100-1/400 gebelik kaynı riskine yol açar.

Perinatologların yaptığı işlemlerde ise gebelik kaybı
neredeyse hiç görülmemektedir.

İnvaziv işlemden kaçınma

Maliyet?
+
Eski yöntemlerde yeni gelişmeler

Hızlı tanı yöntemleri sayesinde gebelik tahliyesi için 3 hafta
bekleme ihtiyacı azalmıştır.

QF-PCR ve FISH ‘teki gelişmeler kromozom analizi kadar
güvenilir sonuç elde edilmesini sağlamaktadır.

Henüz bu yöntemler sadece 5 kromozom ile sınırlıdır ama bu
sık görülen hastalıklarda etkinlik yüksek.

En az iki yöntemle tanıyı koyuyorsanız tahliyeyi
yapabilirsiniz.

Kromozom analizini Down sendromunun tipini ve dolayısıyla
tekrarlama riskini tespit etmek için sürdürün.
+
Eski yöntemlere yeni yöntemlerin
katkısı- Array CGH

Ense kalınlığı artışı ve konjenital anomalilerde kromozomu
normal fetüslerin % 5-15’inde gözle görülemeyen kromozom
bozuklukları vardır.
+
Array CGH
+
Açıklanamayan kromozom
değişiklikleri – Array CGH
+
+

Anne baba kromozomu normal

Fazlalığın nedeni?
+
Yakında

Tüm amniyon veya koryon materyallerinden kromozom
analizi yanında array CGH yapılacak.

PEKİ NE ZAMAN?

Fiyatı 100-200 USD’ye düştüğü zaman

Şu an 2000-2500 TL
+
Eski yöntemlere yeni yöntemlerin
katkısı- Yeni jenerasyon dizi analizi

Yeni jenerasyon dizi analizi yüzlerce genin aynı anada
analizini sağlar.

İnsandaki 21000 genin aynı anda analizini sağlar.

Bir insanın tüm DNA’sının analizini sağlar.
+
Çoklu gen çalışmaları

Uzun QT Paneli (KCNQ1, KCNH2, SCN5A, CACNA1C, ANK2,
KCNE1, KCNE2, KCNJ2, CAV3, SCN4B, AKAP9, SNTA1 genleri)
(12 gen) (Tüm Gen - Dizi Analizi-MISEQ)

Zellweger sendromu, Peroksizom biosentez bozukluğu Paneli
(13 gen) (PEX1, PEX2, PEX3, PEX5, PEX6, PEX10, PEX12, PEX13,
PEX14, PEX16, PEX19, PEX26, HSD17B4 genleri) (Tüm Gen - Dizi
Analizi)

İlerleyici ailesel intrahepatik kolestaz 1, 2, 3 Paneli (PFIC1,
PFIC2, PFIC3) (ATP8B1, ABCB11, ABCB4 genleri) (Tüm Gen Dizi Analizi-MISEQ)

Hipertrofik kardiyomiyopati Paneli (6 gen) (MYH7, MYBPC3,
TNNT2, TNNI3, TPM1, MYL3 genleri) (Tüm Gen - Dizi Analizi)
+
İnfantil polikistik böbrek hastalığı

21 haftalık gebe

Gebelikte USG’de infantil tip polikistik böbrek hastalığı
izleniyor.

Aile erken prenatal tanı ve PGT istediği için mutasyon analizi
planlanıyor.

PKHD1 geni 67 ekzon- Fiyat 2350 Euro

Ekzom sekanslama 2000 Euro

Ekzom kararı verildi.
+
Glutarik asidüri tip 2
Homozigot ETFDH: c.1198_1201del (p.His401GlnfsX3)
+
Literatürdeki benzer vaka
ETFDH, 1-BP DEL, 36A
In an infant with the neonatal-onset form of glutaric acidemia IIC with
congenital anomalies (231680), Olsen et al. (2003) found
homozygosity for a 1-bp deletion of 36A in the ETFDH gene, causing a
frameshift beginning with ala12, introducing a stop codon at amino
acid 19. The parents were consanguineous. The child died 1 hour after
birth and showed Potter face, enlarged polycystic kidneys,
symmetrical warty dysplasia of the cerebral cortex, bile duct
hypoplasia, cholestasis, fatty degeneration of the liver, siderosis, lung
hypoplasia, and steatosis of the myocardium. A second child in the
family presented at birth with similar clinical and morphologic
findings. The patient had been previously reported by Lehnert et al.
(1982) and Bohm et al. (1982).
+
İNVAZİV OLMAYAN
PRENATAL TANI
•Maternal kanda fetal hücreler
•Maternal serum DNA
•Maternal seum RNA
+
Anne kanında fetal hücreler

Eski gebeliklerden kalan hücreler

Zenginleştirme ihtiyacı

Zenginleştirme sorunları
+
İŞTE O MUTLU AN
Yeni nesil sekanslama
+
Yeni nesil dizi analizi cihazı
+
+
Sözlük
Maternal Serum Fetal DNA

Cell free DNA – cfDNA

Maternal Plazma Serbest Fetal DNA

Serum + fibrinojen= Plazma
+
Sözlük
Maternal Serum Fetal DNA

NIFTY - Noninvasive Fetal Trisomy Test

NIFT - Noninvasive Fetal Trisomy Test
+
Sözlük
DNA’daki parmak izi-DNA fingerprinting

Her insanda diğerlerinden farklı DNA bölgeleri vardır.

SNP: Single nucleotide polymorphism
AAATAGCTC
AAACAGCTC

STR: Short Tandem Repeat
ATACATACATACATACATAC
+
Sözlük
Mutasyon
+ Sözlük
Polimorfizm
+
Sözlük

Sekanslama-Dizileme?

AATGAACGATAGCC


Sanger dizileme
Yeni nesil dizileme
+
Yeni nesil sekanslama-dizileme

DNA’daki bir bölgeyi yüzlerce kere okuyor.

Bu sayede düşük orandaki değişiklikleri tespit edebiliyor.

Güvenilir bir oranlama yapabiliyor.

Kapasitesi çok yüksek. Bir insanın bütün DNA’sını
okuyabiliyor. Hatta bir cihaz bir çalışmada 4 insanın bütün
DNA’sını okuyabiliyor.
+
Maternal serumdaki fetal DNA ve
özellikleri

İnsan serumundaki DNA’nın önemli bir kısmı ölen ve
apopitoza uğrayan hücrelerden serbest kalan DNA’dır.

Fetal DNA’nın önemli bir kısmı plasenta kaynaklıdır.

Küçük fragmanlar halindedir.

Serumdaki DNA’nın % 5-10’u fetal kaynaklıdır.

Yarılanma ömrü 16 dk’dır.
+
Masively paralel sequencing
+ MANTIK
Massively Paralel Sequencing
Deep Sequencing

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

T

T

T

T

T

T

T

T

T

T

A

A

A

A

A

G

A

A

A

A

G

G

G

G

G

G

G

G

G

G

C

C

C

C

C

C

C

C

C

C

A

A

A

A

A

A

A

A

A

A
+ Massively Paralel Sequencing
Deep Sequencing
+
MANTIK (oransal olarak 1,5 kat)

21. Kromozom 1. bölge 6299 tane

21. Kromozom 2. bölge 6065 tane

…..

21. Kromozom 574. bölge 5987 tane

7. Kromozom 1. bölge 3997 tane

7. Kromozom 2. bölge 4115 tane

….

7. Kromozom 421. bölge 4005 tane
+
MANTIK – İkiz Gebelik

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

T

T

T

T

T

T

T

T

T

T

A

A

A

T

A

G

A

A

A

A

G

G

G

G

G

G

G

G

G

G

C

C

C

C

C

C

C

C

C

C

A

A

A

A

A

A

A

A

A

A
+
Yanlış pozitif

Plasentaya sınırlı mozaisim

Yanlış pozitif sıklığı % 3

YANLIŞ NEGATİF YOK’A YAKIN
Pozitif
çıkan her hastada
invaziv girişim ile teyid
gerekir.
+
NIFTY tarama testi midir?

NIFTY bir tarama testidir. Ana amaç tüm gebe toplumu
taramaktır.

NIFTY sadece bir tarama testi değildir. Tanı koyan bir tarama
testidir.

Yanlış pozitif ve yanlış negatif olasılığı bir testi tanı testi
tasnifinden çıkarmaz.

Plasenta proteinleri için yapılan indirekt testler “sadece”
taramadır. Bu doğrudan bir DNA testidir.
+
Bugün yapılan
Yarın olacak olan

Bugün parası olan- gazeteden bu konuyu okuyan hanımlar
istiyor

Amaç ikili üçlü tarama yerine bunu uygulamaya koymak

Ne zaman?

Test başına maliyet 50-100 TL’ye düştüğü zaman

3-5 yıl
+
Testi kimler nerede yapıyor?

Life Codex (Almanya)

Panorama

BGI (Çin)

ABD’de bir kaç merkez. Türkiye’den gönderen yok.

Türkiye’de henüz yapan yok
Cihazlar

Hiseq 2000

Miseq

Sequenom
+
Kaça mal oluyor?

850-1250 Euro

Rapor süresi 3 hafta
+
Materyal

Özel tüplere alınmış 10-20 cc kan

Transport 1-4 gün içinde- oda ısısında

Sonuç verme yüzdesi % 98-99

Yeniden materyal gerekebilir.

10. haftadan sonra alınabilir.

Teknik olarak 6. haftadan itibaren test yapılabilir.
+
Endikasyon

Tüm isteyen aileler

Down sendromu riski olup invaziv işlem istemeyenler

Down sendromu olup olmadığını bilmek isteyen ama tahliye
istemeyenler

Trizomi 13- Trizomi 18 riski olanlar?
+
Dezavantajlar

13-18-21 nolu kromozomların sayısal bozuklukları dışındaki
diğer kromozom hastalıklarını göstermez.

Süre hala amniyosentez – koryon villus kadar uzun

Sonuç anormal gelirse girişimsel işlem gerekli
+
Strateji

Uygun endikasyonlarda ve isteyen herkese NIFT YAPMAK
NIFT sonucu anormal geldiğinde QF-PCR ya da FISH ile 1-2
günde tanının teyidini yapmak ve tahliye

Ultrason anomalilerinde

Translokasyon gibi yapısal anomali taşıyıcısı ailelerde

Tek gen hastalıklarında İNVAZİV İŞLEM YAPMAK

İnvaziv ile alınan materyalden kültür yapmayı sürdürüp
mozaik ve translokasyonlu tipleri ayırt edip tekrarlama riski
konusundaki danışmanlığı ondan sonra vermek
+
Strateji

NIFTY öncesi NT bakılmalıdır. NT yüksekse invaziv
önerilmelidir.

İleride taramalarda da NIFTY + NT + ikinci trimester USG
kombinasyonu en olası ideal kombinasyon olacaktır.
+
Strateji

Anomalilerin hepsinde invaziv işlem ile örnek almak

Tahliye bile etsek etiyolojiyi araştırmak

Etiyoloji için genetik konsültasyon, fetal muayene, fetal
örneklerden kromozom ve DNA eldesi

PRENATAL TANI KOYDUĞUMUZ HASTALARIN
ETİYOLOJİSİNİN, SONRAKİ GEBELİK İÇİN GEREKLİ
BİLGİLERİNİ, TEKRARMA RİSKİNİ, TEKRARLAMA HALİNDE
YAPILACAKLARI ORTAYA KOYMUYORSAK İŞİMİZİ YAPRIM
YAPTIK DEMEKTİR.
+
Maternal Serum DNA toplumsal
tarama ihtiyacını karşılıyor mu?

Sensitivite ve spesifite yüksek olmalı

Uygulaması kolay olmalı

İlk trimesterda uygulanabilir olmalı

Ucuz olmalı
+
MATERNAL SERUM RNA

DNA ---- RNA ---- PROTEİN

RNA çok kolay yıkılan bir moleküldür.

İlginç olarak fetal RNA çok stabildir.

Bu zaten fetal RNA’nın küçük fragmanlar halinde olmasından
ve RNAz enziminin etkisinden kaçabilmesinden
kaynaklanmaktadır
+
MATERNAL SERUM RNA

RNA DNA gibi diğer bir biyomarkerdır

Sorun her dokuda ve çeşitli durumlarda farklı genlerin
RNA’larının farklı miktarda üretilmesidir.

Lo tarafından geliştirilen alelik ayrım yöntemi ile PLAC4
geninde yapılan çalışmalarda Down sendromu tanısı başarı
ile konulabilmiştir.
+
Alelik ayrım

A

A

A

A

A

A

A

A

A

A

T

T

T

T

T

T

A

T

T

A

G

G

G

G

G

C

C

C

C

C

A

A

A

A

A
1:1
2:1
+
Alelik ayrım

Sensitivite %90

Spesivite %96,5

Tek marker ile elde edilen bu başarı çoklu markerlara
taşınmaya ve çok ucuz bir tarama yöntemi daha
geliştirilmeye çalışılmaktadır.
+ DÖRT BOYUTLU USG
SERDAR CEYLANER
İNTERGEN
+
Holoprozensefali
Kromozom analizi (%25-50 tanı koydurucu)

Trizomi 13- Trizomi 18- Triploidi

del13q veya dup13q, del(18p), del(7)(q36), dup(3)(p24-pter),
del(2)(p21), del(21)(q22.3)
+
Holoprozensefali
Kromozom analizi normal ise

Array CGH (CNV- Copy Number Variation)(Kopya sayısı
değişikliği) (Özetle delesyon- duplikasyon) (%10-20) (20002500 TL)
+ Holoprozensefali
Sendromik tek gen hastalıkları – Ekzom
sekanslama (% 18-25) (2000-4000 Euro)
Otosomal Dominant






Pallister-Hall syndrome
Rubinstein-Taybi syndrome
Kallmann syndrome
Martin syndrome (with clubfoot, spinal anomalies)
Steinfeld syndrome (with congenital heart disease, absent gallbladder, renal dysplasia, radial defects) (OMIM
184705)
Ectrodactyly and ocular hypertelorism
Otosomal Resesif
 "Pseudotrisomy 13 syndrome," in which affected individuals have a normal karyotype and polydactyly. Other
commonly seen features of trisomy 13, including scalp defects, overlapping fingers, and nail hypoplasia, are
not generally observed [Cordero et al 2008].
 Smith-Lemli-Opitz syndrome [Kelley et al 1996, Weaver et al 2010]
 Meckel syndrome
 Genoa syndrome (with craniosynostosis) (OMIM 601370)
 Lambotte syndrome (with microcephaly, prenatal growth retardation, ocular hypertelorism) (OMIM 245552)
 Hydrolethalus syndrome (with hydrocephalus, polydactyly, and other anomalies) (OMIM 236680)
 Facial clefts and brachial amelia (OMIM 601357)
Otosomal dominant vs multifaktoriyel
 Microtia-anotia (OMIM 600674) and other anomalies
 HPE-agnathia spectrum disorders
+ Holoprozensefali
Non- sendromik tek gen hastalıkları – Ekzom
sekanslama (% 5-10) (2000-4000 Euro)
SHH
7q36
30%-40% <5%
600725
142945
ZIC2
13q32
5%
2%
603073
609637
SIX3
2p21
1.3%
Rare
603714
157170
TGIF1
18p11.3
1.3%
Rare
602630
142946
GLI2
2q14
?
?
610829
165230
PTCH1
9q22.3
?
?
601309
610828
DISP1
1q42
Rare
Rare
607502
FGF8
10q24
Rare
Rare
600483
FOXH1
8q24.3
Rare
Rare
603621
Rare
Rare
601265
TDGF1 (CRIPTO) 3p23-p21 Rare
Rare
187395
GAS1
9q21.33
are
Rare
139185
DLL1
6q27
Rare
Rare
606582
CDON
11q24.2
Rare
Rare
608707
NODAL 10q22.1
+
Holoprozensefali
Çevresel etkenler

Diabet

Alkol

Retinoik asit

Hiperkolesterolemi?

Kolesterol düşürücü ajanlar (Statinler)
+
Diğer nimetler

Maternal kanda fetal DNA artışı (preeklempsi-eklempsi)

Rh grubu tayini (Kan uyuşmazlığı)

HPA1 tayini (Trombosit grup uyumsuzlukları)

Fetal cinsiyet tayini (Cinsiyet seçen hastalıklar- 21
hidroksilaz)

Babadan kalıtılan mutasyonlar
+
Yeni jenerasyon dizi analizinin
nimetleri

Muayene ile tanı konulamayan hastalarda tanı

Akraba evliliklerinde her iki eşin birden taşıdığı
mutasyonların tespiti

Çok genli yada büyük genleri olan hastalıkların araştırılması

Yanlış tanı oranında azalma
+
Çok yakında serbest fetal DNA’dan

Tüm kromozomların tüm bölgeleri analize edilebilecek

21.000 genin tamamı analiz edilebilecek

Anomaliye ve tek gen hastalıklarına bağlı sorunlar çok
azalacak
10
yıl içinde hasta bu işleri evde
yapabilecek
+
Oxford Nanopore Minion
+ Çok yakında serbest fetal DNA
sayesinde

GENETİKÇİ

PERİNATOLOG
PERİNATOLOG USTA
Genetikçi Lazım Olursa


Dr. Serdar Ceylaner [email protected]
05332145337
Author
Document
Category
Uncategorized
Views
3
File Size
1 471 KB
Tags
1/--pages
Report inappropriate content