close

Enter

Log in using OpenID

5A ODO gio 6 novembr..

embedDownload
RNA polimerasi II
trascrive
i geni per la
sintesi dei
precursori
degli mRNA, molti snRNA (U1, U2,
U3, U4, U5, …), un gran numero di
long non coding RNA
mRNA di Eucarioti
e Procarioti
TFIIF e la RNA
polimerasi
… alla fine si
lega la RNA
polimerasi II
seguita da
altri fattori di
trascrizione
TFIIE e TFIIH
Apr 2014
Il confronto tra gemelli umani identici, solo
uno dei quali con sindrome di Down, rivela
un generale appiattimento dei livelli di
espressione genica nella persona affetta
da trisomia
La sindrome di Down si verifica quando un essere
umano ha una copia extra del cromosoma 21.
Poiché ogni cromosoma contiene molti geni
regolatori dell’espressione genica, è stato presunto
per decenni che la condizione patologica fosse
causata principalmente da una sovrabbondanza di prodotti dei geni del
cromosoma 21 in più.
Recentemente è stato segnalato un caso di sindrome di Down che è
associato con alterata espressione dei geni di tutti i cromosomi, non solo
del cromosoma 21.
Questa osservazione implica che l'espressione di un qualsiasi gene su un
qualsiasi cromosoma possa contribuire alla sindrome di Down, e solleva la
possibilità che una copia extra di qualsiasi cromosoma possa distruggere la
regolazione generale dei geni.
Appiattimento dell'espressione genica nella trisomia 21.
In una persona con sindrome di Down i domini genomici che
sono normalmente associati con bassi o alti livelli di
espressione genica sono rispettivamente up-regolati o downregolati, rispetto a quanto avviene nel suo gemello identico
che non ha la trisomia. Il risultato è un appiattimento
dell’espressione genica nell’intero genoma.
La stabilità del complesso di trascrizione,
e quindi del numero di copie di RNA
sintetizzate dalla RNA polimerasi II,
dipende dai fattori di trascrizione (proteine)
che compongono il complesso
Una volta correttamente legata al complesso dei fattori di trascrizione sul promotore, Pol II apre la
doppia elica del DNA ed inizia a legare i primi nucleotidi. Fatto questo, la subunità di inizio viene
sostituita dal fattore di
elongazione che stabilizza la forma
attiva dell’enzima
Enzima che
lega il cap
all’RNA in
corso di sintesi
cap
Una volta raggiunte le sequenze di stop, il pre-RNA si stacca insieme al
fattore di elongazione, ma la sintesi prosegue rallentando gradualmente …
L’enzima che lega il cap si stacca
alla fine della trascrizione
Apr 2014
Durante il suo viaggio nel gene,
l'RNA polimerasi II deve fare i conti
con una serie di ostacoli alla sua
progressione, tra cui i nucleosomi,
le varie proteine ​che legano il DNA,
i danni al DNA e le sequenze che
sono intrinsecamente difficili da
trascrivere. Non sorprende quindi
che un gran numero di fattori di
allungamento si siano evoluti per
garantire che non si verifichi stallo o
arresto della trascrizione. Quando
capita che la RNA polimerasi non si
riesce a riavviare, viene poliubiquitinata e degradata dal
proteasoma. Questo processo è
altamente regolato in modo tale da
assicurare che siano degradate
soltanto le molecole di RNA
polimerasi II che non possono
essere altrimenti recuperate.
La trascrizione della RNA polimerasi II non è un processo continuo, ma
frequentemente l’enzima va in stallo, talvolta anche a marcia indietro,
portando talvolta all'arresto della trascrizione.
Condizioni che portano a stallo possono essere in cis, ad esempio
sequenze difficili da trascrivere, vincoli topologici, o la struttura stessa della
cromatina, oppure in trans, ad esempio la diminuzione degli XTP necessari
per la sintesi di RNA.
La presenza di uno stallo temporaneo può portare l’enzima a fare marcia
indietro o all’arresto trascrizionale, e questo può spesso essere risolto con
l'assunzione di nuovi fattori di allungamento come TFIIS.
La grande stabilità del complesso di elongazione della RNA polimerasi II
permette all’enzima di rimanere attaccato al suo DNA stampo senza
dissociarsi.
Tale stabilità del complesso di allungamento è una benedizione in quanto
assicura alta fedeltà nelle lunghe trascrizioni, ma anche una maledizione
quando polimerasi ferma la sua progressione, poiché in quel caso il gene
coinvolto risulta bloccato.
Poliubiquitinazione e degradazione
della RNA polimerasi II.
L’enzima può risultare arrestato o
totalmente bloccato a causa di
un'ampia varietà di condizioni.
Questo può innescare
ubiquitinazione e
degradazione da parte
del proteasoma della
RNA polimerasi II.
Il complesso della RNA polimerasi II
viene smontato e la subuntà Rbp1
viene poli-ubiquitinata e risucchiata
nel proteasoma mentre le altre
subunità vengono rilasciate.
Appare persino sbagliato affermare “un gene codifica per un
mRNA” che viene tradotto in una proteina.
Nel lievito, sono stati trovati quasi 2 milioni di diversi trascritti
di RNA per un genoma che contiene appena circa 6.000 geni
codificanti per proteine.
Un gene produce
RNA condiffererenti
sequenze di inizio
e di terminazione.
Eterogeneità intrinseca
Molecular Biology: The ends justify the means - Nature. 2013 May 2;497(7447):48-9. doi: 10.1038/nature12098 - Pugh B.F.
Appare persino sbagliato affermare “un gene codifica per un mRNA” che viene
tradotto in una proteina.
Nel lievito, sono stati trovati quasi 2 milioni di diversi trascritti di RNA per un
genoma che contiene appena circa 6.000 geni codificanti per proteine.
L’analisi genomica rivela
che ogni gene produce una
ricca complessità di RNA con
differerenti sequenze di inizio
e di terminazione, indicate
come TIF (transcript isoforms).
Questa pletora di
isoforme deriva da un
piccolo numero di RNA
funzionalmente distinti per ciascun gene
che sembrano originarsi per imprecisioni
nell’inizio della trascrizione.
Le popolazioni cellulari non possono mai essere omogenee, nonostante il fatto che
derivano ​da una singola cellula di partenza. Tale eterogeneità intrinseca ha vaste
implicazioni, dal fornire opportunità per l'adattamento nel corso dell'evoluzione e per
spiegare in parte perché è difficile per uccidere tutte le cellule tumorali in un tumore.
Molecular Biology: The ends justify the means - Nature. 2013 May 2;497(7447):48-9. doi: 10.1038/nature12098 - Pugh B.F.
Il numero di geni codificanti proteine ​nei
vertebrati non è radicalmente diverso dal
numero di geni negli invertebrati (es. circa
20.000 geni nell’uomo contro 19.000 geni in
Caenorhabditis elegans). La prevalenza dello
splicing alternativo nei vertebrati è importante
per loro superiore complessità
Lo splicing alternativo è prevalente negli
eucarioti multicellulari (nei mammiferi riguarda il
95% dei geni); quelli unicellulari hanno per lo più
un solo introne o introni corti e presenti solo in
alcuni geni
Alternative splicing: a pivotal step between eukaryotic transcription and translation - Nat Rev Mol Cell Biol. 2013 Mar;14(3):153-65.
doi: 10.1038/nrm3525 - Kornblihtt et al. - Erratum in Nat Rev Mol Cell Biol. 2013 Mar;14(3). doi:10.1038/nrm3560
Tipi diversi di alternative splicing
Differenze nello splicing alternativo hanno un ruolo
nell’evoluzione delle caratteristiche delle varie specie
Anche se i geni di scimpanzé ed uomo sono identici
per oltre il 99 %, il 6-8 % dei loro esoni alternativi
subiscono uno splicing diverso in tessuti equivalenti
La comparazione di trascrittomi di organi di specie di
vertebrati che abbracciano ~ 350 milioni anni di
evoluzione ha rivelato che i pattern di splicing
alternativo si evolvono rapidamente e che, in un
periodo evolutivo di appena 6 milioni di anni, i profili di
splicing di organi equivalenti si discostano così tanto
da risultare più dipendenti dall’identità della specie che
dal tipo di organo
Alternative splicing: a pivotal step between eukaryotic transcription and translation - Nat Rev Mol Cell Biol. 2013 Mar;14(3):153-65.
doi: 10.1038/nrm3525 - Kornblihtt et al. - Erratum in Nat Rev Mol Cell Biol. 2013 Mar;14(3) - doi:10.1038/nrm3560
Lo splicing occupa una posizione centrale nel flusso
delle informazioni genetiche degli eucarioti, dipende da
vari fattori di regolazione e dal tipo di cromatina
Lo splicing alternativo è almeno altrettanto
importante per il differenziamento come la regolazione
della trascrizione
Nella comunicazione tra cellule, varie molecole
segnale influenzano lo splicing alternativo (i)
modificando l’attività di chinasi e fosfatasi che
controllano trascrizione e traduzione, (ii) la
localizzazione subcellulare dei regolatori dello splicing
e (iii) l’acetilazione degli istoni che influenzano la
struttura della cromatina
Alternative splicing: a pivotal step between eukaryotic transcription and translation - Nat Rev Mol Cell Biol. 2013 Mar;14(3):153-65.
doi: 10.1038/nrm3525 - Kornblihtt et al. - Erratum in Nat Rev Mol Cell Biol. 2013 Mar;14(3). doi:10.1038/nrm3560
L'organizzazione dei geni in esoni ed introni e
l'evoluzione dello splicing alternativo hanno portato due
vantaggi, (i) la produzione di proteine che uniscono, in
una singola molecola, domini funzionali già testati dalla
selezione naturale e (ii) la possibilità per un singolo
gene di produrre due o più varianti di mRNA maturo,
simili ma non identiche, ampliando notevolmente la
capacità codificante dei genomi eucariotici
Lo splicing è realizzato dallo spliceosoma assemblato
nei siti di splicing di ogni introne. Sulla base della sua
sequenza, un sito di splicing può essere forte o
debole. La competizione tra siti forti e deboli vicini nel
pre-mRNA è un fattore che porta a splicing alternativo.
Alternative splicing: a pivotal step between eukaryotic transcription and translation - Nat Rev Mol Cell Biol. 2013 Mar;14(3):153-65.
doi: 10.1038/nrm3525 - Kornblihtt et al. - Erratum in Nat Rev Mol Cell Biol. 2013 Mar;14(3) - doi:10.1038/nrm3560
Gen 2014
I geni eucarioti sono discontinui
costituiti da introni ed esoni.
Il processo di splicing dipende
da un insieme di piccoli RNA nucleari
(snRNA), che si assemblano con
proteine ​in un complesso
noto come spliceosoma.
Studio del ciclo di vita degli snRNA
spliceosomali dalla loro trascrizione,
esportazione dal nucleo e
reimportazione nel nucleo per il loro
assemblaggio nello spliceosoma.
Il processo di assemblaggio può anche influenzare la
regolazione dello splicing alternativo ed ha implicazioni per le
malattie umane.
Le RiboNucleoProteine
sono complessi
formati da RNA e
proteine
Struttura della
RNP U1
attggaaaccgaaacccgttggtcacctctgcaatagccctccctccctcacttctacaattttgtgaca
gtggtcttgttttctgcattctctgcttcacgtgcttgttttgttggagcgcgtttgcatgctgctttaa
attctgaaatattaaaaaaatttcgaagtttttcagcacatgggatgggagttttgaatttcaatttttt
aaaaacatttttctgtgattagtgccgtcgtggcacggctgttagccgcctatccggtttattcgatact
ttGTGAGTTTTTTGTAACTTTATGGTCGTCGAAATGGGAAAACTTGGCCACCAATATAAGTTTGGAAAAC
AATTTCCTAAAAATAAAATAATTGAACTTTTCCGATGAATAAAAAAATCGATCAGATATTCTGGAAAAAA
AATCGATAAATTAATCGATTTTCTTGGAAAATACATCGAAAAATTGAGAAAAATAGAAAAATGAATGTTT
TTCGATTACCGATTTATTGATTTTTCGTGAAAACTGAGTTCAGATAATTTTAAAAGCAATGTTTTTCATT
TTTCAAATCAGAATCACTATAGTTTTGAAAAATCAATAATTAATTTATTGATTTTTCAATATAATTTTTT
GGAAAAAATAGAAAAATCCCTTTCTAAAAGTTTTAAATTTCCAAGAAAAATTCATTTTCAAAATCACCAA
CGCGCTCTATAGAGTAGTCGATGAAAATCTCCGTTAAGGGTGCATGGGCAAAACGCGCTCGAACGACAAT
TGTTATTGTATGTTTGGTCTTGCAACGAAAAGTTTGAAAAATTGAAAAAAAGTTGTGTCTGATACATTTT
TTTTTGGCATTTTCTGCTATTTTACACCAGAAAAAATTTAATAAACATAAAAAATCGAAATTTTTCAAGT
TGGACAATTTTCAGtgagcatcttatccatcctagttctcagttcaggacttgtgcacattcgtttagag
ccagatattcgcaaagccttttcaccggatgattcagatgctggataGTAAGTGACTACTGACCTTGAAG
CCTCCTTCCTCCACCAGTCAGAAATAACACGTTTTTTCGCAATGTTTTTCTTTTTCTAATTCGATTTCCC
TTTCTCCCTTTCTTATTGTGATTTGGTCAATGTTTGGTTGACTGGGAAGAAAATTGAATTTTTTTGGAAT
TCCACTTGAAGTTAAAAAACCCAAAATAAATATTTGATCAAAAATAAATAAGAAAAAAAAGAAAACTTTA
AAGCAAATGAAAATTTCGTTCGTAACTATTTTGTTAATTTTTTTAAAACTCCTATTTTAAATATATGCTT
TTTGCGGAAATTTCTATAAATTTTTTTACATTTTTCAGtgaaacccgtgtctggctggaatactacggac
tcgacatctatccggaacgagcattctgtatttttaccgccaagcgcgaaaattccagtattctccagga
aggcgcactggcagacGTAAGTTGATTCTCCGTCACGCCCACTTTTCTGGCGGGAATTTAAAAAATTTCA
Gatttatactgtggacaatcgactatcggcggcagttggctaccaagatggggatggacgaaaaaattgc
gatccactctgcgacttgaacagcccctttcacttgttagcgGTAGGTGGTGGTCTAGGGTGTCATTTTT
CGATTTTTTCAATTATTCGATGTTTTTAGTGAAAATCGAAAAATCTAAAAATTGAAAATCGAAAAATGAA
AGAAACATTGTTTTTTGGGGACCAAACATCTTAATGAATTTAACAACAGGGAAAACTGAACAGAAACCTG
GACGGTCTTATCCCATTTATCTATATTCTTAAAATGAATGATGGAGAAAAAAGTTAAAATAAAAACATTA
TCAGCTTTTTGTAAGTTTTTCTCAAAAATTGTTCGATTTTTCGATTTTCTAAAAAGTCGAAAAACCGAAA
CCCTTGGTGGTGGTGGTGGTGGACTAGAAAACTCTTCAACGACCACATGGCAATTTTCAGaatttgacgc
ggagaaacaatggtaccacaagtgtattcacctatccggatatgccatatagcggactggatattttcct
gggacttcacttgagtaatgcggattttggtaagattttttttgaaatgttaaatgaaaagttgaaaaat
agtttttatgatttagccactttccagttaaaatttcatttttttaactataaaaagttctggaaaaatg
aatttctAGgccgccgatcctaaaAGTgcaccatttcgcAGaAGTacGTacAGTttcccatctatccctA
GTgGTcttGTtttctgcattctctgcttcacGTgcttGTtttGTtggAGcgcGTttgcatgctgctttaa
attctgaaatattaaaaaaatttcgaAGTttttcAGcacatgggatgggAGTtttgaatttcaatttttt
aaaaacatttttctGTgattAGTgccGTcGTggcacggctGTtAGccgcctatccgGTttattcgatact
ttGTGAGTTTTTTGTAACTTTATGGTCGTCGAAATGGGAAAACTTGGCCACCAATATAAGTTTGGAAAAC
AATTTCCTAAAAATAAAATAATTGAACTTTTCCGATGAATAAAAAAATCGATCAGATATTCTGGAAAAAA
AATCGATAAATTAATCGATTTTCTTGGAAAATACATCGAAAAATTGAGAAAAATAGAAAAATGAATGTTT
TTCGATTACCGATTTATTGATTTTTCGTGAAAACTGAGTTCAGATAATTTTAAAAGCAATGTTTTTCATT
TTTCAAATCAGAATCACTATAGTTTTGAAAAATCAATAATTAATTTATTGATTTTTCAATATAATTTTTT
GGAAAAAATAGAAAAATCCCTTTCTAAAAGTTTTAAATTTCCAAGAAAAATTCATTTTCAAAATCACCAA
CGCGCTCTATAGAGTAGTCGATGAAAATCTCCGTTAAGGGTGCATGGGCAAAACGCGCTCGAACGACAAT
TGTTATTGTATGTTTGGTCTTGCAACGAAAAGTTTGAAAAATTGAAAAAAAGTTGTGTCTGATACATTTT
TTTTTGGCATTTTCTGCTATTTTACACCAGAAAAAATTTAATAAACATAAAAAATCGAAATTTTTCAAGT
TGGACAATTTTCAGtgAGcatcttatccatcctAGTtctcAGTtcAGgacttGTgcacattcGTttAGAG
ccAGatattcgcaaAGccttttcaccggatgattcAGatgctggatAGTAAGTGACTACTGACCTTGAAG
CCTCCTTCCTCCACCAGTCAGAAATAACACGTTTTTTCGCAATGTTTTTCTTTTTCTAATTCGATTTCCC
TTTCTCCCTTTCTTATTGTGATTTGGTCAATGTTTGGTTGACTGGGAAGAAAATTGAATTTTTTTGGAAT
TCCACTTGAAGTTAAAAAACCCAAAATAAATATTTGATCAAAAATAAATAAGAAAAAAAAGAAAACTTTA
AAGCAAATGAAAATTTCGTTCGTAACTATTTTGTTAATTTTTTTAAAACTCCTATTTTAAATATATGCTT
TTTGCGGAAATTTCTATAAATTTTTTTACATTTTTCAGTgaaacccGTGTctggctggaatactacggac
tcgacatctatccggaacgAGcattctGTatttttaccgccaAGcgcgaaaattccAGTattctccAGga
AGgcgcactggcAGacGTAAGTTGATTCTCCGTCACGCCCACTTTTCTGGCGGGAATTTAAAAAATTTCA
GatttatactGTggacaatcgactatcggcggcAGTtggctaccaAGatggggatggacgaaaaaattgc
gatccactctgcgacttgaacAGcccctttcacttGTtAGcgGTAGGTGGTGGTCTAGGGTGTCATTTTT
CGATTTTTTCAATTATTCGATGTTTTTAGTGAAAATCGAAAAATCTAAAAATTGAAAATCGAAAAATGAA
AGAAACATTGTTTTTTGGGGACCAAACATCTTAATGAATTTAACAACAGGGAAAACTGAACAGAAACCTG
GACGGTCTTATCCCATTTATCTATATTCTTAAAATGAATGATGGAGAAAAAAGTTAAAATAAAAACATTA
TCAGCTTTTTGTAAGTTTTTCTCAAAAATTGTTCGATTTTTCGATTTTCTAAAAAGTCGAAAAACCGAAA
CCCTTGGTGGTGGTGGTGGTGGACTAGAAAACTCTTCAACGACCACATGGCAATTTTCAGaatttgacgc
ggAGaaacaatgGTaccacaAGTGTattcacctatccggatatgccatatAGcggactggatattttcct
gggacttcacttgAGTaatgcggattttgGTaAGattttttttgaaatGTtaaatgaaaAGTtgaaaaat
AGTttttatgatttAGccactttccAGTtaaaatttcatttttttaactataaaaAGTtctggaaaaatG
Duplice effetto
dell’allungamento
trascrizionale
sullo
splicing alternativo:
(a) Durante una fase
di allungamento veloce,
la RNA pol II favorisce
il reclutamento dello spliceosoma
al sito forte di splicing al 3’ di un
introne a valle di un sito debole
di plicing al 3’ dell'introne a monte,
il risultato è lo skipping dell’esone.
Invece, durante un allungamento
lento (destra) viene favorito il
reclutamento dello spliceosoma
sull’introne a monte, il risultato è lo
splicing con inclusione dell'esone;
Alternative splicing: a pivotal step between eukaryotic transcription and translation - Nat Rev Mol Cell Biol. 2013 Mar;14(3):153-65.
doi: 10.1038/nrm3525 - Kornblihtt et al. - Erratum in Nat Rev Mol Cell Biol. 2013 Mar;14(3) - doi:10.1038/nrm3560
Duplice effetto dell’allungamento trascrizionale sullo splicing alternativo:
(b) quando entrambi i siti di splicing al 3’ sono ugualmente forti e l'introne a monte ha
un sito di
legame (verde) per un
fattore di
splicing che
inibisce l’inclusione dell'esone
(fattore negativo NF),
l’allungamento veloce della
Pol II (a sinistra)
favorisce il
reclutamento dello
spliceosoma su
ambedue gli introni,
garantendo l’inclusione
dell'esone. Al contrario,
l’allungamento lento (destra)
dà il tempo al fattore di splicing
negativo di legarsi prima dello
spliceosoma, che quindi si legherà
al sito di splicing al 5‘
dell'introne a valle con risultante
skipping dell’esone.
Alternative splicing: a pivotal step between eukaryotic transcription and translation - Nat Rev Mol Cell Biol. 2013 Mar;14(3):153-65.
doi: 10.1038/nrm3525 - Kornblihtt et al. - Erratum in Nat Rev Mol Cell Biol. 2013 Mar;14(3) - doi:10.1038/nrm3560
Lo splicing alternativo è governato da sequenze cis regolatorie
nel pre-mRNA,
ESE (exonic splicing enhancers)
ESS (exonic splicing silencers)
ISE (intronic splicing enhancers)
ISS (intronic splicing silencers)
e da due principali famiglie
di proteine ​regolatrici dello splicing alternativo,
•SRSF
(Ser/Arg-rich splicing factors)
•hnRNP (heterogeneous nuclear ribonucleoproteins)
Alternative splicing: a pivotal step between eukaryotic transcription and translation - Nat Rev Mol Cell Biol. 2013 Mar;14(3):153-65. doi: 10.1038/nrm3525 - Kornblihtt et al. - Erratum in
Nat Rev Mol Cell Biol. 2013 Mar;14(3). doi:10.1038/nrm3560
L’efficienza del processo di
splicing non è mai del 100%
per tutti gli esoni
Anche se le sostituzioni nella
terza base di codoni sinonimi
non cambia l’amminoacido
codificato, talvolta si produce
inaspettatamente un aumento
dell’efficienza dello splicing e
WT
AAA GAT GCT GAT TTG TAT TTA TTA GAC TCT CCT TTT GGA
A1
A2
A3
A4
A5
A6
A7
A8
A9
A10
A11
A12
AAG
AAG
AAA
AAG
AAG
AAG
AAA
AAA
AAA
AAG
AAA
AAA
GAC
GAC
GAC
GAC
GAC
GAC
GAC
GAC
GAT
GAC
GAC
GAC
GCA
GCG
GCT
GCG
GCC
GCC
GCG
GCA
GCC
GCT
GCA
GCA
GAT
GAC
GAT
GAC
GAC
GAC
GAT
GAT
GAC
GAC
GAC
GAC
TTG
TTG
TTG
TTG
TTG
TTA
TTG
TTA
TTA
TTG
TTG
TTA
TAC
TAT
TAC
TAC
TAT
TAC
TAT
TAT
TAT
TAT
TAT
TAC
TTA
TTA
TTA
TTA
TTG
TTG
TTA
TTG
TTG
TTA
TTG
TTA
TTA
TTA
TTG
TTG
TTG
TTG
TTG
TTG
TTG
TTG
TTG
TTG
GAT
GAT
GAT
GAC
GAC
GAC
GAT
GAC
GAT
GAC
GAC
GAC
TCA
TCG
TCA
TCC
TCT
TCG
TCA
TCC
TCA
TCC
TCA
TCA
CCC
CCG
CCG
CCC
CCG
CCT
CCT
CCG
CCC
CCA
CCG
CCG
TTC
TTC
TTC
TTC
TTC
TTT
TTC
TTT
TTC
TTT
TTC
TTT
GGA
GGC
GGA
GGT
GGT
GGC
GGC
GGA
GGC
GGG
GGT
GGT
A13
A14
A15
A16
A17
AAA
AAA
AAG
AAA
AAA
GAC
GAT
GAT
GAT
GAC
GCA
GCG
GCT
GCG
GCA
GAT
GAC
GAT
GAT
GAT
TTG
TTG
TTA
TTG
TTA
TAT
TAT
TAT
TAT
TAC
TTA
TTA
TTA
TTG
TTG
TTG
TTG
TTA
TTA
TTG
GAT
GAT
GAC
GAC
GAT
TCT
TCG
TCT
TCA
TCC
CCG
CCA
CCG
CCG
CCC
TTT
TTT
TTC
TTT
TTC
GGG
GGT
GGT
GGC
GGC
A18 AAA GAT GCA GAT TTG TAC TTG TTA GAC TCG CCC TTT GGC
A19 AAG GAC GCA GAT TTG TAT TTG TTA GAC TCC CCA TTC GGG
A20 AAG GAC GCT GAC TTA TAC TTG TTA GAT TCC CCT TTC GGT
A21 AAG GAT GCA GAT TTA TAT TTA TTA GAC TCC CCT TTT GGT
non una diminuzione come
ci si sarebbe invece aspettato
L’esempio sopra riportato riguarda
l’esone 12 del gene CFTR che
codifica per una proteina di
membrana (canale dello ione Cl-)
responsabile della fibrosi cistica
Assemblaggio co-trascrizionale delle
snRNP e loro rimodellamento dalla
trascrizione alla traduzione e alla
degradazione
Lo splicing che forma mRNA
avviene in modo co-trascrizionale
con l’assemblaggio delle particelle snRNP
La presenza del cap facilita lo
splicing, la formazione della
estremità 3’ e quindi l’esportazione
di mRNA attraverso i pori nucleari
Nel citoplasma, il CBC (cap-binding
complex) viene scambiato con il
fattore di inizio traduzione 4E
(EIF4E) e con il ribosoma
CPSF6 (cleavage and polyadenylation specificity factor 6), EJC (exon junction complex);
hnRNPC (heterogeneous nuclear ribonucleoprotein C), NXF1 (nuclear export factor 1),
PABPC1 (cytoplasmic poly(A) binding protein 1), PABPN1 (nuclear poly(A)-binding protein 1),
TREX1(transcription export complex 1), XRN1 (5′–3′ exoribonuclease 1).
How cells get the message: dynamic assembly and function of mRNA–protein complexes - Nat Rev Genet. 2013
Apr;14(4):275-87. doi: 10.1038/nrg3434 - Müller-McNicoll M, Neugebauer KM.
Figura – Meccanismi di esportazione di mRNP dal nucleo al citosol.
Esempi dei diversi tipi di esport di mRNP (particelle
ribonucleoproteiche messaggero) riguardanti
quattro diverse classi di trascritti della RNA
polimerasi II (Pol II) le loro diverse modalità
di uscita dal nucleo:
- mRNP mature dopo aver completato
lo splicing, sono normalmente esportate
dal nucleo tramite NXF1 (nuclear RNA
export factor 1) che viene reclutato da
complessi di proteine adattatrici, quali
TREX1 (transcription export complex 1)
ed altre (UAP56, CPSF6, UIF, SR, …)
con lunghi RNA pieni di introni che
stanno subendo splicing;
- mRNP sono troppo grandi per
passare attraverso i pori nucleari,
possono uscire attraverso la gemmazione
di vescicole dall’involucro nucleare.
- mRNA privi di introni che codificano per istoni
vengono esportati da SLBP (stem-loop-binding
protein) che viene reclutata dal CBC (cap-binding
complex) e da NELF (negative elongation factor);
- TREX2 può esportare mRNP maturi attraverso i pori
nucleari interagendo con NXF1;
- l’esportazione di lunghi trascritti privi di introni avviene
attraverso una pathway alternativa di esportazione
(ALREX = alternative RNA export) ed altre proteine
che reclutano NXF1 anche in assenza di splicing;
- piccoli trascritti senza introni vengono legati da
PHAX e sono trasportati fuori dal nucleo da altre
proteine (CRM1 e la GTPasi della famiglia RAN).
How cells get the message: dynamic assembly and function of mRNA–protein complexes -Nat Rev Genet. 2013
Apr;14(4):275-87. doi: 10.1038/nrg3434 - Müller-McNicoll Neugebauer
Packaging co-trascrizionale dell’RNA, maturazione ed esportazione di mRNA:
(a) l’assemblaggio della snRNP sul nascente pre-mRNA impedisce la formazione di
loop deleteri;
(b) splicing costitutivo: l’assemblaggio delle snRNP in corso di splicing mantiene gli
esoni consecutivi in stretta vicinanza e contribuisce a garantire il corretto ordine degli
esoni durante lo splicing;
(c) splicing alternativo e
poliadenilazione alternativa
(APA): l’assemblaggio sul
pre-mRNA potrebbe
nascondere forti siti di
splicing o esoni alternativi
per promuovere l’exon
skipping, oppure potrebbe
esporre deboli siti di splicing
per facilitare l'inclusione dell'esone durante lo splicing alternativo. Ne potrebbe
derivare l’occultamento di segnali deboli di poliadenilazione (PAS) presenti negli
introni oppure l’esposizione di PAS per una poliadenilazione (APA) alternativa.
How cells get the message: dynamic assembly and function of mRNA–protein complexes -Nat Rev Genet. 2013
Apr;14(4):275-87. doi: 10.1038/nrg3434 - Müller-McNicoll Neugebauer
Negli eucarioti lo splicing del pre-mRNA è co-trascrizionale,
spazialmente e temporalmente separato dalla traduzione
dell'mRNA che avviene fuori dal nucleo
L’assemblaggio del pre-mRNA nel complesso di splicing è
importante per l’esportazione di mRNA. Ci sono due classi
distinte di RNP competenti per l’export: lunghi mRNA, che
vengono esportati da NXF1 (nuclear export factor 1) e piccoli
RNA che vengono esportati da CRM1 (chromosomal region
maintenance protein 1) attraverso una pathway dipendente da
RAN·GTP.
Il complesso che lega il cap (CBC) è il primo evento di
elaborazione del mRNA nascente che emerge dalla Pol II.
CBC interagisce con diversi TREX1 (transcription export
complex 1).
How cells get the message: dynamic assembly and function of mRNA–protein complexes -Nat Rev Genet. 2013 Apr;14(4):275-87. doi:
10.1038/nrg3434 - Müller-McNicoll Neugebauer
Forte legame tra splicing alternativo e malattia, mutazioni nelle
sequenze regolatrici che influenzano lo splicing alternativo sono
cause diffuse di malattie ereditarie umane e di cancro
Mutazioni nelle sequenze codificanti possono essere male
interpretate considerando solo gli effetti putativi che avrebbero
nella sequenza della proteina codificata
Ad esempio, la variazione di un singolo nucleotide che non
cambia la sequenza amminoacidica di una proteina (mutazione
silente) può facilmente essere scambiata per un polimorfismo
neutrale quando in realtà potrebbe causare l’interruzione di un
ESE cruciale con conseguente origine di una patologia
Le sequenze degli esoni che codificano proteine ​sono
sottoposte a duplice pressione selettiva, (1) conservazione della
sequenza amminoacidica codificata e (2) degli elementi esonici
che regolano lo splicing alternativo del pre-mRNA
Alternative splicing: a pivotal step between eukaryotic transcription and translation - Nat Rev Mol Cell Biol. 2013 Mar;14(3):153-65.
doi: 10.1038/nrm3525 - Kornblihtt et al. - Erratum in Nat Rev Mol Cell Biol. 2013 Mar;14(3) - doi:10.1038/nrm3560
Le più note patologie causate da mutazioni cis -acting sono le
taupatie come la demenza frontotemporale con parkinsonismo,
la distrofia miotonica e l'atrofia muscolare spinale (SMA)
Anche mutazioni in geni che codificano per fattori trans-acting
che regolano lo splicing alternativo possono causare patologie.
A differenza delle mutazioni cis-acting che interessano solo il
gene compromesso, questo secondo tipo di mutazione può
influenzare grandi insiemi di geni
I disturbi più studiati che derivano da questo tipo di mutazione
sono la distrofia muscolare facioscapuloomerale e vari tipi di
tumori legati alla sovraespressione di SRSF1
La ricerca nel campo dello splicing alternativo è vitale per
prevedere i pattern di splicing alternativo e per progettare
protocolli di terapia genica in grado di correggere i difetti dello
splicing alternativo
Alternative splicing: a pivotal step between eukaryotic transcription and translation - Nat Rev Mol Cell Biol. 2013 Mar;14(3):153-65.
doi: 10.1038/nrm3525 - Kornblihtt et al. - Erratum in Nat Rev Mol Cell Biol. 2013 Mar;14(3) - doi:10.1038/nrm3560
Nel nucleo, il processo di editing
altera la sequenza degli mRNA
serve per il trasporto di
colesterolo nel sangue
serve per l’assorbimento di
lipidi nell’intestino
Il processo
di editing
dell’RNA
altera la
sequenza
di mRNA,
ad
esempio
mediante
inserzione
di uracile
(U)
mRNA maturo (dopo splicing ed eventuale
editing) che può essere esportato nel
citoplasma per essere tradotto in proteina
Author
Document
Category
Uncategorized
Views
0
File Size
2 076 KB
Tags
1/--pages
Report inappropriate content